Glycosyl transferase gene and application thereof in preparation of mogroside
By using the glycosyltransferase gene yojK1 obtained from the Bacillus subtilis genome to catalyze the extension of mogroside C3-O-Glc site to glucoside, the problem of low number and content of mogroside biosynthetic genes was solved, achieving efficient synthesis of mogroside and increased content of sweet glycosides.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-24
- Publication Date
- 2026-03-31
AI Technical Summary
In existing technologies, there are relatively few genes related to the biosynthesis of mogrosides, and the content of mogrosides in the whole fruit is extremely low, which makes product purification difficult.
The glycosyltransferase gene yojK1 obtained from the Bacillus subtilis genome can catalyze the extension of mogroside C3-O-Glc site to glucoside, which can be used to prepare high-sugar mogroside. It can also be combined with other glycosyltransferases such as UGT153033 and UGT30033 to catalyze the extraction of immature mogroside.
This study achieved efficient synthesis of mogrosides, increased the yield of mogrosides and the content of sweet glycosides, and made up for the shortcomings of existing technologies.
Smart Images

Figure CN121759486A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a glycosyltransferase gene obtained from the genome of Bacillus subtilis and its application in the preparation of mogroside. Background Technology
[0002] Natural products are bioactive substances that have been selected and optimized by nature over a long period of time, and are the most important source of drug discovery. Mogrosides are a general term for saponins isolated from *Siraitia grosvenorii*, a plant in the Cucurbitaceae family, and are a class of triterpenoid compounds. Mogrosides are the main bioactive components of *Siraitia grosvenorii*, and possess numerous pharmacological activities such as antitussive and expectorant effects, anticancer properties, antioxidant effects, and blood sugar regulation. Currently, more than 20 types of mogrosides have been isolated. However, the total saponin content in *Siraitia grosvenorii* is low, only 0.8%–1.3% (w / w) in the whole fruit, and the complex structure of these substances makes product purification difficult.
[0003] The synthesis and yield enhancement of mogrosides using biotechnology has become a research hotspot. In recent years, researchers have conducted studies on the biosynthesis of mogrosides through tissue culture and biotransformation, providing fundamental components for the production of mogrosides through synthetic biology. Itkin et al. identified glycosyltransferase UGT720-269-1, which acts on the C3-OH and C24-OH sites of mogroside derived from monk fruit, and glycosyltransferase UGT94-289-3, which acts on the C3-O-Glc and C24-O-Glc sites of mogroside IIe. Furthermore, the glycosyltransferase UGT74AC1, which acts on the C3-OH site of mogroside, identified by Sun Yuanxia's team, showed a nearly thousand-fold increase in catalytic activity after semi-rational design modification, and also gained additional C24-OH glycan elongation function. However, to date, the number of known functional genes involved in the biosynthesis of mogrosides remains relatively small, especially glycosyltransferase genes that catalyze glycan elongation. Summary of the Invention
[0004] In view of the shortcomings of existing technologies, such as the limited number of genes known to be related to the biosynthesis of mogrosides and the extremely low content of mogrosides in whole fruit, this invention provides a novel glycosyltransferase gene obtained from the Bacillus subtilis genome that can act on the CC3-O-Glc site of mogrosides to extend glucosides, and its application in the preparation of high-sugar mogrosides.
[0005] The glycosyltransferase gene provided by this invention has the nucleotide sequence shown in SEQ ID NO: 1. This glycosyltransferase gene was obtained by PCR amplification using extracted Bacillus subtilis genomic DNA as a template, primer pair yojK1-28a-F / R, and the PCR product was recovered using agarose gel electrophoresis; it is named yojK1.
[0006] In addition, the present invention also provides a glycosyltransferase encoded by the above-mentioned glycosyltransferase gene, the amino acid sequence of which is shown in SEQ ID NOs: 2.
[0007] In addition, the present invention also provides nucleic acid constructs or expression vectors containing the above-mentioned glycosyltransferase gene or expressing the above-mentioned glycosyltransferase.
[0008] In addition, the present invention also provides host cells containing the above-mentioned nucleic acid constructs or expression vectors.
[0009] Meanwhile, the present invention also provides the application of the above-mentioned glycosyltransferase, which can be used in the preparation of mogroside and its analogues by glycosyl catalytic reactions.
[0010] Meanwhile, the present invention also provides the application of the above-mentioned host cells, which can be used to prepare glycosyltransferases for glycosyl catalytic reactions, or to directly prepare mogrosides and their analogues.
[0011] Specifically, the reaction formulas for the glycosyl catalytic reactions of the aforementioned glycosyltransferases or host cells are as follows:
[0012]
[0013] In the formula, R1, R2, and R3 are H, monosaccharide glycosyl groups, or polysaccharide glycosyl groups.
[0014] The substrates R1 and R2 of formula (I) were substituted to form compounds of formula (II), as shown in Table 1.
[0015] Table 1. Production of high-glucose mogrosides catalyzed by glycosyltransferase yojK1.
[0016]
[0017] Specifically, this invention can also be used to accelerate the ripening of bitter mogrosides in immature monk fruit, thereby increasing the content of sweet glycosides in monk fruit. It can be used alone or in combination with other glycosyltransferases (such as UGT153033 and UGT30033) for better catalysis.
[0018] The beneficial effects of this invention are as follows:
[0019] 1. The glycosyltransferase gene of the present invention makes up for the deficiencies in the prior art, which is that there are few known functional genes involved in the biosynthesis of mogrosides, especially glycosyltransferase genes that can catalyze the extension of sugar chains, and that the molecular synthesis mechanism of most mogrosides has not been fully elucidated, thus providing a new gene for the synthesis of mogrosides.
[0020] 2. The glycosyltransferase identified in this invention can specifically recognize the C3-O-Glc site of mogroside, thereby achieving mogroside glycan chain elongation.
[0021] 3. The glycosyltransferase produced by the gene expression of the present invention can be used to construct a mogroside microbial cell factory using synthetic biology techniques, thereby achieving efficient synthesis of various mogrosides and increasing the synthesis pathways and yield of mogrosides.
[0022] 4. The glycosyltransferase produced by the gene expression of the present invention can realize in vitro glycosylation reaction and catalyze the generation of various mogrosides, thereby increasing the synthesis pathway and yield of mogrosides. Attached Figure Description
[0023] Figure 1 The HPLC chromatogram shows the catalysis of mogroside IIe as a glycosyl acceptor, UDP-glucose as a glycosyl donor, and the glycosyltransferase yojK1 to generate mogroside IIIx.
[0024] Figure 2 The HPLC chromatogram shows the conversion of mogroside IVx to mogroside III using mogroside III as a glycosyl acceptor and UDP-glucose as a glycosyl donor, catalyzed by the glycosyltransferase yojK1.
[0025] Figure 3 The HPLC chromatogram shows the catalysis of glycosyltransferase yojK1 to generate mogroside Vx using symmonoside I as the glycosyl acceptor and UDP-glucose as the glycosyl donor. Detailed Implementation
[0026] The present invention will be further described below with reference to the accompanying drawings. In the embodiments, unless otherwise specified, the technical means used are all conventional technical means in the art.
[0027] I. Obtaining the glycosyltransferase gene yojK1 and constructing the recombinant plasmid
[0028] Example 1
[0029] (I) Extraction of Bacillus subtilis genome
[0030] (1) Extract cells using the TaKaRaMiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0. Collect cells, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant. Add 180 μl of Buffer GL, 20 μl of Proteinase K (20 mg / ml), and 10 μl of RNase A (10 mg / ml), and mix thoroughly by vortexing. Incubate at 56°C for 10 minutes until the solution becomes transparent and clear. Add 200 μl of Buffer GB and 200 μl of 100% ethanol, and mix thoroughly by pipetting.
[0031] (2) Install the Spin Column on the Collection Tube, transfer the solution into the Spin Column, centrifuge at 12000 rpm for 2 minutes, and discard the filtrate;
[0032] (3) Add 500 μl of Buffer WA to the Spin Column, centrifuge at 12000 rpm for 1 minute, and discard the filtrate;
[0033] (4) Add 700 μl of Buffer WB to the Spin Column, centrifuge at 12000 rpm for 1 minute, and discard the filtrate;
[0034] (5) Repeat step (4);
[0035] (6) Place the Spin Column on the Collection Tube and centrifuge at 12,000 rpm for 2 minutes;
[0036] (7) Place the Spin Column on a new 1.5ml centrifuge tube, add 50-200μl of sterile water or Elution Buffer to the center of the Spin Column membrane, and let stand at room temperature for 5 minutes.
[0037] (8) Elute DNA by centrifuging at 12000 rpm for 2 minutes to obtain Bacillus subtilis DNA extract; if a larger yield is required, the elution solution can be added back to the center of the Spin Column membrane or 50-200 μl of sterile water or Elution Buffer can be added. After standing at room temperature for 5 minutes, centrifuge at 12000 rpm for 2 minutes to elute DNA.
[0038] (II) Construction of recombinant plasmids
[0039] (1) Using the extracted Bacillus subtilis genomic DNA as a template, PCR amplification was performed using primer pair yojK1-28a-F / R (see Table 2) to obtain amplification products of 1.4–1.5 kb.
[0040] (2) The PCR product was recovered by agarose gel to obtain the glycosyltransferase gene yojK1, which has the nucleotide sequence shown in SEQ ID NO: 1;
[0041] (3) The above glycosyltransferase was cloned into the pET28a plasmid to obtain the pET28a-yojK1 recombinant plasmid.
[0042] Table 2. Primer pair sequence listing yojK1-28a-F / R
[0043] Primers Sequence (5'→3') yojK1-28a-F CTCCGTCGACAAGCTTCCATGGCTAATGTATTAATGATCGGTTTCC yojK1-28a-R GTGGTGGTGGGTGCTCGAGTTATGCATTTGCTGATTGAGTTTTTTGTTTTACAG
[0044] II. Expression of the glycosyltransferase gene yojK1 in Escherichia coli
[0045] Example 2
[0046] (I) Preparation of competent Escherichia coli cells
[0047] (1) Take out the strain stored in the -80℃ freezer, streak it on an LB solid plate, and incubate it in a 37℃ incubator for 12h;
[0048] (2) Pick a single clone and place it in 5 mL of LB liquid medium and incubate it in a shaker at 37°C for 12 h;
[0049] (3) Add 3% bacterial solution to 50 mL LB liquid medium and incubate until OD600 is 0.4-0.6;
[0050] (4) Place the bacterial culture on ice to cool for half an hour, and pre-cool the centrifuge at the same time;
[0051] (5) Centrifuge at 4℃ and 3000r / min for 10min, and discard the supernatant;
[0052] (6) Add 10 mL of CaCl2-MgCl2 mixed reagent and gently blow to mix the bacterial cells;
[0053] (7) Centrifuge at 4℃ and 3000r / min for 5min, and discard the supernatant;
[0054] (8) Add 2 mL of CaCl2-glycerol mixed reagent and gently mix the bacterial cells;
[0055] (9) Dispense 100 μL into each of the pre-cooled 1.5 mL centrifuge tubes;
[0056] (10) Store at -80℃ for later use.
[0057] (II) Expression of glycosyltransferases in Escherichia coli
[0058] (1) The pET28a-yojK1 recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells by heat shock method, and the empty vector pET28a was used as a negative control;
[0059] (2) Add to the transformation system, resuspend the bacterial cells, and incubate on ice for 30 min;
[0060] (3) After heat shock in a 42℃ water bath for 90-95 seconds, immediately place on ice and incubate on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium and incubate on a shaker at 37℃ and 200 rpm for 45 minutes. Take 200 μL of bacterial culture and spread it on LB solid medium containing the corresponding antibiotic. Incubate in a constant temperature incubator at 37℃ for 12-16 hours. Select single clones for sequencing verification.
[0061] (4) Pick positive expression colonies and place them in 5 mL of LB liquid medium containing the corresponding antibiotic, and activate them at 37°C and 200 rpm for 12 h; transfer 1% bacterial culture to 50 mL of LB liquid medium containing the corresponding antibiotic for expansion culture; wait for OD 600 The concentration was 0.6-0.8, and IPTG solution with a final concentration of 0.1 mM was added; induction was performed at 16℃ and 150 rpm for 16 h.
[0062] (5) After induction, the bacterial cells were collected by centrifugation at 4°C and 6000 r / min for 15 min. The bacterial cell pellet was washed with sterile water and collected by centrifugation at 4°C and 6000 r / min for 15 min. This process was repeated twice. 3 mL of pre-cooled lysis buffer was taken and the bacterial cell pellet was resuspended on ice. The lysis buffer containing the bacterial cells was placed on an ice-water mixture. The cell lysis conditions were 30% energy, 1 second sonication followed by 2 seconds of pause, and 5 min of sonication. The solution after cell lysis was centrifuged at 4°C and 12000 r / min for 15 min. The cell lysis buffer was placed on ice for later use. The supernatant of the cell lysis buffer was used as crude enzyme solution for subsequent enzyme catalytic reaction experiments.
[0063] III. In vitro glycosylation reaction and product detection
[0064] Example 3
[0065] The cell lysate of recombinant Escherichia coli BL21(DE3)-pET32a-yojK1 obtained in Example 2 was used as the crude enzyme solution for glycosylation reaction, and the cell lysate of recombinant Escherichia coli BL21(DE3)-pET32a containing the empty vector was used as a negative control.
[0066] The glycosylation reaction system consisted of: 50 mM MgCl2, 50 mM UDP-glucose, 1 M Tris-HCl (pH = 7.5), 10 mg / mL saponin substrate, and an appropriate amount of crude enzyme solution.
[0067] The steps of the in vitro glycosylation reaction are as follows:
[0068] (1) After mixing the reaction system, react it in a water bath at 30°C for 12 hours, and then add an equal volume of n-butanol to terminate the reaction.
[0069] (2) After the n-butanol evaporates to dryness, the sample is dissolved in methanol, filtered through a 0.22μm filter, and detected by HPLC.
[0070] HPLC detection conditions: An Agilent Poroshell 120EC-C18 column (4μm, 4.6mm × 250mm) was used at a column temperature of 30℃ and a flow rate of 1.0mL / min. ELSD dual detector was employed, with an injection volume of 10μL. Binary gradient elution was used, with mobile phase A (water) and mobile phase B (acetonitrile). Elution program: 0-55 min, 22.5%-62.5% B; 55-58 min, 62.5% B; 58-60 min, 62.5%-22.5% B.
[0071] In this embodiment, the supernatant of cell lysate from recombinant Escherichia coli BL21(DE3)-pET32a-yojK1 was used as the crude enzyme solution for glycosylation. The crude enzyme solution has the amino acid sequence shown in SEQ ID NO: 2. The specific reaction is as follows:
[0072] (1) Using mogroside IIe as a glycosyl acceptor and UDP-glucose as a glycosyl donor, the glycosyltransferase yojK1 catalyzes the formation of mogroside IIIx. The HPLC identification results of the product are as follows: Figure 1 As shown;
[0073] (2) Using mogroside III as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase yojK1 catalyzes the formation of mogroside IVx. The HPLC identification results of the product are as follows: Figure 2 As shown;
[0074] (3) Using mogroside IVe as a glycosyl acceptor and UDP-glucose as a glycosyl donor, and glycosyltransferase yojK1 as a catalyst, the product was analyzed by HPLC and identified by Q Exactive quadrupole-electrostatic field orbital trap high-resolution mass spectrometry. The results showed that the product was mogroside IVe.
[0075] (4) Using mogroside IVa as a glycosyl acceptor and UDP-glucose as a glycosyl donor, and glycosyltransferase yojK1 as a catalyst, the product was analyzed by HPLC and identified by Q Exactive quadrupole-electrostatic field orbital trap high-resolution mass spectrometry. The results showed that the product was mogroside IVa.
[0076] (5) Using symbioside I as the glycosyl acceptor and UDP-glucose as the glycosyl donor, the glycosyltransferase yojK1 catalyzes the formation of mogroside Vx. The HPLC identification results of the product are as follows: Figure 3 As shown.
[0077] The reaction formula is as follows:
[0078]
[0079] In the formula, the compounds generated by substituting substrates R1 and R2 are shown in Table 3; R1, R2, and R3 are shown in Table 3.
[0080] Table 3. Synthesis of mogrosides catalyzed by glycosyltransferase yojK1.
[0081]
[0082] IV. In vitro applications of glycosyltransferases
[0083] Example 4
[0084] (I) Acquisition and expression of glycosyltransferase genes UGT153033 and UGT30033 in Escherichia coli
[0085] (1) Extraction of RNA from monk fruit
[0086] 1) Take out fresh monk fruit samples that have been stored in a -80℃ freezer for 15 days and place them in liquid nitrogen to keep the samples in an ultra-low temperature state; at the same time, pre-cool the centrifuge;
[0087] 2) Pre-cool the mortar and other containers with liquid nitrogen, remove the monk fruit sample from the liquid nitrogen, remove the foil wrapping the surface, and quickly cut the fruit into small pieces on a sterile plate using a disposable medical surgical blade and scalpel handle. Then transfer the pieces to the mortar and add liquid nitrogen to grind the fruit for a period of time until the sample is pulverized into a fine green powder.
[0088] 3) Add 100 mg of the ground powder to a centrifuge tube, resuspend the powder in 1 mL of Trizol reagent and mix well, then let stand at room temperature for 10 min.
[0089] 4) Centrifuge at 4℃ and 12000r / min for 10min;
[0090] 5) Transfer the supernatant obtained after centrifugation into a new centrifuge tube, add 200 μL chloroform, 35 μL 3 mol / L sodium acetate, 15 μL β-mercaptoethanol, and 10 μL 1% polyvinylpyrrolidone (PVP), mix thoroughly, and let stand on ice for 15 min.
[0091] 6) Centrifuge at 4℃ and 12000r / min for 10min;
[0092] 7) Transfer the supernatant obtained after centrifugation into a new centrifuge tube, add an equal volume of isopropanol and 200 μL of 3 mol / L sodium acetate, and precipitate at -20℃ for 1 h;
[0093] 8) Centrifuge at 4℃ and 12000r / min for 10min;
[0094] 9) Discard the supernatant obtained by centrifugation, and add 1 mL of pre-cooled 75% ethanol to wash the precipitate;
[0095] 10) Repeat step (9);
[0096] 11) Centrifuge at 4℃ and 12000r / min for 10min;
[0097] 12) Discard the supernatant obtained by centrifugation and vacuum dry for 2 min to reduce ethanol residue;
[0098] 13) Add 30 μL of RNase-free water and dissolve at room temperature for 5 min to obtain the monk fruit RNA extract. Store at -80℃ for later use. Take 2 μL of RNA for agarose gel electrophoresis analysis.
[0099] (2) Construction of recombinant plasmids
[0100] 1) Reverse transcription was performed using extracted monk fruit RNA as a template to obtain cDNA template; PCR amplification was performed using the cDNA template with primer pairs R-30033-F / R and R-153033-F / R (see Table 4) to obtain amplification products of 1.4–1.5 kb.
[0101] Table 4. Primer pair sequence listings R-30033-F / R and R-153033-F / R
[0102] Primers Sequence (5'→3') 30033-F AGCTCCGTCGACAAGCTTGGATGGATGCCCAGCAAG 30033-R TGGTGGTGGTGGTGCTCGAGTTAAATTGAACATGGAGCCTTTTTGCGC 153033-F GCTCCGTCGACAAGCTTGGATGGTGCAAC 153033-R TGGTGGTGGTGGTGCTCGAGTTAAAATTTATATGGTTTC
[0103] 2) The PCR products were recovered using agarose gel to obtain the glycosyltransferase genes UGT153033 (the nucleotide sequence of which is shown in SEQ ID NO: 3) and UGT30033 (the nucleotide sequence of which is shown in SEQ ID NO: 4).
[0104] 3) The above glycosyltransferase genes were cloned into the pET32a plasmid to obtain the recombinant plasmids pET32a-UGT153033 and pET32a-UGT30033.
[0105] (3) Preparation of competent Escherichia coli cells
[0106] Refer to the preparation process in Implementation 2.
[0107] (4) Expression of glycosyltransferases in Escherichia coli
[0108] The preparation process is the same as in Example 2. The difference is that the recombinant plasmids pET32a-UGT153033 and pET32a-UGT30033 were transformed into *E. coli* Rosetta (DE3) competent cells via heat shock, with the empty vector pET32a serving as a negative control. The cell lysate of the obtained recombinant *E. coli* Rosetta-pET32a-UGT153033 was used as a crude enzyme solution for glycosylation, and this crude enzyme solution has the amino acid sequence shown in SEQ ID NO: 5. The cell lysate of the obtained recombinant *E. coli* Rosetta-pET32a-UGT30033 was also used as a crude enzyme solution for glycosylation, and this crude enzyme solution has the amino acid sequence shown in SEQ ID NO: 6.
[0109] (II) In vitro application of glycosyltransferases promotes the increase of sweet glycoside content in monk fruit extract.
[0110] Fresh monk fruit samples were removed from a -80°C freezer and dehydrated in a vacuum freeze dryer for 72 hours. Appropriate amounts of sample and water were weighed at a 1:100 material-to-liquid ratio, mixed, and vortexed. The mixture was then placed in an ultrasonic water bath for extraction, sonicated at 40 kHz for 1 hour at room temperature. The supernatant was collected by centrifugation for subsequent catalysis and testing.
[0111] UGT153033, UGT30033, and yojK1 were induced and expressed, and then used to co-catalyze the immature monk fruit extract to increase the content of sweet glycosides in the extract. The contents of various mogrosides were quantitatively analyzed by LC-QQQ-MS, and the results are shown in Table 5.
[0112] Table 5. Co-catalysis of monk fruit extract by glycosyltransferases UGT153033, UGT30033, and yojK1
[0113]
[0114] In the table, MG1 represents mogroside monoglycosides (IA1, IE1); MG2 represents mogroside disaccharides (IIA1, IIA2, IIe, 11-O-IIA); MG3 represents mogroside triglycosides (IIIA1, III, IIIe, 11-O-IIIA1, 11-O-III, 11-O-IIIe); MG4 represents mogroside tetraglycosides (IVa, IVe, IVx, SMG I, 11-O-SMMG I); and MG5 represents mogroside 5glycosides (V, Vx, and 11-OV).
[0115] The results showed that, after being catalyzed by glycosyltransferase, the original higher content of MG1, MG2, and MG3 in the extract of immature monk fruit was converted into sweeter glycosides MG4 and MG5. This indicates that the glycosyltransferase can be used to accelerate the ripening of bitter mogrosides in immature monk fruit, thereby increasing the content of sweet glycosides in monk fruit.
[0116] The above embodiments are merely exemplary embodiments of the present invention and are not intended to limit the present invention. The scope of protection of the present invention is defined by the claims. Those skilled in the art can make various modifications or equivalent substitutions to the present invention within its spirit and scope of protection, and such modifications or equivalent substitutions should also be considered to fall within the scope of protection of the present invention.
Claims
1. A glycosyltransferase gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:
1.
2. A glycosyltransferase, characterized in that, Its amino acid sequence is shown in SEQ ID NO: 2, and is encoded by the glycosyltransferase gene described in claim 1.
3. A nucleic acid construct or expression vector, characterized in that, It contains the glycosyltransferase gene as described in claim 1, or expresses the glycosyltransferase as described in claim 2.
4. A host cell, characterized in that, It contains the nucleic acid construct or expression vector as described in claim 3.
5. The application of the glycosyltransferase as described in claim 2, characterized in that, Used for the preparation of mogrosides and their analogues via glycosyl catalysis.
6. An application of a host cell as described in claim 4, characterized in that, Used to prepare glycosyltransferases for glycosyl-catalyzed reactions, or to directly prepare mogrosides and their analogues.
7. The application according to any one of claims 5 or 6, characterized in that, The reaction formula for the glycosyl catalytic reaction is as follows: In the formula, R1, R2, and R3 are H, monosaccharide glycosyl groups, or polysaccharide glycosyl groups.
8. The application according to claim 7, characterized in that, The substrate for the glycosyl catalytic reaction is a compound of formula (I), and the corresponding product is a compound of formula (II). The glycosyl donor is UDP-glucose, specifically including the following: The compound of formula (I) is mogroside IIe, and the compound of formula (II) is mogroside IIIx; The compound of formula (I) is mogroside III, and the compound of formula (II) is mogroside IVx; The compound of formula (I) is mogroside IVe, and the compound of formula (II) is mogroside Ve; The compound of formula (I) is mogroside IVa, and the compound of formula (II) is mogroside Va; The compound of formula (I) is symmenidine I, and the compound of formula (II) is mogroside Vx.
9. The application according to claim 7, characterized in that, It can also be used to accelerate the ripening of bitter mogrosides in immature monk fruit, thereby increasing the content of sweet glycosides in monk fruit.