Application of recombinant human periostin in preparation of medicine for improving intervertebral disc degeneration
By inhibiting the ferroptosis of intervertebral disc nucleus pulposus cells and enhancing their antioxidant capacity through recombinant human periostin (rPOSTN), the problems of lack of precise targeting and insufficient antioxidant capacity in existing technologies are solved, and effective intervention in intervertebral disc degeneration is achieved.
Patent Information
- Application Number
- CN202510851342.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-23
AI Technical Summary
Existing anti-ferroptosis strategies lack precise targeting of intervertebral disc nucleus pulposus cells, making it difficult to achieve local and efficient intervention. In addition, existing drugs are insufficient in regulating ferroptosis and antioxidant capacity of NP cells, and the mechanism of action of POSTN in NP cell ferroptosis is unclear.
Recombinant human periostin (rPOSTN) is used to prepare drugs that inhibit ferroptosis of intervertebral disc nucleus pulposus cells, enhance total antioxidant capacity, and improve intervertebral disc degeneration.
At low concentrations, it significantly reduces erastin-induced lipid peroxidation and mortality, protects mitochondrial structure, enhances the antioxidant reserve of NP cells, achieves local sustained drug delivery, and provides new ideas for gene therapy or cell therapy.
Smart Images
Figure CN120678892A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of recombinant human periostin in the preparation of a drug for improving intervertebral disc degeneration. Background Art
[0002] Intervertebral Disc Degeneration (IDD) is the main pathological basis for low back pain and spinal dysfunction. Its core mechanism involves the functional decline of nucleus pulposus cells (NP cells) and matrix degradation. Recent studies have shown that ferroptosis, as a Fe 2+ The programmed cell death mode driven by lipid peroxidation plays a key role in the process of IDD: compounds such as ferroptosis inducer (Erastin) inhibit system Xc - The subunit SLC7A11 is activated and the activity of glutathione peroxidase 4 (GPX4) is reduced, leading to the accumulation of lipid peroxides and the 2+ Overload eventually leads to damage to the mitochondrial membrane structure, cell apoptosis and extracellular matrix degradation of NP cells, accelerating the loss of intervertebral disc height and functional impairment.
[0003] Existing anti-ferroptosis strategies mainly rely on small molecule inhibitors, but these drugs are mostly administered systemically, lack precise targeting of NP cells, and have limitations such as systemic toxicity and short metabolic half-life. In addition, although studies have suggested that the extracellular matrix glycoprotein Periostin (POSTN) can improve the oxidative stress microenvironment in bone and joint tissues, its role in regulating NP cell ferroptosis and improving overall antioxidant reserves has not been systematically verified. Therefore, the precise intervention strategy for NP cell ferroptosis in IDD still has the following technical gaps: (1) There is a lack of combined regulatory means for NP cell ferroptosis and antioxidant capacity; (2) Existing drugs are not targeted enough, making it difficult to achieve local and efficient intervention; (3) The mechanism of action and application value of POSTN in NP cell ferroptosis have not yet been clarified. Summary of the Invention
[0004] The present invention aims to provide the use of recombinant human periostin in the preparation of a drug for improving intervertebral disc degeneration. The drug improves intervertebral disc degeneration by inhibiting ferroptosis of intervertebral disc nucleus pulposus cells, enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells.
[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0006] Application of recombinant human periostin (rPOSTN) in the preparation of drugs for improving intervertebral disc degeneration.
[0007] Preferably, the drug improves intervertebral disc degeneration by inhibiting ferroptosis of intervertebral disc nucleus pulposus cells and enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells.
[0008] The present invention also provides the use of recombinant human periostin in the preparation of a drug for resisting ferroptosis of intervertebral disc nucleus pulposus cells.
[0009] Preferably, the drug is used to inhibit lipid peroxidation and cell death induced by ferroptosis inducers, and protect mitochondrial morphology.
[0010] The present invention also provides the use of recombinant human periostin in the preparation of a drug for enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells.
[0011] The present invention also provides a pharmaceutical composition comprising the recombinant human periostin and a pharmaceutically acceptable carrier.
[0012] Preferably, the pharmaceutical composition is used to resist ferroptosis of intervertebral disc nucleus pulposus cells, enhance the total antioxidant capacity of intervertebral disc nucleus pulposus cells, and improve intervertebral disc degeneration.
[0013] The present invention also provides the use of POSTN gene as a drug target in the preparation of drugs for improving intervertebral disc degeneration.
[0014] Preferably, the expression product of the POSTN gene is the recombinant human periostin, and the synthesis amount of the recombinant human periostin is regulated by regulating the expression of the POSTN gene.
[0015] Preferably, the ferroptosis of intervertebral disc nucleus pulposus cells is prevented and the total antioxidant capacity of intervertebral disc nucleus pulposus cells is enhanced by regulating the expression of POSTN gene, and the regulation of POSTN gene expression is to overexpress the POSTN gene.
[0016] Compared with the prior art, the present invention has the following advantages and technical effects:
[0017] (1) The present invention discloses the use of recombinant human periostin in the preparation of drugs for improving intervertebral disc degeneration. The rPOSTN specifically inhibits the ferroptosis of intervertebral disc nucleus pulposus cells. At a low concentration of 100-200 ng / mL, it can significantly reduce erastin-induced lipid peroxidation and mortality, and protect the mitochondrial ultrastructure.
[0018] (2) Bidirectional verification of POSTN gene regulation: POSTN overexpression significantly enhanced the antioxidant reserve of NP cells and reduced ferroptosis sensitivity; POSTN knockdown weakened the cell antioxidant capacity and aggravated ferroptosis of intervertebral disc nucleus pulposus cells.
[0019] (3) Low-concentration rPOSTN can be combined with degradable carriers (such as hydrogels and nanoparticles) to achieve local and continuous drug delivery to the intervertebral disc; the POSTN gene regulation method provides ideas for future gene therapy or cell therapy; the present invention can be used in combination with existing Ferrostatin-1, iron chelators, etc. to synergistically delay IDD.
[0020] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is a bar graph showing the effects of rPOSTN (100 ng / mL, 200 ng / mL) on lipid peroxidation in NP cells under the condition of Erastin (1 μM) in Example 1;
[0022] Figure 2 TEM diagram of mitochondrial morphology of NP cells in each treatment group under the condition of Erastin (1 μM) in Example 1;
[0023] Figure 3 The cell death rate test results of each treatment group in Example 1, wherein, Figure 3 A in the figure is a schematic diagram of the control group, knockdown group and overexpression group. Figure 3 B in the figure is the bar chart of the control group and the knockdown group. Figure 3 C in the figure is the control overexpression histogram;
[0024] Figure 4 is a bar graph of the total antioxidant capacity of NP cells in each treatment group in Example 1, wherein: Figure 4 A in the figure is the total antioxidant capacity of the control group, knockdown group, and overexpression group. Figure 4 B in the figure shows the effect of exogenous addition of different concentrations of rPOSTN on antioxidant capacity. DETAILED DESCRIPTION
[0025] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0026] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.
[0027] Source of test materials:
[0028] Recombinant human periostin (rPOSTN) was purchased from Ablome at concentrations ranging from 100 ng / mL to 200 ng / mL.
[0029] DMEM / F12 culture medium included 10% FBS and 1% double antibody.
[0030] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.
[0031] Example 1
[0032] POSTN gene overexpression (POSTN OE) was performed as follows: a lentiviral vector (pLenti-CMV-POSTN) was used to construct a POSTN overexpression lentiviral nucleotide sequence as shown in SEQ ID NO. 1; primary human NP cells were infected for screening to obtain a stable overexpression cell line.
[0033] SEQ ID NO.1:
[0034]
[0035] POSTN gene knockdown (POSTN ShRNA), the experimental plan is as follows: the shRNA (Sh-2) nucleotide sequence targeting POSTN mRNA is designed as shown in SEQ ID NO.2, and it is cloned into the Lv-ShPOSTN vector; human primary NP cells are infected with lentivirus to obtain a stable knockdown cell line.
[0036] SEQ ID NO.2: CAGCGCCTCCTTAAATTAATT
[0037] Cell sources and culture conditions:
[0038] Primary human NP cells were obtained from healthy donor intervertebral discs. After dissociation by collagenase type II digestion, cell phenotype was confirmed using Collagen II and Aggrecan immunofluorescence (Collagen II). Cells were cultured in DMEM / F12 medium at 37°C in a 5% CO2 incubator and were used in all experiments after passage 3.
[0039] Trial groups:
[0040] (1) Control group (NC): starvation medium without Erastin and rPOSTN, empty vector gene background (Con OE).
[0041] (2) Erastin model group (Erastin): Erastin 1 μM, empty vector gene background (Con OE).
[0042] (3) Erastin+rPOSTN group: Erastin 2μM+rPOSTN 100ng / mL.
[0043] (4) Erastin+rPOSTN group: Erastin 2μM+rPOSTN 200ng / mL.
[0044] Main detection methods and implementation steps:
[0045] 1. Lipid peroxidation detection (BODIPY-C11 staining + flow cytometry). The test principle is that BODIPY-C11 emits green light (Ex 488nm / Em 510nm) in its unoxidized state and emits red light (Ex 488nm / Em 585nm) after lipid peroxidation. An increase in the red / green ratio indicates increased peroxidation.
[0046] The experimental plan is as follows:
[0047] (1) Cell inoculation and treatment: NP cells of each group were inoculated into 6-well plates (3×105 Cells were attached for 24 hours and then starved for 12 hours. Erastin (2 μM) and / or rPOSTN (100 ng / mL, 200 ng / mL) were added simultaneously according to the group and incubated for 12 hours.
[0048] (2) BODIPY-C11 staining: After treatment, cells were washed twice with PBS. BODIPY-C11 (final concentration 2 μM) was added and incubated at 37°C in the dark for 30 min. Cells were washed twice with PBS, collected, and resuspended in 500 μL PBS.
[0049] (3) Flow cytometry: The instrument parameters are 488 nm excitation light; collecting 510 / 30 nm (green) and 585 / 40 nm (red) channel signals; collecting ≥1×10 4 For each cell event, first circle the live cell population on the FSC / SSC graph, then calculate the red / green fluorescence ratio. FlowJo software counts the proportion of lipid peroxidation-positive cells (above the red channel threshold) and exports the data. Figure 1 .
[0050] Depend on Figure 1 It can be seen that the C11+ positive staining ratio of nucleus pulposus cells in the Erastin-treated group was significantly increased. After exogenous addition of rPOSTN, 100 ng / mL could alleviate the C11+ ratio, and 200 ng / mL could restore it to normal levels, indicating that rPOSTN has the ability to enhance cell resistance to ferroptosis.
[0051] 2. Mitochondrial morphology observation (transmission electron microscopy, TEM). The experimental principle is as follows: Ferroptosis characteristically causes mitochondrial volume reduction, membrane structure wrinkling or rupture, and a significant reduction or even disappearance of cristae. These ultrastructural pathological changes can be visually observed using TEM.
[0052] The experimental plan is as follows:
[0053] (1) Sample fixation: After the cells were passaged to P3, they were rinsed twice with PBS. The cell pellet was collected by gentle scraping and centrifuged at 300 × g for 5 min. The cells were then fixed with freshly prepared 2.5% glutaraldehyde (PBS, pH 7.4) for 2 h at 4°C.
[0054] (2) Dehydration and embedding: wash with PBS three times, 10 min each time; dehydration with gradient ethanol (30%, 50%, 70%, 80%, 90%, 100%, 10 min each); dehydration with acetone twice (gold: 10 min); embedding with Epon resin: soak in acetone / resin 1:1 for 2 h, pure resin for 4 h; polymerization at 60°C overnight.
[0055] (3) Ultrathin sectioning and staining: Ultrathin sections of 60-80 nm were cut using an ultrathin microtome; staining was performed with lead acetate and uranyl acetate at room temperature for 5 min each.
[0056] (4) TEM observation and photography: Using FEI Tecnai G2 Spirit TEM (120kV accelerating voltage), randomly select ≥10 fields of view; observe and photograph at least 100 mitochondrial instances in each group, and record the proportion of ferroptosis characteristics (shrinkage, cristae disappearance). The results are as follows Figure 2 .
[0057] Depend on Figure 2 It can be seen that a large number of mitochondrial shrinkage and cristae damage occurred in the Erastin group; the morphology of the Erastin+rPOSTN group was closer to the control group, and the rPOSTN concentration of 200 ng / mL was better than the rPOSTN concentration of 100 ng / mL.
[0058] 3. Cell mortality detection (PI staining + flow cytometry). The experimental principle is as follows: PI (propidium iodide) can penetrate dead or late apoptotic cells, causing nuclear staining to show a strong red signal; living cells are not stained by PI.
[0059] The experimental plan is as follows:
[0060] (1) POSTN gene regulation: POSTN OE group: P2 human primary NP cells were infected with lentiviral vector (MOI = 20), the culture medium was changed after 24 hours, and then puromycin (2-4 μg / mL) was used for screening for 48 hours to obtain a stable overexpression cell line; Con OE group: empty vector infection and the same puromycin screening process; POSTN Sh-2 group: P2 cells were infected with LV-ShPOSTN, and the culture medium was changed after 48 hours; after stable knockdown, they were used for experiments.
[0061] (2) Grouping and Erastin Treatment: Con OE, POSTN OE, and POSTN Sh-2 cells were seeded in 6-well plates (3×10 5 cells / well), adhered for 24 h, and starved for 12 h; Erastin was not added to the control group and POSTN OE group; Erastin (2 μM) was added to the Con OE+Erastin group, POSTN OE+Erastin group, and POSTN Sh-2+Erastin group, and incubated for 12 h.
[0062] (3) PI staining: After treatment, cells were washed twice with PBS; cells were collected and resuspended in 500 μL PBS, PI staining solution (1 μg / mL) was added, and incubated in the dark for 10 min; flow cytometry: excitation at 561 nm, PI signal was collected at 670 / 30 nm channel, and ≥1×10 4 FlowJo software was used to count the proportion of PI-positive cells, and the range of PI-negative fluorescence intensity was confirmed by using an empty control tube. The number of PI-positive cells was circled and a histogram was drawn. The results were shown in the figure. Figure 3 .
[0063] Depend on Figure 3 It can be seen that knocking down POSTN significantly increased the cell death rate under the stimulation of the same concentration of Erastin. Figure 3 As can be seen from C in Figure 3, overexpression of POSTN significantly reduced the cell death rate under the stimulation of the same concentration of Erastin.
[0064] 4. Total Antioxidant Capacity Test (T-AOC), the test principle is as follows: T-AOC (Total Antioxidant Capacity) kit measures the sample's resistance to 2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonicacid) (ABTS· + ) The reducing ability of free radicals reflects the overall antioxidant reserve of cells.
[0065] The test method is as follows:
[0066] (1) Cell pretreatment: Con OE, POSTN OE, and POSTN Sh-2 cells were seeded in 6-well plates (3 × 10 5 cells / well), adhered for 24 h, and starved for 12 h; Erastin (2 μM) and rPOSTN (100 ng / mL, 200 ng / mL) were added according to the group and treated for 12 h; the rPOSTN group was treated with rPOSTN only;
[0067] (2) Sample preparation: After treatment, wash the cells twice with PBS; add appropriate amount of cell lysis buffer and lyse at 4°C for 30 min; centrifuge at 12000×g for 15 min, and collect the supernatant (total cell protein solution).
[0068] The protein concentration was determined by BCA method with a determination range of 1-2 mg / mL.
[0069] (3) T-AOC assay: Prepare according to the kit instructions: take 20 μL of sample or antioxidant standard of known concentration (such as Trolox), add 180 μL of reaction buffer, and incubate at 37°C for 20 min; after lysis at 37°C, measure the absorbance (OD) at a wavelength of 520 nm using a microplate reader; calculate the total antioxidant capacity (U / mg protein) of the sample using the standard curve.
[0070] (4) Result processing: Three biological replicates were performed for each group; One-way ANOVA was performed using GraphPad Prism 9.0, with Tukey correction for multiple comparisons; the data were expressed as mean ± SD; p < 0.05 was considered significant. Figure 4 As shown, the T-AOC levels of each group were compared.
[0071] Depend on Figure 4 It can be seen that in the POSTN OE group, T-AOC was significantly higher than that in the Con OE group; in the POSTN Sh-2 group, T-AOC was significantly lower than that in the Con OE group; in the Erastin+rPOSTN group, compared with the Con OE+Erastin group, T-AOC levels in the L-rPOSTN and H-rPOSTN groups increased significantly, and the effect of H-rPOSTN was better.
[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of recombinant human periostin in the preparation of drugs for improving intervertebral disc degeneration.
2. The application according to claim 1, characterized in that The drug inhibits the ferroptosis of intervertebral disc nucleus pulposus cells, thereby enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells and improving intervertebral disc degeneration.
3. Application of recombinant human periostin in the preparation of anti-ferroptosis drugs for intervertebral disc nucleus pulposus cells.
4. The application according to claim 3, characterized in that The drug is used for inhibiting lipid peroxidation and cell death induced by ferroptosis inducers, and protecting mitochondrial morphology.
5. Application of recombinant human periostin in the preparation of drugs for enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells.
6. A pharmaceutical composition, characterized in that The invention comprises the recombinant human periostin according to claim 1 and a pharmaceutically acceptable carrier.
7. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition is used for resisting ferroptosis of intervertebral disc nucleus pulposus cells, enhancing the total antioxidant capacity of intervertebral disc nucleus pulposus cells, and improving intervertebral disc degeneration.
8. Application of POSTN gene as a drug target in the preparation of drugs to improve intervertebral disc degeneration.
9. The use according to claim 1 or 8, characterized in that: The expression product of the POSTN gene is the recombinant human periostin according to claim 1, and the synthesis amount of the recombinant human periostin is regulated by regulating the expression of the POSTN gene.
10. The use according to claim 8, characterized in that: The ferroptosis of intervertebral disc nucleus pulposus cells is prevented by regulating the expression of POSTN gene, and the total antioxidant capacity of intervertebral disc nucleus pulposus cells is enhanced. The regulation of POSTN gene expression is to overexpress the POSTN gene.