NDRV sigma C circular RNA vaccine and application thereof

The NDRVσC circular RNA vaccine constructed through the T4 phage type I intron self-splicing system and chitosan-polyethylenimine nanoparticle delivery system solves the problems of limited safety and immune effects of existing vaccines and achieves efficient immune protection.

CN120683132APending Publication Date: 2025-09-23SICHUAN AGRI UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510823151.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-06-18
Filing Date
2025-06-19
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing NDRV vaccines have problems with safety and limited immune effects, especially inactivated vaccines have limited immune effects, attenuated vaccines have the risk of reversion to virulence, subunit vaccines have weak immunogenicity, recombinant viral vector vaccines have the risk of genetic recombination and strict storage conditions, and circular RNA vaccines have not been reported for NDRV.

Method used

CircRNA-σC was constructed using the T4 phage type I intron self-splicing system, and the NDRVσC circular RNA vaccine was prepared using a chitosan-polyethylenimine nanoparticle delivery system. The T4 phage type I cyclization system was used to circularize linear RNA to form circRNA-σC, and chitosan-polyethylenimine nanoparticles were combined to improve delivery efficiency and safety.

Benefits of technology

The NDRVσC circular RNA vaccine with high stability, high safety and high immunogenicity has been achieved, which significantly improved the immune response and antibody titer of ducklings, provided strong protection against NDRV, and avoided the risk of genetic recombination and storage conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683132A_ABST
    Figure CN120683132A_ABST
Patent Text Reader

Abstract

The invention discloses an NDRV [sigma] C circular RNA vaccine and application thereof, and belongs to the technical field of vaccines.Duck hepatitis A virus type 1 (DHAV-1) UTR and T4 bacteriophage I type intron self-splicing cyclization systems are adopted to construct circular RNA (CirRNA-[sigma] C) for expressing NDRV [sigma] C protein, and a vaccine preparation is prepared through a chitosan-polyethyleneimine (CS-PEI) nano delivery system. The feasibility of a circular RNA vaccine system based on DHAV-1UTR in poultry vaccines is confirmed for the first time, the established nano delivery technology and circular RNA vaccine platform have the characteristics of high stability, good safety, strong immunogenicity and the like, and an important technical path is provided for development of novel vaccines of NDRV and other viral epidemic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of vaccines, and in particular to an NDRVσC circular RNA vaccine and applications thereof. Background Art

[0002] Novel duck reovirus disease, also known as "duck hemorrhagic necrotizing hepatitis" and "flower liver disease," is a serious infectious disease caused by infection with the novel duck reovirus (NDRV), resulting in high morbidity and mortality rates that severely impact the duck farming industry. The disease is primarily characterized by severe hemorrhagic and necrotic lesions in the liver and spleen, with a mortality rate of approximately 5.0% to 50%. Novel duck reovirus (NDRV) is a segmented, spherical, non-enveloped double-capsid RNA virus. Sigma C (σC) is the primary structural protein of NDRV and a key target for viral invasion, directly involved in the receptor-binding process for viral attachment to host cells. Studies have also shown that σC is the primary immunogenic protein of NDRV, effectively activating both humoral (IgG, neutralizing antibodies) and cellular (Th1 / Th2, CTL) responses in the host, with antibody titers positively correlated with protective efficacy after immunization. Currently, there are no effective prevention and control measures for NDRV, and vaccines are an effective means of preventing and controlling viral infection.

[0003] Vaccines targeting NDRV mainly include inactivated vaccines, attenuated vaccines, and subunit vaccines. Inactivated vaccines have good safety, but limited immune effects. Attenuated vaccines can induce a strong immune response, but there is a risk of reversion to virulence. In recent years, subunit vaccines based on σC and σB proteins, recombinant viral vector vaccines, and nucleic acid vaccines have attracted widespread attention due to their high efficiency and safety. Subunit vaccines are highly safe but have weak immunogenicity and incomplete antigenic epitopes. Recombinant viral vector vaccines, on the other hand, have problems such as the risk of genetic recombination, interference from pre-existing immunity, and strict vaccine storage conditions. Among nucleic acid vaccines, circular RNA vaccines have shown significant advantages due to their unique structure and have become an emerging direction in vaccine research and development. Circular RNA vaccines mainly have three core advantages: high stability, high biosafety, and sustained translation efficiency. Circular RNA is a single-stranded RNA with a covalently closed structure. The covalently closed structure gives it resistance to nuclease degradation, and its half-life is 3-5 times longer than that of linear RNA. It self-activates innate immunity through the RIG-I / MDA5 pathway, and can induce Th1 / CTL polarization without exogenous adjuvants, achieving synergy of humoral and cellular immunity. There is no risk of genome integration, avoiding the biosafety risks of recombinant viral vectors. The in vitro transcription circularization process can achieve mass production within 7 days, and a single vector can concatenate multiple antigen epitopes, which is suitable for emergency prevention and control of emerging animal diseases. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide an NDRVσC circular RNA vaccine and its application. The present invention successfully prepares circular RNA (CircRNAσC) by using the T4 phage type I intron self-splicing system, encapsulates CircRNAσC through the delivery material CS-PEI and successfully delivers it to cells for protein expression. The obtained NDRVσC circular RNA vaccine (CircRNA-σC-CS-PEI) can effectively induce ducklings to produce a rapid immune response and has good immunogenicity; it provides strong protection against NDRV attacks and provides a reference for the prevention and control of animal diseases caused by NDRV.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides a circRNA-σC, wherein the circRNA-σC is constructed by the following steps:

[0007] (1) The T7 in vitro transcription promoter shown in SEQ ID NO.1, the first homology arm shown in SEQ ID NO.2, the first T4 phage type I circularization system shown in SEQ ID NO.3, the second T4 phage type I circularization system shown in SEQ ID NO.4, and the second homology arm shown in SEQ ID NO.5 were sequentially cloned into the pUC57 vector to construct a circularization vector;

[0008] (2) linearizing the circularized vector obtained in step (1) to obtain a linearized vector, and sequentially cloning the first DHAV-1 UTR shown in SEQ ID NO.6, the signal peptide shown in SEQ ID NO.7, the NDRVσCCDS sequence shown in SEQ ID NO.8, and the second DHAV-1 UTR shown in SEQ ID NO.9 into the linearized vector to obtain a recombinant vector;

[0009] (3) Using the recombinant vector obtained in step (2) as a template, T7 RNA polymerase is used to perform in vitro transcription to obtain a linear precursor, and the linear precursor is catalyzed to form a self-splicing cyclization reaction of circRNA-σC.

[0010] The first T4 phage type I circularization system and the second T4 phage type I circularization system both consist of introns and exons.

[0011] In step (3), when the catalytic linear precursor self-splicing cyclization reaction forms CircRNA-σC, the introns in the first T4 phage type I cyclization system and the second T4 phage type I cyclization system as well as the first homology arm and the second homology arm are cut off.

[0012] The T7 in vitro transcription promoter (SEQ ID NO.1) is as follows:

[0013] TAATACGACTCACTATAGG.

[0014] The first homology arm (SEQ ID NO.2) is as follows:

[0015] GGGAGACCCTCGACCGTCGATTGTCCACTGGTC.

[0016] The first T4 phage type I circularization system (SEQ ID NO.3) is as follows:

[0017] AACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACG TCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAA GAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCAC.

[0018] The second T4 phage type I circularization system (SEQ ID NO.4) is as follows:

[0019] GAGACGCTACGGACTTAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTC AAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAAT TAGTAAG.

[0020] The second homology arm (SEQ ID NO.5) is as follows:

[0021] ACCAGTGGACAATCGACGGATAACAGCATATCTAGTTT.

[0022] The first DHAV-1 UTR (SEQ ID NO.6) is as follows:

[0023] TTTGAAAGCGGGTGCATGCATGGCCATTTTCCAGCACAGGTTCAGCTGGTATGGCATGCATGCATCGACTGCTTGGGGGTGTCCCTGACCCCCTTAATTCAACGTCTAGCCCACGATACGGACACCCTATCCAATTTGTTTCCCTTTACCTCCCATGGACTGACTTGTATGGACATGGATCTAAATTGGATTATCCTTTACTTGTGGTGGTTAGCCAACCATGCTCTGGTGTAATGATCCCATGTGTTCATCTGGCTAAGTGCCGACCTAGGAGGTGGTGCTGAAATATTGCAAGCCACTAGCGTCGTTACACTTGACCTCTGGATACGTAGGATTAATTGCATTCTGTACAGAGGAAGGCTAGTCTATGCCTTGGGCTAATGGTCTTCGTTGTGAAACGGATTACCGGTAGTAGCATCTTAGACTACCAAGGTTGTAGGTGAGTGTGTGGTCTAGAGTAGGCACATATCTGTCCAGGCACATGCACATTGTTGCGATTGCTCCAGACTAGTTCCTGAGGGACAGATGTTGTGGGGGGCTCGGGAAAACCCCCTTAACCTACACTGCCTGATAGGGTCGCGGCTGGTCGAGTCCCACACACTATAATACCAGTAGACTTTCATGAA。

[0024] The signal peptide (SEQ ID NO.7) is specifically as follows:

[0025] GATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTT CGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGA。

[0026] The function of the signal peptide is to guide the translated protein to be secreted outside the cell.

[0027] The NDRV σC CDS sequence (SEQ ID NO.8) is specifically as follows:

[0028] ATGGATCGCAACGAGGTGATACGCCTGATACTTTCCCTCCTCCCCTACCAGTCAAGCGACGTCGATCATTTGACGACACAGATCAAATCCCTCCAAAGCGCCGTCGACTCACTGAAAGAATCACAAGTGGTAGTGTTGAGACGCCTGACTACGATTACGTCGACGGTGGCGGATCTACAATCAACAACTGAATTGTTGGCCTCACAGGTGGCAGGACTTAGTTCCCGTGTGGCTTCAGTGACTGATGAGGTAGTCCGTGTAAATTCAGTAATTGGAACTACGATCACTAATCTTGACAGTGTCCGGTCCGAGCTATCCTCTCTCTCCTCCCAAGTCTCGTCGCAGACGTCCACTCTAACGAATCTTACATCAACCGTTTCATCCCAGTCTCTTGCGATTTCTGATCTCCAGCGACGAGTTACGGCCTTAGAACGATCGGGTGGTGCGCCGATGCAATTTGAAGCTCCCTTGCACCTACAAAACGGAATCGTCTCACTTCAAGCATCTCCCTCTTTCTGTTCTTTGTCTCCGATCCTCTCCGGACCTGCTGATGCTGCTGTCTTTAAGGTTGGTGAGTGGCTGGGAACTGTCATATCTGGTCAAAGTCAGTCATCTGCAATCATGAACGTGCGGCTTCATTCATTTGGGCAGCGGACCATGTTGCTTATGTCTTCACAAAATGTATTCACTATTCCGCCAGGTTCGGGTGCGTCTTTGCAACTAGATGTGAATCGTATAACGACCCCTGCCATTGACGCTGCTATGGTGACTCCTTCCGCTGCTTTTGCTTCTGCTTCCTTTATGGCTGACATAGCTTTCAAAGACTCGAAGACAGGAGAAGTCCATGCTTTACACACTACTGGCTCTTTTCGATCACCTTCTTTCTCTATCGTTTGGGTCCCGGTTGCTTCGGAAACTCGTAATTATCAAATAATGGCGTTACGCTTCACCGTCGCCACGGGC。

[0029] The second DHAV-1 UTR (SEQ ID NO.9) is as follows:

[0030] ACTGTTGGTCCGCAGGTACCATAAACCTGTTTTTCCTGGGTTTTAGTGTTGTGGGATACCCAGGAGTACACGTAAAACACCCACTGGCTTTGGAGCTGTGCCACATGACACCTCCCAGCTTGACAGTGCTGTCAGAAACTGTTGTATAGGAATAGGCT AAAACTAATCAATTTAACCCCATGATTGTTTAGGTATTAGTTGTTAGTATTTAGTATAAGACATTTGGTGATATAAAGACCTCACACAATCTCCACTTTCCGTGAGGACCCTAAGCCAAATGACTTCTTTTTACTTTACTATTCCCTACCCTACATAA.

[0031] The advantage of the circular RNA (CircRNA-σC) prepared by adding elements in this application over the existing circular RNA (natural circular RNA) is that the expression of the target protein can be achieved by replacing the gene fragment of the target protein in the circularized vector, which is beneficial to the engineered protein production and vaccine development.

[0032] Specifically, the role of the T4 phage type I circularization system is to circularize the linear RNA obtained by in vitro transcription to generate circular RNA; the complementary binding of the homologous arms at both ends can shorten the spatial distance between the introns and exons of the T4 phage type I circularization system, thereby promoting the circularization reaction; the first DHAV-1UTR contains an IRES element, and the IRES element in the first DHAV-1UTR belongs to the type IV internal ribosome entry site, which is used to initiate the translation of circular RNA protein. Therefore, a circular vaccine for NDRV prevention and control is prepared based on DHAV-1UTR.

[0033] The IRES element sequence contained in the first DHAV-1 UTR is shown in SEQ ID NO. 10, and is specifically as follows:

[0034] AGCGTCGTTACACTTGACCTCTGGATACGTAGGATTAATTGCATTCTGTACAGAGGAAGGCTAGTCTATGCCTTGGGCTAATGGTCTTCGTTGTGAAACGGATTACCGGTAGTAGCATCTTAGACTACCAAGGTTGTAGGTGAGTGTGTGGTCTAGAGT AGGCACACATTCTGTCCAGGCACATGCACATTGTTGCGATTGCTCCAGACTAGTTCCTGAGGGACAGATGTTGTGGGGGGCTCGGGAAAACCCCCTTAACCTACACTGCCTGATAGGGTCGCGGCTGGTCGAGTCCCACACACTATAATACCAGTAGACT.

[0035] In step (2), the circularized vector is linearized by restriction enzyme cutting sites Not I and Bgl II.

[0036] In step (3), the self-splicing cyclization reaction temperature is 55° C., and the reaction time is (20-25) min.

[0037] Preferably, in step (3), the self-splicing cyclization reaction temperature is 55° C. and the reaction time is 20 min.

[0038] In a second aspect, the present invention provides the use of the above-mentioned CircRNA-σC in the preparation of poultry vaccines.

[0039] In a third aspect, the present invention provides an NDRVσC circular RNA vaccine, wherein the NDRVσC circular RNA vaccine uses the above-mentioned CircRNA-σC as an active ingredient.

[0040] The NDRVσC circular RNA vaccine further comprises chitosan-polyethyleneimine nanoparticles.

[0041] Vaccine development requires a safe and effective adjuvant or antigen delivery system. The chitosan-polyethyleneimine (CS-PEI) system is constructed through the physicochemical synergy of chitosan (CS) and polyethyleneimine (PEI). Chitosan's biocompatibility neutralizes PEI's cytotoxicity, while its mucus adhesion prolongs the antigen's retention time in the mucosa. PEI, through its "proton sponge effect," promotes endosomal escape, enhancing the efficiency of nucleic acid intracellular delivery (transfection efficiency is 2.3 times higher than that of a single vector).

[0042] Chitosan-polyethyleneimine delivery mechanism: ① The CS outer layer protects nucleic acids from enzymatic degradation and enhances mucosal uptake through mucin interactions; ② The PEI core compresses nucleic acids (encapsulation efficiency >90%), buffering the acidic environment of the endosomal membrane and promoting nucleic acid release into the cytoplasm; ③ The two components synergistically activate the TLR4 / MyD88 and RIG-I pathways, enhancing dendritic cell maturation and antigen cross-presentation. By balancing delivery efficiency and biosafety, chitosan-polyethyleneimine provides key technical support for the clinical translation of nucleic acid vaccines.

[0043] The chitosan-polyethyleneimine nanoparticles are prepared by electrostatic adsorption and chemical cross-linking of chitosan and polyethyleneimine, and the mass ratio of chitosan to polyethyleneimine is (160-162):43.

[0044] Preferably, the mass ratio of chitosan to polyethyleneimine is 161:43.

[0045] The chitosan-polyethyleneimine nanoparticles have a particle size of 100-200 nm and a Zeta potential of +14 mV.

[0046] The circRNA-σC was mixed with chitosan-polyethyleneimine nanoparticles at an N / P ratio of 1:1, and vortexed and incubated for 25-30 minutes to form the NDRVσC circular RNA vaccine (circRNA-σC-CS-PEI).

[0047] The immunization dose of the vaccine for ducklings is 5-20 μg / each, the time of the first immunization is 3 days old, the time of the booster immunization is 17 days old, and the immunization route is leg muscle injection.

[0048] In a fourth aspect, the present invention provides use of the above-mentioned NDRVσC circular RNA vaccine in the preparation of a medicament for preventing duck reovirus infection.

[0049] Beneficial effects of the present invention:

[0050] The present invention innovatively uses the duck hepatitis A virus type 1 (DHAV-1) UTR and the T4 phage type I intron self-splicing circularization system to construct a circular RNA (circRNA-σC) expressing the NDRVσC protein, and prepares the vaccine preparation through a chitosan-polyethyleneimine (CS-PEI) nanodelivery system. Experimental data showed that dynamic light scattering and transmission electron microscopy characterization showed that CS-PEI nanoparticles can stably encapsulate circRNA-σC to form nanoparticles with uniform particle size (circRNA-σC-CS-PEI). Animal experiments showed that after ducklings were immunized with circRNA-σC-CS-PEI, the titers of serum NDRV-specific antibodies and neutralizing antibodies were significantly increased compared with the inactivated vaccine group and the linear RNA group (P<0.0001), and the protection effect against virus was excellent. This invention confirms for the first time the feasibility of a circular RNA vaccine system based on DHAV-1UTR in poultry vaccines. The established nano-delivery technology and circular RNA vaccine platform have the characteristics of high stability, good safety, and strong immunogenicity, providing an important technical path for the development of new vaccines for NDRV and other viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Schematic diagram of the construction process of circRNA-σC excluding the T7 in vitro transcription promoter.

[0052] Figure 2 The figure shows the in vitro transcription and circularization of NDRVσC. Lane M: DL5,000 DNA Marker; lane Precursor: RNA precursor after in vitro transcription; lane Circular: circular RNA after catalytic circularization; lane Circular+R: circular RNA after RNase R enzyme digestion.

[0053] Figure 3 Figure 2 is the cyclization efficiency diagram of NDRVσC.

[0054] Figure 4 This is the N / P screening diagram for CS-PEI encapsulated CircRNAσC.

[0055] Figure 5 This is an electron micrograph of CircRNA-σC-CS-PEI liposome nanoparticles.

[0056] Figure 6 This is the expression of CircRNA-σC-CS-PEI at the cellular level.

[0057] Figure 7 For the delivery of circRNA-σC-CS-PEI at the tissue level.

[0058] Figure 8Figure 2 shows the specific antibody levels induced by circRNA-σC-CS-PEI in ducklings.

[0059] Figure 9 Figure 2 shows the neutralizing antibody level induced by circRNA-σC-CS-PEI in ducklings.

[0060] Figure 10 Figure 2 shows the specific lymphocyte proliferation level induced by circRNA-σC-CS-PEI in ducklings.

[0061] Figure 11 The weight growth rate of the experimental ducks in the clinical trial

[0062] Figure 12 Changes in autopsy of experimental ducks in clinical trials

[0063] Figure 13 This is a picture of the pathological tissue sections of the test ducks in the clinical experiment. DETAILED DESCRIPTION

[0064] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0065] As previously mentioned, novel duck reovirus disease (NDRV) is caused by infection with a novel duck reovirus, resulting in high morbidity and mortality, severely impacting the duck farming industry. Vaccines are an effective means of combating NDRV infection. While linear mRNA is widely used in vaccines, no circular RNA vaccines targeting NDRV have been reported.

[0066] Based on this, the present invention provides a novel duck reosome σC circular RNA vaccine and its application. The constructed circRNA-σC-CS-PEI vaccine can effectively stimulate the body's immune protection response against NDRV. This circular RNA vaccine combines the safety and immunogenicity of subunit vaccines with the ability to stimulate a comprehensive immune response in a short period of time, thus possessing broad development and application prospects.

[0067] In the present invention, the circRNA-σC-CS-PEI vaccine is constructed by the T4 phage type I intron self-splicing system, which has the following advantages:

[0068] High stability and long-term expression: circRNA can resist nuclease degradation without chemical modification, maintaining longer-lasting antigen expression in vivo;

[0069] High safety: the 5'-end cap structure of linear mRNA is easily recognized by pattern recognition receptors (such as RIG-I), triggering an innate immune response. CircRNA, lacking such a structure, can reduce the release of inflammatory factors, and circRNA vaccines do not trigger significant cytokine storms or tissue pathological damage. The protein translation efficiency is high. By optimizing the IRES sequence or introducing the m6A modification, the translation efficiency of circRNA can be increased by 2.5 times compared to traditional mRNA.

[0070] In summary, based on the research on NDRV pathology, the inventors of the present invention have obtained a circular RNA vaccine CircRNA-σC-CS-PEI with good preventive effect. This vaccine has no side effects, can induce higher antibody titers and has a good immune effect against NDRV, and can be widely used in the immune prevention work of NDRV.

[0071] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0072] The test materials used in the examples and comparative examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0073] The NDRV strain used in the examples of the present invention is NDRV-TH11, which is described in Chen Z, Zhu Y, Li C, Liu G. Epidemic-associated novel duck reovirus, China, 2011. Emerg Infect Dis. 2012 Jul;18(7):1209-11. doi:10.3201 / eid1807.120190. PMID: 22709408; PMCID: PMC3376814.

[0074] Example 1: Preparation of CircRNA-σC

[0075] (1) The T7 in vitro transcription promoter shown in SEQ ID NO.1, the first homology arm shown in SEQ ID NO.2, the first T4 phage type I circularization system shown in SEQ ID NO.3, the second T4 phage type I circularization system shown in SEQ ID NO.4, and the second homology arm shown in SEQ ID NO.5 were cloned into the pUC57 vector in sequence to construct a circularization vector. This process was completed by Qingke Biotechnology Co., Ltd.

[0076] (2) The synthesized circularized vector was linearized by the reserved restriction enzyme cutting sites (Not I, Bgl II) to obtain a linearized vector. The first DHAV-1 UTR shown in SEQ ID NO.6 (connected by the EcoRV restriction enzyme cutting site), the signal peptide shown in SEQ ID NO.7, and the second DHAV-1 UTR shown in SEQ ID NO.9 (connected by the XhoI restriction enzyme cutting site) were cloned into the linearized vector in sequence;

[0077] The CDS sequence of NDRVσC was consulted by NCBI, and primers shown in SEQ ID NO.11-SEQ ID NO.12 were designed to amplify linear σC. The linear σC was then ligated with the linearized vector through homologous recombination to construct a recombinant vector.

[0078] FW:

[0079] GCCAGGAAATCCATGCCCGATTCAGAAGAGGATCCGATCGCAACGAGGTG (SEQ ID NO. 11);

[0080] RV: CCTGCGGACCAACAGTCTCGAGCTAGCCCGTGGCGACGGTGAAGCG (SEQ ID NO. 12).

[0081] (3) Using the recombinant vector obtained in step (2) as a template, T7 RNA polymerase was used to transcribe the linear precursor in vitro. The in vitro transcription PCR program was: incubate at 37°C for 3 h. The transcription system was as shown in Table 1.

[0082] Table 1: In vitro transcription system

[0083]

[0084] After the reaction was completed, 1 μL of DNase I was added to each tube and incubated at 37°C for 15 min to remove the template DNA.

[0085] A GTP solution with a final concentration of 2 mM was added to the transcription system and incubated at 55°C for 20 min to catalyze the self-splicing and circularization of the linear precursor to form CircRNA-σC (at this time, CircRNA-σC was not purified and some linear precursors may still exist).

[0086] RNase R exonuclease can degrade linear RNA but retain circular RNA, so RNase R was used for treatment. The RNase R digestion system is shown in Table 2.

[0087] Table 2: RNaseR digestion system

[0088]

[0089] The reaction system was placed in a 37°C water bath and incubated for 20 min.

[0090] The RNA sample treated with the enzyme digestion system was purified as follows to obtain pure CircRNA-σC.

[0091] Purification was performed using the RNA Clean and Concentrator Kit and the APExBIO kit. The specific steps are as follows:

[0092] (1) Adjust the RNA sample to 100 μL with elution buffer and mix gently. Add 350 μL of binding concentrate solution to the sample and mix gently by pipetting. Add 250 μL of anhydrous ethanol to the sample and mix gently by pipetting.

[0093] (2) Assemble the column and collection tube, pipette the mixture onto the column, and centrifuge at 10,000-14,000 rpm for 1 minute. Repeat the process, add 500 μL of washing solution, and centrifuge at 10,000-14,000 rpm for 1 minute until the washing solution passes through the column.

[0094] (3) After discarding the washing solution, continue centrifugation for 10-30 seconds to ensure that the washing solution is fully removed.

[0095] (4) Place the column after thorough centrifugation in step (3) into a new collection tube, add 50 μL of elution buffer to the center of the column, incubate at 65-70°C for 6 minutes, and centrifuge at 1000 rpm for 1 minute to recover the eluted RNA. To maximize RNA recovery, add another 50 μL of elution buffer to the center of the column and repeat the elution process. Collect the eluate into the same tube to obtain purified circRNA-σC.

[0096] Example 2: Preparation and Detection of CircRNA-σC-CS-PEI

[0097] The charge ratio (N / P) of the CS-PEI / RNA complex is defined as the molar relationship of the amine groups (representing positive charge) in the cationic molecule to the phosphate groups (representing negative charge) in the RNA.

[0098] The prepared CS-PEI of different concentrations (0.625-80 mM) was mixed with the purified CircRNA-σC prepared in Example 1. The N / P ratio of CS-PEI and CircRNA-σC was 0.1-4. The mixture was vortexed for 30 seconds, allowed to stand for 30 minutes, and RNA loading buffer was added. The mixture was incubated at 75°C for 10 minutes. Nucleic acid electrophoresis was performed to detect the packaging effect of CS-PEI of different concentrations and circular RNA. The packaging effect was as follows: Figure 4 shown.

[0099] (3) CircRNA-σC-CS-PEI electron microscopy detection

[0100] CircRNA-σC-CS-PEI nanoparticles prepared with a 1:1 N / P ratio of CS-PEI and circRNA-σC were diluted 100-fold and subjected to transmission electron microscopy (TEM). A 10-μL aliquot was placed on a copper grid and allowed to stand for 10 minutes. Excess liquid was removed with filter paper, and the morphology of the circRNA-σC-CS-PEI nanoparticles was observed under infrared light using a Talos L120C microscope (Thermo Fisher).

[0101] The test results showed that CS-PEI nanoparticles can stably encapsulate CircRNA-σC to form nanoparticles with uniform particle size circRNA-σC-CS-PEI ( Figure 5 ).

[0102] Example 3: Expression of CircRNA-σC-CS-PEI in cells (293T)

[0103] Place the cell slides in a 12-well plate for cell plating. After 12-16 hours, mix CircRNA-σC-CS-PEI with Lipo2000 transfection reagent (N / P ratio 1:1) to prepare transfection complex. Transfect 2 μg of CircRNA-σC-CS-PEI per well and incubate at room temperature for 5 minutes. Add cells to the wells and culture in a 37°C cell culture incubator. After 48 hours, perform the following operations:

[0104] 1. Fixation: Before collecting the slides, wash away any dead cells remaining on the cell surface with PBS. Then, add 500 μL of 4% paraformaldehyde to each well and fix overnight at 4°C. The next day, wash with PBST for 5 minutes each time, three times.

[0105] 2. Permeabilization: Add 200 μL of 0.25% Triton X-100 to each well and permeabilize at 4°C for 30 min. Wash with PBST for 5 min each time, three times.

[0106] 3. Blocking: Add 200 μL of 5% BSA to each well and block at 37°C for 2 hours (prepare blocking solution with PBST). Then wash with PBST for 5 minutes each time, three times. The steps for preparing PBST blocking solution are as follows:

[0107] (1) Measure 100 mL of PBS (10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, pH 7.4).

[0108] (2) Add 0.1 mL of Tween-20 and vortex to mix to obtain PBST.

[0109] (3) Weigh 5 g of BSA (must be protease-free, IgG-free molecular biology grade, such as Sigma A7906).

[0110] (4) Slowly add BSA to PBST and stir magnetically (4°C) until completely dissolved (about 30 minutes). Filter sterilize (0.22 μm filter membrane), and store at -20°C after aliquoting (avoid repeated freezing and thawing).

[0111] 4. Primary antibody incubation: Add 200 μL of mouse anti-Myc antibody diluted with 5% BSA (1:500) to each well, incubate at 4°C overnight, and then wash the unbound antibody with PBST for 5 minutes each time, three times.

[0112] 5. Secondary antibody incubation: add 200 μL of green fluorescent goat anti-rabbit diluted with 5% BSA (1:500) to each well and incubate at 37°C for 1 hour. After 1 hour, wash the unbound antibody with PBST for 5 minutes each time, 3 times.

[0113] 6. DAPI nuclear staining: Add 200 μL of DAPI diluted with PBS (1:1000) to each well to stain the cell nucleus, incubate at 37°C for 15 minutes, and then wash the unbound DAPI with PBST for 5 minutes each time, three times.

[0114] 7. Observation: Place the slide upside down on a glass slide containing 50% glycerol and observe the protein expression under an inverted fluorescence microscope and take photos.

[0115] The results showed that circRNA-σC-CS-PE could be expressed as a protein in HEK293T cells.

[0116] Example 4: Animal Immune Effect Detection

[0117] 1. Detection of circRNA-σC-CS-PEI delivery at the tissue level

[0118] Eighty three-day-old ducklings were randomly divided into four groups, each containing 20 ducklings: the mock group, the inactivated NDRV-SDYK-4 group, the 10 μg lineRNA-σC-CS-PEI group (referred to as lineRNA-σC, with a 1:1 N / P ratio of linear σC to CS-PEI), and the 10 μg circRNA-σC-CS-PEI group (referred to as circRNA-σC, with a 1:1 N / P ratio of circRNA-σC to CS-PEI). Three-day-old ducklings in each group received a primary immunization. A secondary booster immunization was administered intramuscularly at 17 days of age in all groups, except the inactivated NDRV-SDYK-4 group. The specific immunization patterns of each group are shown in Table 3.

[0119] When the ducklings were 31 days old, NDRV (TCID 50 =10 7.5 / mL), 1mL / bird. After 24 hours, the liver, spleen, kidney, and muscle of the ducklings were taken to extract RNA and quantitatively detect the delivery of circRNA-σC-CS-PEI at the tissue level. The test results showed that the delivery efficiency of circRNA-σC-CS-PEI was the highest in muscle ( Figure 7 ).

[0120] Table 3 Grouping and immunization of experimental animals

[0121]

[0122] 2. Detection of specific antibody levels induced by circRNA-σC-CS-PEI in ducklings

[0123] The purified CircRNA-σC-CS-PEI protein was diluted to 2.5 μg / mL using ELISA coating solution. After dilution, 100 μL / well was added to a 96-well microplate and coated at 4°C for 16 hours. After 16 hours, the liquid in the microplate was discarded, and the plate was patted dry. 200 μL of 1% BSA was added to each well and blocked at 37°C for 2 hours. After 2 hours, the liquid in the microplate was discarded and each well was washed 3-4 times with 200 μL of washing solution for 5 minutes each time. After each wash, the microplate was patted dry. After washing, the serum to be tested was coated with 1% BSA. Diluted 1:80, added to the enzyme-labeled plate, 100 μL / well, reacted at 37°C for 60 minutes; discarded the liquid in the enzyme-labeled plate after 1 hour, washed 3-4 times with washing solution (washing method is the same as above), added 100 μL diluted HRP-labeled goat anti-duck IgY (1:300) to each well, reacted at 37°C for 60 minutes; discarded the liquid in the microplate after 1 hour, washed 3-4 times as above, added 100 μL substrate TMB to each well, incubated at room temperature in the dark for 15 minutes; added 50 μL stop solution, 50 μL / well, mixed gently, and detected the OD value at a wavelength of 450 nm on an enzyme-labeled instrument. The test results showed that circRNA-σC-CS-PEI induced higher levels of specific antibodies in ducklings ( Figure 8 ).

[0124] 3. Detection of neutralizing antibody levels induced by circRNA-σC-CS-PEI in ducklings

[0125] Neutralizing antibody levels were detected by preparing duck embryo fibroblasts (DEF) according to the laboratory exploratory method. The method for preparing duck embryo fibroblasts is as follows:

[0126] (1) Duck embryo processing: Open the eggshell with a blunt end, remove the duck embryo aseptically and place it in a pre-cooled culture dish; remove the head, limbs and internal organs, and retain the trunk tissue; rinse with PBS buffer three times until there is no blood stain.

[0127] (2) Tissue digestion: Cut the trunk into 1mm pieces 3 Tissue blocks; add 0.25% trypsin (pre-cooled at 4°C) and digest at 4°C for 12-16 hours (or in a 37°C water bath for 15-20 minutes); add serum-containing culture medium to terminate digestion and disperse cells by pipetting.

[0128] (3) Cell isolation and culture: The cell suspension was filtered through a funnel with filter paper to remove undigested tissue; the cell suspension was resuspended in complete culture medium and inoculated into a culture dish; the cell suspension was cultured in a 37°C, 5% CO2 incubator, and the medium was changed for the first time after 24 hours.

[0129] DEF was prepared as described above and inoculated into 96-well plates. The plates were then incubated at 37°C in a 5% CO2 incubator for 24-36 hours. The complement of each duckling group was inactivated by placing the serum in a 56°C water bath for 30 minutes. After inactivation, the serum was sterilized by filtration using a 0.22 μm filter in a clean bench. The filtered serum was serially diluted with DMEM at a ratio of 1:10, 1:20, 1:40, 1:80, 1:160, and 1:320.

[0130] Dilute NDRV to 100 TCID 50 / mL; the diluted serum and diluted virus were mixed in equal volumes, incubated in an incubator for 1 hour after mixing, and 200 μL / well was added to a 96-well plate, which was placed in a CO2 incubator for 5-7 days; the cell lesions were observed under a microscope daily, and the number of wells with lesions at each dilution was counted. The serum dilution that can protect 50% of the cells from developing lesions was calculated using the Reed-Muench method. This dilution is the neutralizing antibody titer of the serum.

[0131] Neutralizing antibody test results showed that ( Figure 9 ): 14 days after immunization, there was no statistical difference in the circRNA-σC immunization group (geometric mean titer GMT = 73.55) and the NDRV-SDYK-4 inactivated virus immunization group (GMT = 58.5), but both were significantly higher than the lineRNA-σC immunization group (GMT = 35.75; P < 0.001); 28 days after immunization, there was no statistical difference in the circRNA-σC group (geometric mean titer GMT = 73.55) and the NDRV-SDYK-4 inactivated virus immunization group (GMT = 58.5), but both were significantly higher than lineRNA-σC 10 μg (GMT = 42.3; P < 0.001).

[0132] 4. Detection of specific lymphocyte proliferation levels induced by circRNA-σC-CS-PEI in ducklings after immunization

[0133] 28 days after immunization, peripheral blood mononuclear cells (PBMC) were isolated from the jugular vein blood of each group of ducklings using a lymphocyte separation kit (Duck Peripheral Blood Lymphocyte Separation Liquid Kit Catalog No.: P5720, Beijing Solebeau Technology Co., Ltd.). PBMC were resuspended in DMEM complete medium containing 10% FBS, and the cells were seeded into 96-well plates with 100 μL per well. Subsequently, each sample was stimulated with 100 μL complete medium (DMEM) containing purified σC antigen (20 μg / ml), and four replicates were set up. The proliferation activity was measured by the CCK-8 method, and the test results are shown as follows: Figure 10 shown.

[0134] 5. Evaluation of immune protection efficacy

[0135] (1) Post-challenge autopsy lesions

[0136] On the 5th day after the challenge, the experimental ducks were autopsied, and the liver, spleen, bursa of Fabricius, and thymus were collected. The pathological changes observed were recorded by taking photos. Figure 12 ).

[0137] Biopsy results revealed numerous punctate hemorrhages and necrotic lesions in the liver parenchyma of ducks in the mock group, as well as grayish-white necrotic lesions (1-2 mm in diameter) in the spleen and subthymic hemorrhage. These typical lesions were not detected in the NDRV-SDYK-4 immunization group or the 10 μg circRNA-σC immunization group. Notably, occasional hemorrhages in the liver and congestion and enlargement of the spleen were observed in the 10 μg lineRNA-σC immunization group, demonstrating significantly higher pathological damage compared to the 10 μg circRNA-σC immunization group.

[0138] (2) Preparation of pathological sections

[0139] Preparation of pathological tissue sections of experimental ducks, preparation steps are as follows:

[0140] Sampling and Fixation: Tissue should be cut with a sharp knife or scissors. When cutting tissue blocks, pull the knife backward from the base of the knife. Tissue blocks should be approximately 0.2-0.3 cm thick and ideally 1.5 cm x 1.5 cm x 0.3 cm in size. Tissue blocks should be fixed in 10% formalin solution for 24-48 hours. Dewaxing: Xylene is typically used for dewaxing. Rehydrate with a gradient of ethanol and rinse with tap water. Hematoxylin staining: After hydration, sections are immersed in hematoxylin solution for 5-20 minutes to stain cell nuclei. Rinse with tap water for 3-5 minutes. Differentiate with 1% hydrochloric acid and ethanol for 5-30 seconds. Rinse with tap water for 1-3 minutes. Bluing with a weak alkaline solution for 30 seconds to 1 minute. Rinse thoroughly with tap water for 5-10 minutes. Eosin staining: After hydration, sections are directly immersed in eosin solution to stain the cytoplasm for approximately 5-15 minutes. Dehydrate with a gradient of ethanol and clear with xylene. Mount with neutral gum.

[0141] HE staining pathological sections showed that the liver cells in the mock group were damaged, with structural destruction, condensed nuclei and disappearance, and infiltration of red blood cells and lymphocytes. In contrast, the liver cells in the 10μg circRNA-σC and NDRV-SDYK-4 inactivated virus immunization groups showed no obvious cytopathic changes and intact structures, while the livers in the 10μg LineRNA-σC group showed red blood cell infiltration. These results indicate that immunization with 10μg circRNA-σC and NDRV-SDYK-4 inactivated virus played a strong protective role for the experimental ducks against NDRV attack ( Figure 13 ).

[0142] In summary, the circular RNA vaccine CircRNA-σC-CS-PEI of the present invention is constructed by inserting the NDRV σC gene into a T4 phage type I intron self-splicing circularization vector to construct a circularized recombinant plasmid; then in vitro transcription and circularization are performed to obtain the circular RNA CircRNA-σC; CircRNA-σC is encapsulated in CS-PEI to form liposome nanoparticles, namely the immunogenic circular RNA vaccine CircRNA-σC-CS-PEI. Compared with the inactivated NDRV vaccine, it has an improved effect on the immunogenicity and protective performance of the vaccine.

[0143] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent replacements, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A circRNA-σC, characterized in that The CircRNA-σC is constructed by the following steps: (1) The T7 in vitro transcription promoter shown in SEQ ID NO.1, the first homology arm shown in SEQ ID NO.2, the first T4 phage type I circularization system shown in SEQ ID NO.3, the second T4 phage type I circularization system shown in SEQ ID NO.4, and the second homology arm shown in SEQ ID NO.5 were sequentially cloned into the pUC57 vector to construct a circularization vector; (2) linearizing the circularized vector obtained in step (1) to obtain a linearized vector, and sequentially cloning the first DHAV-1 UTR shown in SEQ ID NO.6, the signal peptide shown in SEQ ID NO.7, the NDRVσCCDS sequence shown in SEQ ID NO.8, and the second DHAV-1 UTR shown in SEQ ID NO.9 into the linearized vector to obtain a recombinant vector; (3) Using the recombinant vector obtained in step (2) as a template, T7 RNA polymerase is used to perform in vitro transcription to obtain a linear precursor, and the linear precursor is catalyzed to form a self-splicing cyclization reaction of circRNA-σC.

2. CircRNA-σC according to claim 1, characterized in that The first T4 phage type I circularization system and the second T4 phage type I circularization system both consist of introns and exons.

3. CircRNA-σC according to claim 1, characterized in that In step (3), the self-splicing cyclization reaction temperature is 55° C., and the reaction time is (20-25) min.

4. Use of the circRNA-σC according to claim 1 in the preparation of poultry vaccines.

5. A NDRVσC circular RNA vaccine, characterized in that The NDRVσC circular RNA vaccine uses the CircRNA-σC described in claim 1 as an active ingredient.

6. The NDRVσC circular RNA vaccine according to claim 5, characterized in that The NDRVσC circular RNA vaccine further comprises chitosan-polyethyleneimine nanoparticles.

7. The NDRVσC circular RNA vaccine according to claim 6, characterized in that The mass ratio of chitosan to polyethyleneimine in the chitosan-polyethyleneimine nanoparticles is: (160-162):

43.

8. The NDRVσC circular RNA vaccine according to claim 7, characterized in that The chitosan-polyethyleneimine nanoparticles have a particle size of 100-200 nm and a Zeta potential of +14 mV.

9. The NDRVσC circular RNA vaccine according to claim 6, characterized in that The circRNA-σC is mixed with chitosan-polyethyleneimine nanoparticles at an N / P ratio of 1:1, and vortexed and incubated for 25-30 minutes to form the NDRVσC circular RNA vaccine.

10. Use of the NDRVσC circular RNA vaccine according to claim 5 in the preparation of a medicament for preventing duck reovirus infection.

Citation Information

Cited By

  • Circular RNA (Ribonucleic Acid) and application thereof in trichomonad pigeon vaccine

    CN121737164A