Zanthoxylum bungeanum PDS gene VIGS silencing vector, silencing system and construction method and application of zanthoxylum bungeanum PDS gene VIGS silencing system

Abstract

The invention discloses a zanthoxylum bungeanum PDS gene VIGS silencing vector, a silencing system and a construction method and application thereof, and belongs to the technical field of biology. According to the method, a VIGS silencing system containing the pepper PDS gene is constructed, pTRV1 plasmids are cooperated, pepper stems are infected through an agrobacterium-mediated method, PDS gene silencing is achieved, the PDS expression level is effectively reduced, and the whitening phenomenon of plants is caused. By optimizing vector design and operation conditions, efficient and specific silencing of a target gene can be realized in a natural growth environment of a pepper plant, a complicated in-vitro culture step is not needed, and the time from gene silencing to phenotype observation is remarkably shortened, so that a rapid, simple, convenient and efficient new method is provided for research of pepper gene functions. The method has the effects of promoting the process of pepper gene function identification, providing powerful support for breeding and genetic improvement of pepper excellent varieties, and further promoting upgrading and sustainable development of pepper industry.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Zanthoxylum bungeanum PDS gene VIGS silencing vector, a silencing system, and a construction method and application thereof. Background Art

[0002] Zanthoxylum bungeanum is a plant with important economic and medicinal value. Its fruit is rich in various bioactive components, such as volatile oils, alkaloids, and flavonoids. It is not only widely used in food seasoning but also possesses pharmacological properties such as anti-inflammatory, antibacterial, and antioxidant properties. In recent years, with increasing interest in healthy diets and natural medicines, market demand for Zanthoxylum bungeanum has continued to grow. However, the genetic regulatory mechanisms underlying Zanthoxylum bungeanum's growth and development, quality development, and response to environmental stress remain largely unknown, hindering the selection and production of superior Zanthoxylum bungeanum varieties.

[0003] Gene silencing technology has become an important tool in recent years for studying plant gene function and genetic improvement. By specifically inhibiting the expression of target genes, its function in plant growth, development, and physiological processes can be studied. Virus-induced gene silencing (VIGS) is a widely used gene silencing method. It is rapid, efficient, and easy to use, and has been successfully applied to the study of a variety of plants, such as tomatoes, peppers, and peanuts. VIGS inserts target gene fragments into viral vectors and utilizes the viral replication and transcription mechanisms to induce silencing of endogenous plant genes, thereby enabling rapid identification of gene function.

[0004] Phytoene desaturase (PDS) in Zanthoxylum bungeanum is a key enzyme in the carotenoid biosynthesis pathway, primarily involved in the conversion of phytoene to ζ-carotene. The PDS gene encodes a polypeptide consisting of three helical α-sequences and is present in plant chloroplasts as a cysteine ​​transmembrane structure. This protein inhibits the production of octadecenoic acid within chloroplasts, participating in processes such as thermotolerance and cold tolerance and photosynthetic synthesis, thus possessing crucial physiological functions. Silencing the PDS gene blocks the carotenoid biosynthesis pathway, leading to photooxidative degradation of chlorophyll and albinism in plants. The advantages of using this gene for gene silencing in plants are: 1. It is widely present and highly conserved in plants; 2. Silencing the gene results in an albinism phenotype that is directly observable, making screening simple and phenotypic.

[0005] Despite the success of VIGS in many plants, Zanthoxylum bungeanum (Zanthoxylum bungeanum) remains a unique challenge for gene silencing studies. The complex genome of Zanthoxylum bungeanum and the lack of efficient genetic transformation systems make traditional gene silencing methods difficult to apply effectively in Zanthoxylum bungeanum. Furthermore, the long growth cycle of Zanthoxylum bungeanum, which takes several years from seed germination to flowering and fruiting, further complicates the study of gene function. Therefore, developing a non-in vitro gene silencing technique for Zanthoxylum bungeanum is of great significance. Summary of the Invention

[0006] The present invention aims to provide a Zanthoxylum bungeanum PDS gene VIGS silencing vector, silencing system, and construction and application thereof to address the aforementioned problems of the prior art. By optimizing vector design and operating conditions, this technology enables gene silencing in the natural growth environment of Zanthoxylum bungeanum plants, eliminating the need for in vitro culture or complex genetic transformation procedures. This provides a new, efficient and convenient method for studying Zanthoxylum bungeanum gene function.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a Zanthoxylum bungeanum PDS gene VIGS silencing vector. The silencing vector comprises a pTRV2 vector and a specific fragment of the Zanthoxylum bungeanum PDS gene. The nucleotide sequence of the specific fragment is shown in SEQ ID NO.1.

[0009] The present invention also provides a method for constructing the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1, comprising the following steps:

[0010] The specific fragment described in claim 1 is connected to the pTRV2 vector to construct the silencing vector PDS-pTRV2.

[0011] Preferably, the specific fragment is obtained by PCR amplification; the primer pair used for PCR amplification includes an upstream primer PDS-TRV2-F and a downstream primer PDS-TRV2-R; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5.

[0012] The present invention also provides a Zanthoxylum bungeanum PDS gene VIGS silencing system, which comprises: a mixed solution of an Agrobacterium liquid containing pTRV1 and an Agrobacterium liquid containing the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1; the volume ratio of the Agrobacterium liquid containing pTRV1 and the Agrobacterium liquid containing the Zanthoxylum bungeanum PDS gene VIGS silencing vector is 1:1.

[0013] The present invention also provides application of the Zanthoxylum bungeanum PDS gene VIGS silencing vector or silencing system in identifying the function of the Zanthoxylum bungeanum PDS gene.

[0014] The present invention also provides a method for identifying the function of the Zanthoxylum bungeanum PDS gene, comprising the following steps:

[0015] Preferably, the silencing system infects the Zanthoxylum bungeanum stems in vitro and then continues to culture, and observes the phenotypic changes of the leaves; when the leaves lose their green color and turn white or light yellow, it indicates that the Zanthoxylum bungeanum PDS gene is functional.

[0016] Preferably, the infection method includes: piercing the stem of Zanthoxylum bungeanum, injecting the silencing system into the stem of Zanthoxylum bungeanum by wrapping the wound with a water-absorbing material soaked in bacterial solution, and infecting in the dark for 12 hours; the Agrobacterium includes Agrobacterium GV3101.

[0017] Preferably, before using the silencing system to infect the Zanthoxylum bungeanum stem in vitro, the method further includes the steps of resuspending the Agrobacterium containing the Zanthoxylum bungeanum PDS gene VIGS silencing system in a resuspension solution, adding acetosyringone, and standing in the dark; the standing time is 2 to 3 hours; and the resuspension solution contains MgCl2·6H2O and MES.

[0018] Preferably, the conditions for continued cultivation are 16 h light / 8 h dark mode, temperature 22±3° C., air humidity 80%, and light intensity 2000 lux.

[0019] The present invention also provides the application of the Zanthoxylum bungeanum PDS gene VIGS silencing vector or the Zanthoxylum bungeanum PDS gene VIGS silencing system in the breeding of excellent Zanthoxylum bungeanum varieties and genetic improvement.

[0020] The present invention discloses the following technical effects:

[0021] The gene silenced in this study is Zanthoxylum bungeanum phytoene dehydrogenase (PDS), a key enzyme in the carotenoid biosynthesis pathway, primarily involved in the conversion of phytoene to zeta-carotene. Silencing the PDS gene blocks the carotenoid biosynthesis pathway, leading to photooxidative degradation of chlorophyll and albinism in the plant.

[0022] The present invention, by optimizing vector design and operating conditions, can achieve efficient and specific silencing of target genes in the natural growth environment of Zanthoxylum bungeanum plants, without the need for complex in vitro culture steps, significantly shortening the time from gene silencing to phenotypic observation, thereby providing a fast, simple and efficient new method for the study of Zanthoxylum bungeanum gene functions. Its effect is to promote the process of Zanthoxylum bungeanum gene function identification, deeply reveal the genetic regulatory mechanism of Zanthoxylum bungeanum growth and development, quality formation and stress resistance and other traits, provide strong support for the breeding and genetic improvement of Zanthoxylum bungeanum fine varieties, and then promote the upgrading and sustainable development of the Zanthoxylum bungeanum industry. For example, by silencing the key genes related to the aroma synthesis of Zanthoxylum bungeanum fruit, its metabolic regulatory mechanism can be studied in depth, providing guidance for cultivating Zanthoxylum bungeanum varieties with high aroma content. In addition, this technology can also be applied to the research on Zanthoxylum bungeanum resistance to pests and diseases, by silencing genes related to disease and pest resistance, exploring its resistance mechanism, and providing a new strategy for the disease and pest control of Zanthoxylum bungeanum. In short, the research on Zanthoxylum bungeanum gene silencing technology under non-isolated conditions will open up new paths for scientific research and production applications of Zanthoxylum bungeanum, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Figure 1 is the result of agarose gel electrophoresis detection of PDS gene clone;

[0025] Figure 2 Figure 1 is the result of PCR identification of competent E. coli colonies transformed with PDS; Maker is the standard DNA molecule; 1-4 are positive colonies of E. coli transformed with PDS;

[0026] Figure 3 This is the colony image of Agrobacterium transformed with PDS-pTRV2 and pTRV1;

[0027] Figure 4 Figure 1 is the agarose gel electrophoresis detection result of PCR identification of Agrobacterium tumefaciens transformed with PDS-pTRV2; Maker is the standard DNA molecule; 1-6 are positive colonies of Agrobacterium tumefaciens transformed with PDS-pTRV2;

[0028] Figure 5 This is a picture of PDS-pTRV2 infecting Zanthoxylum bungeanum;

[0029] Figure 6 This is a comparison of Zanthoxylum bungeanum plants before and after silencing;

[0030] Figure 7 This is the final effect after infection. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Experimental Materials

[0038] 1.1 Strains and vectors

[0039] Strains: Escherichia coli DH5α, Agrobacterium tumefaciens GV3101;

[0040] Plasmids: pTRV1, pTRV2.

[0041] 1.2 Reagents and kits

[0042] Reagents: DNA Marker DL2000, MgCl2, NaCl, acetosyringone (AS), 2-(N-morpholino)ethanesulfonic acid (MES), agar powder, yeast extract, tryptone, kanamycin (Kana), rifampicin (Rif), 2×FastTaqPremix.

[0043] Kits: DNA purification and recovery kit, plasmid mini-preparation and midi kit.

[0044] 2. Test methods

[0045] 2.1 Gene cloning

[0046] Based on the Zanthoxylum bungeanum genome reference sequence, cloning primers for the PDS gene-specific fragment (sequence shown in SEQ ID NO. 1) were designed using Primer 5.0. The primers are shown in Table 1. The PDS gene-specific fragment is 284 bp long.

[0047] Table 1 Primers

[0048]

[0049]

[0050] SEQ ID NO.1:

[0051] TGTGTGGACTACCCAAGACC AGATATTGATAGCACAGCTAATTTCTTGGAAGCTGCTTACTTATCTTCTTCATTTCGTACTTCTCCCCGTCCTCCTAAGCCGTTGAATGTTGTAATTGCTGGTGCAGGTTTGGCTGGTTTATCAACTGCAAAGTATTTGGCAGATGCAGGCCACAAGCCTTTGTTACTGGAAGCAAGAGATGTTCTAGGCGGAAAGGTGGCTGCATGGAAAGATCAGGATGGGGACTGGTATGAGACAGGACTG CATATTTTTTTCGGGGCTTA.

[0052] The PDS gene-specific fragment (length 284 bp) was cloned using Zanthoxylum bungeanum cDNA as a template and PCR amplified using 2×FastTaq Premix enzyme. The amplification reaction system is shown in Table 2.

[0053] Table 2 PCR reaction system

[0054]

[0055] After mixing and centrifugation, place the mixture in a common PCR instrument and perform the following reaction procedure as shown in Table 3.

[0056] Table 3 PCR reaction process

[0057]

[0058] After the reaction, the PCR product was detected by 1% agarose gel electrophoresis. Using DNAMarker 2000 as the standard comparison band, the corresponding gel block containing the target gene was cut into a 1.5 mL EP tube, and the target band was recovered from the gel using a DNA purification kit.

[0059] 2.2 Preparation of linearized vector

[0060] The original circular plasmid pTRV2 was digested with the corresponding enzymes XbalI and SacI, respectively. The enzyme digestion system is shown in Table 4.

[0061] Table 4 Enzyme digestion reaction system

[0062]

[0063] After mixing the above reaction system, place it in a PCR instrument at 37°C for 1 hour. After the enzyme digestion is completed, the success of the enzyme digestion is confirmed by agarose gel electrophoresis. The successful enzyme digestion product is recovered using a DNA purification kit to obtain the linearized vector.

[0064] 2.3 Connecting the target gene and vector

[0065] Use 2×Seamless Cloning Mix ligase to ligate the amplified product to the linearized vector after double enzyme digestion. The target gene and target vector plasmid digestion product are ligated according to the system in Table 5 below.

[0066] Table 5 Ligation reaction system

[0067]

[0068] After the above reaction system is mixed, it is placed in a PCR instrument at 50°C for 20 minutes to obtain a ligation solution.

[0069] 2.4 Transformation of E. coli competent cells

[0070] Transform the ligation reaction product into competent E. coli cells as follows:

[0071] (1) Take out a tube of 100 μL of DH5α competent cells and place it on ice for 10 minutes to thaw;

[0072] (2) Add 10 μL of ligation solution to 100 μL of thawed competent cells, gently rotate to mix, and incubate on ice for 30 min;

[0073] (3) Place the mixture in a 42°C water bath and heat shock for 90 seconds without shaking.

[0074] (4) After heat shock, place on ice and cool for 2 minutes;

[0075] (5) Add 700 mL of LB medium and culture at 37°C in a shaker at 220 rpm for 1 h.

[0076] (6) The mixed culture solution was aspirated and spread on LB medium plates containing the corresponding resistance, and cultured in an oven at 37°C for 16 h overnight;

[0077] (7) The next day, observe whether bacteria grow.

[0078] 2.5 Colony PCR Identification

[0079] Remove the solid culture plate containing a single colony and, using a sterile pipette tip, transfer the colony to 200 μL of LB liquid medium supplemented with the appropriate antibiotic. Incubate at 37°C in a shaker at 220 rpm for 5–6 hours until turbidity occurs. Use this bacterial solution as a template for PCR identification. The reaction system is shown in Table 6.

[0080] Table 6 Colony PCR reaction system

[0081]

[0082] After mixing and centrifugation, place the mixture in a PCR instrument and perform the reaction in Table 7 as follows:

[0083] Table 7 Colony PCR process

[0084]

[0085] The PCR products were subjected to agarose gel electrophoresis, and DNAMarker 2000 was used as a standard comparison band to check whether the amplified fragments met the expected size. Clones that met the expected size were selected and sequenced by Aoke Biotech Co., Ltd. to obtain the PDS-TRV2 vector.

[0086] 2.6 Transformation of Agrobacterium

[0087] The obtained PDS-TRV2 and TRV1 vectors were transformed into Agrobacterium GV3101 competent cells. The steps are as follows:

[0088] (1) Take out the competent Agrobacterium GV3101 stored in the refrigerator, wait for it to partially melt and then insert it into ice

[0089] (2) Pipette 2 μL of vector plasmid into the competent medium, gently stir the bottom of the tube to mix it, and then place it on ice, in liquid nitrogen, in a 37°C water bath, and on ice for 5 minutes each. Avoid shaking during the placement.

[0090] (3) Add 700 μL of LB liquid medium without antibiotics and place in a shaker at 28°C and 220 rpm for 3 h;

[0091] (4) 100 μL of bacterial solution was spread on a solid LB plate (containing kanamycin and rifampicin) and incubated upside down in a 28°C constant temperature incubator for 2 to 3 days.

[0092] 2.7 Colony PCR Identification

[0093] Remove the solid culture plate containing a single colony and place it in 100 μL of LB liquid culture medium using a sterile pipette tip. Incubate at 28°C in a shaker at 220 rpm for 6–7 hours until turbidity occurs. Use this Agrobacterium culture as a template for PCR identification.

[0094] 2.8 Preservation of Agrobacterium culture solution

[0095] The correctly identified Agrobacterium bacterial liquid was propagated in large quantities. 100 μL of the correctly identified Agrobacterium bacterial liquid was taken and added to 15 mL of LB liquid medium (containing kanamycin and rifampicin). After shaking and culturing at 28°C and 220 rpm for 16 to 20 hours, 50% glycerol was added to preserve the bacterial liquid at a ratio of 1:1 and stored at -80°C.

[0096] 2.9 Infection

[0097] Take the Agrobacterium liquid and streak it on an LB plate (containing kanamycin and rifampicin), incubate it upside down at 28°C for 2 to 3 days, pick a positive single colony and add it to an appropriate amount of LB liquid medium (containing kanamycin and rifampicin), shake it at 28°C and 220 rpm for 16 to 20 hours, collect the bacteria by centrifugation at 6000 rpm for 10 minutes, discard the supernatant, use a pipette to draw 1 mL of resuspension buffer (2.03 g MgCl2·6H2O + 2.13 g MES to 1 L of water), mix the precipitate by aspiration, add 10-15 mL of resuspension buffer, centrifuge at 6000 rpm for 8 minutes, discard the supernatant, add 10-15 mL of resuspension buffer, centrifuge at 6000 rpm for 6 minutes, adjust the OD to 0.4-0.6 with resuspension buffer, add acetosyringone (0.1 mol / L, 10 mL + 10 μL), and let it stand in the dark for 2 to 3 hours. Mix the Agrobacterium culture solution containing TRV1 and the Agrobacterium culture solution containing the PDS-TRV2 vector in a 1:1 ratio. Use a 1 mL sterile syringe and a blade to pierce the stem of the Zanthoxylum bungeanum. Wrap the wound with cotton soaked in the culture solution and infect in the dark for 12 hours. Then switch to a 16-hour light / 8-hour dark mode, a temperature of 22±3°C, an air humidity of 80%, and a light intensity of 2000 lux.

[0098] 3. Experimental results

[0099] 3.1 PDS gene cloning, agarose gel electrophoresis results are as follows Figure 1 As shown, the fragment sizes were consistent with expectations.

[0100] 3.2 The PDS gene was constructed into the pTRV2 vector and transferred into E. coli for amplification. The agarose gel electrophoresis pattern of the plasmid was as follows: Figure 2 shown.

[0101] 3.2 Sequencing and alignment of the colonies grown by Agrobacterium transformed with the successful PDS-pTRV2 vector Figure 3 As shown, the grown colonies were identified by colony PCR, and the results were as follows Figure 4 shown.

[0102] 3.3 The process of silencing the pepper plant is to first pierce the stem of the plant parallel to the main trunk along the center with a surgical blade, then inject the mixed infection solution along the puncture site through a sterile syringe and wrap it with absorbent cotton soaked with the solution. Figure 5 shown.

[0103] 3.4 The initial results of the PDS gene silencing system showed that the mesophyll cells along the leaf veins were changing from green to yellow to white. Figure 6 shown.

[0104] 3.5 The final effect after infection may cause large areas of leaves or branches above the infected area to become white, such as Figure 7 shown.

[0105] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A Zanthoxylum bungeanum PDS gene VIGS silencing vector, characterized in that: The silencing vector includes a pTRV2 vector and a specific fragment of the Zanthoxylum bungeanum PDS gene, and the nucleotide sequence of the specific fragment is shown in SEQ ID NO.

1.

2. A method for constructing the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1, characterized in that: The following steps are involved: The specific fragment described in claim 1 is connected to the pTRV2 vector to construct the silencing vector PDS-pTRV2.

3. The construction method according to claim 2, characterized in that The specific fragment is obtained by PCR amplification; the primer pair used for PCR amplification includes an upstream primer PDS-TRV2-F and a downstream primer PDS-TRV2-R; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

5.

4. A Zanthoxylum bungeanum PDS gene VIGS silencing system, characterized in that: The silencing system comprises: a mixture of Agrobacterium liquid containing pTRV1 and Agrobacterium liquid containing the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1; the volume ratio of the Agrobacterium liquid containing pTRV1 and the Agrobacterium liquid containing the Zanthoxylum bungeanum PDS gene VIGS silencing vector is 1:

1.

5. Use of the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1 or the silencing system according to claim 4 in identifying the function of the Zanthoxylum bungeanum PDS gene.

6. A method for identifying the function of a Zanthoxylum bungeanum PDS gene, characterized in that: The steps include: After infecting the Zanthoxylum bungeanum stems in vitro using the silencing system described in claim 4, the stems are continuously cultured and the phenotypic changes of the leaves are observed; when the leaves lose their green color and turn white or light yellow, it indicates that the Zanthoxylum bungeanum PDS gene is functioning.

7. The method according to claim 6, characterized in that The infection method includes: piercing the stem of Zanthoxylum bungeanum, injecting the silencing system into the stem of Zanthoxylum bungeanum by wrapping the wound with a water-absorbing material soaked in bacterial liquid, and infecting in the dark for 12 hours; the Agrobacterium includes Agrobacterium GV3101.

8. The method according to claim 6, characterized in that Before using the silencing system to infect the Zanthoxylum bungeanum stem in vitro, the method further includes the steps of using a resuspension solution to resuspend the Agrobacterium containing the Zanthoxylum bungeanum PDS gene VIGS silencing system, adding acetosyringone and standing in the dark; the standing time is 2 to 3 hours; and the resuspension solution contains MgCl2·6H2O and MES.

9. The method according to claim 6, characterized in that The conditions for continued cultivation are 16 h light / 8 h dark mode, temperature 22±3° C., air humidity 80%, and light intensity 2000 lux.

10. Use of the Zanthoxylum bungeanum PDS gene VIGS silencing vector according to claim 1 or the Zanthoxylum bungeanum PDS gene VIGS silencing system according to claim 4 in the breeding and genetic improvement of superior Zanthoxylum bungeanum varieties.

Images