Agrobacterium rhizogenes-mediated rapid and efficient genetic transformation method for cynodon dactylon

Through the Agrobacterium rhizogenes-mediated method, the stem segments of Bermudagrass runners were disinfected and specifically treated to induce the formation of hairy roots, which solved the problem of cumbersome and inefficient genetic transformation operations of Bermudagrass and achieved rapid and efficient genetic breeding and gene function research.

CN120683164APending Publication Date: 2025-09-23YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510910067.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

The genetic transformation of Bermuda grass is cumbersome and inefficient. Existing methods are time-consuming and have a low transformation positive rate, making it difficult to achieve rapid and efficient genetic breeding and gene function research.

Method used

Using the Agrobacterium rhizogenes-mediated method, the stem segments of Bermudagrass runners were disinfected and treated with lines and needles, and then infected with Agrobacterium rhizogenes to induce the formation of hairy roots. Finally, the transgenic plants were cultured and identified under specific conditions.

Benefits of technology

The genetic transformation process of bermudagrass was completed within two months, simplifying the operation process, improving the transformation efficiency, and achieving a positive rate of 25%, realizing efficient genetic breeding and gene function research in conventional laboratories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005479809990000101
    Figure BDA0005479809990000101
  • Figure BDA0005479809990000102
    Figure BDA0005479809990000102
  • Figure BDA0005479809990000111
    Figure BDA0005479809990000111
Patent Text Reader

Abstract

The invention discloses an agrobacterium rhizogenes-mediated rapid and efficient genetic transformation method for cynodon dactylon. The method comprises the following steps: (1) transforming, culturing and treating agrobacterium rhizogenes; (2) disinfecting and treating stolon sections of cynodon dactylon; (3) impregnating the stolons of the cynodon dactylon with agrobacterium rhizogenes, and inducing to form hairy roots; and (4) regenerating the transgenic cynodon dactylon plant. Compared with an existing universal genetic transformation method of the cynodon dactylon mediated by a gene gun and agrobacterium tumefaciens, the method has the advantages that tedious and low-efficiency callus induction and regeneration operation does not need to be carried out, the whole operation process can be completed within two months, and a convenient technical means is provided for genetic breeding and gene function research of the cynodon dactylon.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and biotechnology, and particularly relates to a rapid and efficient Bermudagrass genetic transformation method mediated by Agrobacterium rhizogenes. Background Art

[0002] Bermuda grass (Cynodon dactylon L.) is an herbaceous plant of the genus Cynodontidae, subfamily Gramineoideae, Poaceae. It is an important warm-season lawn grass and forage grass with many advantages, such as fast growth, strong regeneration ability, resistance to trampling, pruning, salt and alkali, good palatability, and balanced nutrition. It is widely used in the vast areas south of the Yellow River Basin in China for lawn construction in sports fields, parks, and community green belts, as well as for grazing pastures on slopes and wastelands, and has important economic value.

[0003] In addition to its aforementioned desirable traits, bermudagrass also exhibits frequent outcrossing and complex chromosome ploidy. Cultivating new bermudagrass varieties using traditional hybrid breeding methods not only requires a long timeframe but also has a low success rate. Using plant genetic transformation techniques to target genes associated with target traits through transgenic molecular breeding and gene editing can precisely improve these traits, significantly accelerating the breeding process. However, compared to other plants, genetic transformation of bermudagrass is more challenging. Currently reported gene gun-mediated and Agrobacterium-mediated genetic transformation methods for bermudagrass (patents: A gene gun-mediated genetic transformation method for hybrid bermudagrass; A method for genetic transformation of forage bermudagrass) require tedious and complex callus induction and regeneration, are time-consuming, inefficient, and have a low transformation success rate. Recent reports have shown that Agrobacterium rhizogenes can induce hairy roots in plants such as rubber grass (Taraxacum koksaghyz Rodin), sweet potato (Ipomoea batatas L.), and potato (Solanum tuberosum L.), leading to the regeneration of transgenic plants. However, whether bermudagrass can undergo similar genetic transformation is still unknown. Summary of the Invention

[0004] Purpose of the invention: In response to the problems existing in the prior art, the present invention provides a rapid and efficient method for genetic transformation of bermudagrass mediated by Agrobacterium rhizogenes. Compared with the currently common gene gun and Agrobacterium-mediated bermudagrass genetic transformation methods, the present invention does not require tedious and inefficient callus induction and regeneration operations, and the entire operation process can be completed within two months. It provides a convenient technical means for bermudagrass genetic breeding and gene function research, and solves the problem of difficulty and low efficiency in genetic transformation of bermudagrass.

[0005] Technical solution: To achieve the above-mentioned purpose, the present invention provides a rapid and efficient method for genetic transformation of Bermudagrass mediated by Agrobacterium rhizogenes, comprising the following steps:

[0006] (1) Transformation, culture, and treatment of Agrobacterium rhizogenes: The binary vector containing the target gene is transformed into Agrobacterium and cultured and activated;

[0007] (2) Disinfection and treatment of Bermuda grass runner segments: The hydroponic Bermuda grass runner segments were disinfected and then subjected to streaking and acupuncture treatments. Compared with soil-grown plants, hydroponic plants do not come into contact with the soil and carry fewer bacteria, which can shorten the disinfection time and reduce the incidence of subsequent bacterial infection.

[0008] (3) Infecting the stem segments of Bermudagrass runners with Agrobacterium rhizogenes to induce the formation of hairy roots: Infecting the stem segments of Bermudagrass runners with Agrobacterium rhizogenes to culture and produce hairy roots;

[0009] (4) Regeneration and identification of transgenic bermudagrass plants: The bermudagrass runner segments that have grown hairy roots are further cultured to regenerate plants and positive plants are identified.

[0010] Wherein, the Agrobacterium rhizogenes strain in step (1) is ATCC15834; the binary vector includes any one of the pBI, pCAMBIA, and pEarleyGate series vectors.

[0011] The activation of Agrobacterium rhizogenes in step (1) is as follows: Agrobacterium rhizogenes is resuspended in an infection buffer to an OD of 600 Prepare 0.6-0.8% Agrobacterium infection solution and let it stand in the dark at room temperature for 2-3 hours.

[0012] Preferably, the activation of Agrobacterium rhizogenes in step (1) is as follows: Agrobacterium rhizogenes is resuspended in an infection buffer to an OD of 600 Prepare 0.6% Agrobacterium infection solution and let it stand in the dark at room temperature for 2-3 hours.

[0013] Wherein, the method for disinfecting the Bermuda grass runner stem segments in step (2) is: soaking and disinfecting in sodium hypochlorite solution for 10-20 seconds, soaking and washing in sterile water for 10-20 seconds, soaking and disinfecting in ethanol solution for 30-60 seconds, soaking and washing in sterile water for 10-20 seconds, and repeating the washing 4-5 times.

[0014] Among them, the method of marking and acupuncture in step (2) is: using a scalpel to gently mark the surface of the disinfected bermudagrass runner segment, marking each stem segment about 5-10 times; further using a medical disposable syringe needle to acupuncture the runner node, the insertion depth is about 1-3 mm, and each node is acupunctured 3-5 times.

[0015] Wherein, the method for infecting the Bermudagrass runner stem segment with Agrobacterium rhizogenes in step (3) is: vacuuming to allow the Agrobacterium rhizogenes bacterial solution to fully penetrate into the Bermudagrass runner tissue.

[0016] Preferably, the vacuum condition in step (3) is a negative pressure of 0.8-1 kg / cm 2 Continue vacuuming for 20-30 minutes, rest for 5-10 minutes, and continue vacuuming to a negative pressure of 0.8-1kg / cm 2 Do this for 5-10 minutes.

[0017] Furthermore, the vacuum condition in step (3) is a negative pressure of 0.8 kg / cm 2 Continue vacuuming for 20-30 minutes, rest for 5-10 minutes, and continue vacuuming to a negative pressure of 0.8 kg / cm 2 Do this for 5-10 minutes.

[0018] Wherein, the culture medium used for producing hairy roots in step (3) is Hoagland solid culture medium.

[0019] The culture conditions for producing hairy roots in step (3) are 16 hours of light (500-1500 lux) / 8 hours of dark cycle, 28° C., and 30%-60% humidity.

[0020] Preferably, the culture conditions for producing hairy roots in step (3) are 16 hours light (1000 lux) / 8 hours dark cycle, 28° C., and 40% humidity.

[0021] Wherein, the substrate used for regenerating plants from the Bermuda grass runner segments growing hairy roots in step (4) is 4-8 mm vermiculite.

[0022] Preferably, the Agrobacterium rhizogenes-mediated rapid and efficient Bermudagrass genetic transformation method of the present invention comprises the following steps:

[0023] (1) Transformation, culture and treatment of Agrobacterium rhizogenes.

[0024] Transform Agrobacterium with a binary vector: Add 1-5 μg of the binary vector containing the target gene (pBI, pCAMBIA, or pEarleyGate series vectors are all acceptable) to 100 μl of ATCC15834 Agrobacterium rhizogenes competent cells, mix well, incubate on ice for 30 minutes, quickly freeze in liquid nitrogen for 5 minutes, incubate in a 37°C water bath for 5 minutes, and incubate on ice for 5 minutes. Add 800 μl of antibiotic-free TY liquid medium (5 g / L peptone, 3 g / L yeast extract) in a clean bench and culture with shaking at 28°C for 3 hours. Pipette 100-300 μl of the bacterial solution and spread it on TY solid medium (5 g / L peptone, 3 g / L yeast extract, 10 g / L agar) containing antibiotics (determined by the binary vector) and culture inverted at 28°C for 2-3 days until single colonies grow.

[0025] Identification of positive transformed Agrobacterium: Pick a single colony and inoculate it into 3 ml of TY liquid medium containing antibiotics (determined by the binary vector). Incubate at 28°C with shaking for 2 days. Pipette 1 μl of the bacterial solution for conventional PCR analysis (the primers used in PCR are designed based on the binary vector and target gene sequences). Agarose gel electrophoresis is used to detect whether PCR amplifies a DNA band of the target size. Agrobacterium that amplifies the target band is a positive transformant that has successfully transformed the binary vector.

[0026] Agrobacterium expansion culture: Add the positive transformed Agrobacterium culture liquid to 200 ml of TY liquid medium containing antibiotics at a ratio of 1:100, culture at 28°C with shaking, and measure the OD of the culture liquid using a UV spectrophotometer every two hours. 600 Absorbance value, wait for OD 600 When the concentration reaches 0.6-0.8, the culture can be stopped.

[0027] Agrobacterium activation treatment: Centrifuge (3000g, 10 minutes, 4°C) to collect the expanded cultured Agrobacterium cells, wash the cells with sterile water, re-centrifuge (3000g, 10 minutes, 4°C), and resuspend the cells in 150-200 ml of infection buffer (10 mM magnesium chloride, 200 μM acetosyringone) to obtain the OD 600 Place about 0.6-0.8 of the Agrobacterium infection solution in a 500ml beaker and let it stand in the dark at room temperature for 2-3 hours before use.

[0028] (2) Disinfection and treatment of Bermuda grass runner segments.

[0029] Hydroponic cultivation of Bermuda grass: Cut healthy runners from the Bermuda grass lawn, wash off the soil on the surface with clean water, wrap the runner nodes with a sponge, insert them into a foam board, place them in a 50cm×30cm×30cm turnover box, add Hoagland nutrient solution, and cultivate for about 1-2 weeks under the conditions of 16 hours light (5000-10000 lux) / 8 hours dark cycle, 28℃, and 40%-70% humidity.

[0030] Disinfection of Bermudagrass runner segments: Cut newly grown Bermudagrass runners grown in hydroponics, remove the leaves, and further cut into 3-4 cm long segments, each containing a single node (approximately 3 / 4 of the segment, 0.75-1 cm from the bottom). In a clean bench, soak the cut segments in 20% sodium hypochlorite solution for 10-20 seconds, then rinse with sterile water for 10-20 seconds, then rinse with 75% ethanol solution for 30-60 seconds, then rinse with sterile water for 10-20 seconds, and repeat four times.

[0031] Knife cutting and acupuncture treatment of the stem segments of the Bermuda grass runners: In a clean bench, use a scalpel to gently score the surface of the disinfected Bermuda grass runner segments, score each stem segment about 5-10 times; further use a medical disposable syringe needle to acupuncture the runner nodes, the penetration depth is about 1-3mm, and each node is acupunctured 3-5 times.

[0032] (3) Agrobacterium rhizogenes was used to infect the stem segments of Bermudagrass runners to induce the formation of hairy roots.

[0033] Infecting the Bermudagrass runners with Agrobacterium rhizogenes: In a clean bench, place the Bermudagrass runners disinfected and treated in step (2) into the Agrobacterium-infected solution obtained in step (1), and cover the beaker with tin foil. Place the beaker in a vacuum desiccator and evacuate (negative pressure 0.8 kg / cm 2 ) for 20-30 minutes, rest for 5-10 minutes, and continue to vacuum (negative pressure 0.8kg / cm 2 ) for 5-10 minutes to allow the rhizogenes Agrobacterium solution to fully penetrate into the Bermuda grass runner tissue.

[0034] To produce hairy roots in bermudagrass runner segments: Place a beaker in a clean bench and use tweezers to transfer the bermudagrass runner segments infected with Agrobacterium to a plate containing Hoagland's solid medium (0.7% agar) and antibiotics (determined by the binary vector). Ensure that the surface of the segment, especially the nodes, is completely in contact with the medium and seal the plate with parafilm. Place the plate upright and incubate under a 16-hour light (500-1500 lux) / 8-hour dark cycle at 28°C and 30%-60% humidity for approximately two weeks. Bermudagrass runner segments successfully transformed with Agrobacterium rhizogenes will develop hairy roots at the nodes.

[0035] (4) Regeneration and identification of transgenic Bermuda grass plants.

[0036] Regeneration of plants from bermudagrass runner segments with hairy roots: The flat plate of the runner segments with hairy roots grown in step (3) is further cultured under conditions of 16 hours of light (500-1500 lux) / 8 hours of dark cycle, 28°C, and 30%-60% humidity for 1-2 weeks. When the hairy roots grow to 4-5 cm, the runner segments are transferred to a hole tray containing 4-8 mm vermiculite matrix using tweezers so that the hairy roots are completely placed below the surface of the matrix. The tray is watered thoroughly and cultured under conditions of 16 hours of light (5000-10000 lux) / 8 hours of dark cycle, 28°C, and 40%-70% humidity. Water is replenished every 5 days. After 2-3 weeks, bermudagrass plants regenerated from the runner segments can be obtained.

[0037] Identification of transgenic Bermudagrass plants: New roots and leaves of regenerated Bermudagrass plants are excised and genomic DNA is extracted for PCR analysis (primers used in PCR are designed based on the binary vector and target gene sequence). Agarose gel electrophoresis is then used to test whether a DNA band of the target size is amplified by PCR. Plants that amplify the target band are considered positive plants for successful genetic transformation. Alternatively, a reporter gene carried by the binary vector can be used for testing; successful expression of the reporter gene and the appearance of corresponding phenotypic traits further confirm that the plant is positive.

[0038] The present invention proposes a rapid and efficient method for bermudagrass genetic transformation mediated by Agrobacterium rhizogenes. Compared with the currently common gene gun and Agrobacterium-mediated bermudagrass genetic transformation methods, the present invention does not require tedious and inefficient callus induction and regeneration operations. The entire operation process can be completed within two months, providing a convenient technical means for bermudagrass genetic breeding and gene function research.

[0039] Specifically:

[0040] (1) Through various comparative experiments, the present invention has developed a genetic transformation method specifically suitable for Bermudagrass using Agrobacterium rhizogenes. Under optimal conditions, the positive rate of hairy root formation from Bermudagrass runners can reach 25% (Tables 1-4). Because all Bermudagrass runner nodes that form hairy roots are capable of regenerating plants, the overall plant transformation efficiency is also 25%.

[0041] (2) The present invention uses a specific Agrobacterium strain (ATCC1583) and a specific concentration of bacterial solution to significantly improve the positive rate of inducing the formation of hairy roots in bermudagrass runners. Lowering or increasing the concentration of the Agrobacterium infection solution will lead to a decrease in the positive rate of inducing the formation of hairy roots in subsequent bermudagrass runners. In addition, the positive rate of inducing the formation of hairy roots in bermudagrass runners using other strains is lower than that of the ATCC1583 strain.

[0042] (3) The present invention discovered for the first time that using a scalpel to mark the runners and a syringe needle to puncture the runner nodes can significantly improve the efficiency of Agrobacterium rhizogenes infection. Compared with the control group, the simultaneous use of knife marking and acupuncture can increase the positive rate of hairy root formation in bermudagrass runners by about 3-4 times (Table 2). This may be because knife marking and marking can create wounds, which facilitate the entry of Agrobacterium into the bermudagrass runner tissue, thereby improving the transformation efficiency.

[0043] (4) The present invention discovered for the first time a specific vacuum treatment method (vacuuming for 20-30 minutes, resting for 5-10 minutes, and continuing to vacuum for 5-10 minutes) that enables Agrobacterium rhizogenes to infect Bermudagrass runner segments to obtain a higher hairy root induction positive rate compared to other vacuum treatments, while the hairy root induction positive rate is the lowest when the treatment is not vacuumed.

[0044] (5) In order to avoid contamination by foreign bacteria, the root growth medium used in the present invention is a Hoagland solid medium without added sucrose. The carbon source required for the growth of hairy roots cannot be obtained from the culture medium, but is provided entirely by the Cynodon dactylon runners. The present invention found that setting the culture conditions for inducing hairy root growth after infecting Cynodon dactylon runners with Agrobacterium to low light (500-1500 lux) can increase the positive rate of hairy root formation of Cynodon dactylon runners by about 2-3 times compared with the growth conditions without light (Table 4). This may be because under light conditions, Cynodon dactylon runners can carry out photosynthesis and thus provide sufficient nutrients for the growth of hairy roots, but excessive light can inhibit the growth of root-inducing Agrobacterium. Therefore, the light range that can achieve the best effect needs to be 500-1500 lux.

[0045] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0046] (1) The present invention uses hydroponic Bermudagrass runner segments for direct genetic transformation, avoiding the tedious, inefficient, and time-consuming callus culture process. The process is simple and quick. Through the experimental steps of the present invention, positive transgenic Bermudagrass plants can be obtained within two months.

[0047] (2) The present invention avoids callus culture operations and uses a sugar-free culture medium for hairy root culture. It does not have high requirements for laboratory sterile conditions and does not require a special tissue culture room. The operation can be completed in a conventional plant physiology and molecular biology laboratory.

[0048] (3) The present invention can be used for the biological function verification and analysis of endogenous genes of Bermuda grass, and can also be used for transgenic molecular breeding and gene editing breeding of Bermuda grass. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a technical flow chart of the present invention.

[0050] Figure 2 RUBY reporter gene detection (A) and DNA detection results (B) of 35S:RUBY transformation of 'Yangjiang' Bermudagrass plants mediated by Agrobacterium rhizogenes.

[0051] Figure 3 EGFP reporter gene detection (A) and DNA detection results (B) of 'Yangjiang' Bermudagrass plants mediated by Agrobacterium rhizogenes 35S:EGFP.

[0052] Table 1 shows the statistical effect of different concentrations of the impregnation solution of two Agrobacterium rhizogenes strains on the formation of hairy roots

[0053] Table 2 shows the statistical effects of different knife cutting and needle puncture treatments on hairy root formation

[0054] Table 3 shows the statistical effects of different vacuum treatments on hairy root formation

[0055] Table 4 shows the statistical effect of different light intensities on hairy root formation in co-culture after infection DETAILED DESCRIPTION

[0056] The present invention will be further described below with reference to the accompanying drawings and examples.

[0057] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the examples were purchased from conventional biochemical reagent stores unless otherwise specified.

[0058] The nationally approved Bermudagrass variety 'Yangjiang' Bermudagrass: National Main Warm Season Turfgrass Germplasm Bank of Grassland Research Center, Institute of Botany, Chinese Academy of Sciences, Jiangsu Province;

[0059] Agrobacterium rhizogenes ATCC15834 competent cells: Beijing Coolaibo Technology Co., Ltd., product number CC416;

[0060] Hoagland nutrient solution: Beijing Coolaibo Technology Co., Ltd., product number NSP1020;

[0061] pBI121-EGFP binary vector: Hunan Fenghui Biotechnology Co., Ltd., product number BR511;

[0062] 35S:RUBY binary vector: Hunan Fenghui Biotechnology Co., Ltd., product number sc2024056.

[0063] Example 1

[0064] The RUBY gene was transformed into bermudagrass. The specific process is as follows: Figure 1 As shown:

[0065] (1) Transformation, culture and treatment of Agrobacterium rhizogenes.

[0066] Transformation of Agrobacterium with the 35S:RUBY binary vector: Add 2 μg of 35S:RUBY vector to 100 μl of ATCC15834 competent Agrobacterium rhizogenes cells, mix well, incubate on ice for 30 minutes, quick-freeze in liquid nitrogen for 5 minutes, incubate in a 37°C water bath for 5 minutes, and incubate on ice for 5 minutes. Add 800 μl of antibiotic-free TY liquid medium (5 g / L peptone, 3 g / L yeast extract) in a clean hood and incubate at 28°C with shaking for 3 hours. Pipette 200 μl of the bacterial solution onto TY solid medium (5 g / L peptone, 3 g / L yeast extract, 10 g / L agar) containing 50 μg / ml spectinomycin and incubate inverted at 28°C for 2 days until single colonies appear.

[0067] Identification of positive transformed Agrobacterium: Pick a single colony and inoculate it into 3 ml of TY liquid medium containing 50 μg / ml spectinomycin. Incubate with shaking at 28°C for 2 days. Pipette 1 μl of the bacterial solution for conventional PCR analysis (the upstream primer of PCR is 35S-F: AGAAGATTTTCTCCAAGAAGCCGA, and the downstream primer is RUBY-R: ATAATGAGCACGCCATCATTCTTG). Use agarose gel electrophoresis to detect whether the PCR amplifies a 394 bp DNA band. Agrobacterium that amplifies a 394 bp DNA band is a positive transformant that has successfully transformed with 35S:RUBY.

[0068] Agrobacterium expansion culture: Add the positive transformed Agrobacterium culture liquid to 200 ml of TY liquid medium containing 50 μg / ml spectinomycin at a ratio of 1:100. Incubate at 28°C with shaking. Measure the OD600 absorbance of the culture liquid using a UV spectrophotometer every two hours. Stop the culture when the OD600 reaches 0.6.

[0069] Agrobacterium activation treatment: Centrifuge (3000g, 10 minutes, 4°C) to collect the expanded cultured Agrobacterium cells, wash the cells with sterile water, re-centrifuge (3000g, 10 minutes, 4°C), and resuspend the cells in 200 ml of infection buffer (10 mM magnesium chloride, 200 μM acetosyringone) to obtain the OD 600 Place the 0.6% Agrobacterium infection solution in a 500ml beaker and let it stand in the dark at room temperature for 3 hours.

[0070] (2) Disinfection and treatment of Bermuda grass runner segments.

[0071] Hydroponic cultivation of Bermuda grass: Cut healthy, mature runners with internode length greater than 3 cm from the Bermuda grass lawn, wash off the soil on the surface with clean water, wrap the runner nodes with sponges, and insert them into foam boards. Plant no more than 30 runners on each foam board and place them in a 50cm×30cm×30cm turnover box. Add Hoagland nutrient solution until the liquid surface is 2 cm away from the upper edge of the turnover box. Cultivate for about 2 weeks under the conditions of 16 hours of light (8000 lux) / 8 hours of dark cycle, 28°C, and 60% humidity.

[0072] Disinfection of Bermudagrass runner segments: Cut newly grown Bermudagrass runners from hydroponics, remove the leaves, and further cut into 3-4 cm long segments, each containing a single node. In a clean bench, soak the cut segments in 20% sodium hypochlorite solution for 15 seconds, then rinse with sterile water for 15 seconds, then soak in 75% ethanol solution for 50 seconds, then rinse with sterile water for 15 seconds. Repeat this four times.

[0073] Knife cutting and acupuncture treatment of the stem segments of the Bermuda grass runners: In the clean bench, use a scalpel to gently score the surface of the disinfected Bermuda grass runner segments, score each segment about 8 times, with a score spacing of about 2 mm and a depth of about 1 mm; further use a medical disposable syringe needle to acupuncture the runner nodes, with a penetration depth of about 2 mm, and acupuncture each node 5 times, at different positions.

[0074] (3) Agrobacterium rhizogenes was used to infect the stem segments of Bermudagrass runners to induce the formation of hairy roots.

[0075] Infecting the Bermudagrass runners with Agrobacterium rhizogenes: In a clean bench, place the Bermudagrass runners disinfected and treated in step (2) into the Agrobacterium-infected solution obtained in step (1), and cover the beaker with tin foil. Place the beaker in a vacuum desiccator and evacuate (negative pressure 0.8 kg / cm 2 ) for 30 minutes, rest for 10 minutes, and continue to vacuum (negative pressure 0.8kg / cm 2 ) for 5 minutes to allow the Agrobacterium rhizogenes solution to fully penetrate into the Bermuda grass runner tissue.

[0076] Hairy root production in bermudagrass runner segments: Place a beaker in a clean bench and use tweezers to transfer the bermudagrass runner segments infected with Agrobacterium to a plate containing Hoagland's solid medium (0.7% agar) supplemented with 50 μg / ml hygromycin. Ensure the surface of the segments, especially the nodes, are completely in contact with the medium. Seal the plate with parafilm. Place the plate upright and incubate under a 16-hour light (1000 lux) / 8-hour dark cycle at 28°C and 40% humidity for 2 weeks.

[0077] (4) Regeneration and identification of transgenic Bermuda grass plants.

[0078] Regeneration of plants from bermudagrass runner segments with hairy roots: The flat plate of the runner segments with hairy roots in step (3) is further cultured under 16 hours of light (1000 lux) / 8 hours of dark cycle, 28°C, and 40% humidity for 2 weeks. When the hairy roots grow to 4-5 cm, the runner segments are transferred to a hole tray containing 4-8 mm vermiculite matrix using tweezers, so that the hairy roots are completely placed below the surface of the matrix. The tray is watered thoroughly and cultured under 16 hours of light (8000 lux) / 8 hours of dark cycle, 28°C, and 60% humidity. Water is replenished every 5 days. After 2 weeks, 35S:RUBY transgenic bermudagrass plants regenerated from the runner segments are obtained.

[0079] Identification of transgenic Bermuda grass plants: Cut the new roots and leaves of the regenerated Bermuda grass plants, extract genomic DNA for PCR analysis (upstream primer 35S-F: AGAAGATTTTCTCCAAGAAGCCGA, downstream primer RUBY-R: ATAATGAGCACGCCATCATTCTTG), and use agarose gel electrophoresis to detect whether PCR amplifies a 394bp DNA band. Plants that amplify a 394bp DNA band are positive plants that have successfully undergone genetic transformation. Since the betalain produced by the expression of the RUBY reporter gene appears red when observed with the naked eye, the transgenic plant can be further judged as a positive plant by observing that it turns red ( Figure 2 In this example, the number of runners that formed hairy roots, the total number of runners, and the positive rate (%) were 9, 36, and 25%, respectively.

[0080] In this embodiment, the bermudagrass was cultivated in hydroponics for 2 weeks, transformed with Agrobacterium for 2 days, identified for 2 days, expanded culture and activated for 1 day (the Agrobacterium-related steps were completed just before the bermudagrass was hydroponically cultivated), infected with Agrobacterium for 1 day, hairy roots were induced for 2 weeks, plants were regenerated for 2 weeks, and tested for 1 day, with a total time of no more than 2 months.

[0081] Example 2

[0082] The EGFP gene was transformed into bermudagrass. The specific process is as follows Figure 1 As shown:

[0083] (1) Transformation, culture and treatment of Agrobacterium rhizogenes.

[0084] Transform Agrobacterium with pBI121-EGFP binary vector: Add 2.5 μg of pBI121-EGFP vector to 100 μl of ATCC15834 Agrobacterium rhizogenes competent cells, mix well, incubate on ice for 30 minutes, quick-freeze in liquid nitrogen for 5 minutes, incubate in a 37°C water bath for 5 minutes, and incubate on ice for 5 minutes. Add 800 μl of antibiotic-free TY liquid medium (5 g / L peptone, 3 g / L yeast extract) in a clean bench and culture with shaking at 28°C for 3 hours. Pipette 200 μl of bacterial liquid and spread it on TY solid medium (5 g / L peptone, 3 g / L yeast extract, 10 g / L agar) containing 50 μg / ml kanamycin, and culture it upside down at 28°C for 3 days until a single colony grows.

[0085] Identification of positive transformed Agrobacterium: Pick a single colony and inoculate it into 3 ml of TY liquid medium containing 50 μg / ml kanamycin. Cultivate with shaking at 28°C for 2 days. Pipette 1 μl of the bacterial solution for conventional PCR analysis (the upstream primer of PCR is 35S-F: CAACCACGTCTTCAAAGCAA, the downstream primer is EGFP-R: CTTCAGGGTCAGCTTGCCGT). Agarose gel electrophoresis is used to detect whether the PCR amplification of the 297 bp DNA band is detected. Agrobacterium that amplifies the 297 bp DNA band is a positive transformant that has successfully transformed with pBI121-EGFP.

[0086] Agrobacterium expansion culture: Add the positive transformed Agrobacterium culture liquid to 200 ml of TY liquid medium containing 50 μg / ml kanamycin at a ratio of 1:100. Incubate with shaking at 28°C. Measure the OD600 absorbance of the culture liquid every two hours using a UV spectrophotometer. Stop the culture when the OD600 reaches 0.8.

[0087] Agrobacterium activation treatment: Centrifuge (3000g, 10 minutes, 4 ° C) to collect the expanded cultured Agrobacterium cells, wash the cells with sterile water, re-centrifuge (3000g, 10 minutes, 4 ° C), and resuspend the cells in 180 ml of infection buffer (10 mM magnesium chloride, 200 μM acetosyringone) to obtain an Agrobacterium infection solution with an OD600 of 0.8. Place it in a 500 ml beaker and stand at room temperature in the dark for 2 hours.

[0088] (2) Disinfection and treatment of Bermuda grass runner segments.

[0089] Hydroponic cultivation of Bermuda grass: Cut healthy, mature runners with internode length greater than 3 cm from the Bermuda grass lawn, wash off the soil on the surface with clean water, wrap the runner nodes with sponges, and insert them into foam boards. Plant no more than 30 runners on each foam board and place them in a 50cm×30cm×30cm turnover box. Add Hoagland nutrient solution until the liquid surface is 2 cm away from the upper edge of the turnover box. Cultivate for about 1.5 weeks under the conditions of 16 hours of light (8000 lux) / 8 hours of dark cycle, 28°C, and 60% humidity.

[0090] Disinfection of Bermudagrass runner segments: Cut newly grown Bermudagrass runners from hydroponics, remove the leaves, and further cut into 3-4 cm long segments, each containing a single node. In a clean bench, soak the cut segments in 20% sodium hypochlorite solution for 15 seconds, then rinse with sterile water for 15 seconds, then soak in 75% ethanol solution for 50 seconds, then rinse with sterile water for 15 seconds. Repeat this four times.

[0091] Knife cutting and acupuncture treatment of the stem segments of the Bermuda grass runners: In the clean bench, use a scalpel to gently score the surface of the disinfected Bermuda grass runner segments, score each segment about 6 times, with a score spacing of about 2 mm and a depth of about 1 mm; further use a medical disposable syringe needle to acupuncture the runner nodes, with a penetration depth of about 2 mm, and acupuncture each node 4 times, puncturing different positions.

[0092] (3) Agrobacterium rhizogenes was used to infect the stem segments of Bermudagrass runners to induce the formation of hairy roots.

[0093] Infecting the Bermudagrass runners with Agrobacterium rhizogenes: In a clean bench, place the Bermudagrass runners disinfected and treated in step (2) into the Agrobacterium-infected solution obtained in step (1), and cover the beaker with tin foil. Place the beaker in a vacuum desiccator and evacuate (negative pressure 0.8 kg / cm 2 ) for 30 minutes, rest for 10 minutes, and continue to vacuum (negative pressure 0.8kg / cm 2 ) for 5 minutes to allow the Agrobacterium rhizogenes solution to fully penetrate into the Bermuda grass runner tissue.

[0094] Hairy root production in bermudagrass runner segments: Place a beaker in a clean bench and use tweezers to transfer the Agrobacterium-infected bermudagrass runner segments to a plate containing Hoagland's solid medium (0.7% agar) supplemented with 50 μg / ml kanamycin. Ensure the surface of the segment, especially the nodes, is completely in contact with the medium. Seal the plate with parafilm. Place the plate upright and incubate under a 16-hour light (1000 lux) / 8-hour dark cycle at 28°C and 40% humidity for 2 weeks.

[0095] (4) Regeneration and identification of transgenic Bermuda grass plants.

[0096] Regeneration of plants from bermudagrass runner segments with hairy roots: The runner segments with hairy roots in step (3) are further cultured under 16-hour light (1000 lux) / 8-hour dark cycle, 28°C, and 40% humidity for 2 weeks. When the hairy roots grow to 4-5 cm, the runner segments are transferred to a hole tray containing 4-8 mm vermiculite matrix using tweezers, so that the hairy roots are completely placed below the surface of the matrix. The tray is watered thoroughly and cultured under 16-hour light (8000 lux) / 8-hour dark cycle, 28°C, and 60% humidity. Water is replenished every 5 days. After 2 weeks, 35S:EGFP transgenic bermudagrass plants regenerated from the runner segments are obtained.

[0097] Identification of transgenic bermudagrass plants: Cut the new roots and leaves of the regenerated bermudagrass plants, extract genomic DNA for PCR analysis (upstream primer 35S-F: CAACCACGTCTTCAAAGCAA, downstream primer EGFP-R: CTTCAGGGTCAGCTTGCCGT), and use agarose gel electrophoresis to detect whether PCR amplifies a 297bp DNA band. Plants that amplify a 297bp DNA band are positive plants with successful genetic transformation. Since the green fluorescent protein produced by the expression of the EGFP reporter gene can produce green fluorescence with a wavelength of 507nm under the excitation of an excitation light with a wavelength of 488nm, the transgenic plant can be further judged as a positive plant by observing the green fluorescence produced by irradiating it with a 488nm ultraviolet light ( Figure 3 In this example, the number of runners that formed hairy roots, the total number of runners, and the positive rate (%) were 9, 38, and 23.68%, respectively.

[0098] Comparative Example 1

[0099] All steps were carried out according to the method of Example 1, with the only difference being that the OD of the Agrobacterium infection solution was replaced 600 The values ​​were 0.4, 0.8, 1.0, and 1.2, and the Agrobacterium strain K599 was substituted. As shown in Table 1, decreasing or increasing the concentration of the Agrobacterium inoculation solution resulted in a decrease in the positive rate of hairy root formation in subsequent bermudagrass runners. At all five inoculation solution concentrations, the K599 strain had a lower positive rate of hairy root formation in bermudagrass runners than the ATCC1583 strain.

[0100] Table 1

[0101]

[0102] Comparative Example 2

[0103] All steps were performed according to the method of Example 1, with the only difference being the number of times the sterilized bermudagrass runner segments were cut and punctured. As shown in Table 2, the highest hairy root induction rate was achieved when the bermudagrass runners were cut and scored 5-10 times and then punctured 3-5 times.

[0104] Table 2

[0105]

[0106]

[0107] Comparative Example 3

[0108] All steps were performed according to the method of Example 1, with the only difference being the vacuum treatment method used to infect Bermudagrass runners with Agrobacterium. As shown in Table 3, vacuuming for 20-30 minutes, pausing for 5-10 minutes, and continuing for 5-10 minutes resulted in a higher hairy root induction rate than other vacuum treatments. No vacuum treatment resulted in the lowest hairy root induction rate.

[0109] Table 3

[0110]

[0111]

[0112] Comparative Example 4

[0113] All steps were performed according to the methods of Example 1, with the only difference being that the light intensities used to induce hairy root growth after Agrobacterium infection of Bermudagrass runners were changed to 0, 500, 1500, and 2000 lux. As shown in Table 4, both decreasing and increasing the light intensity resulted in a decrease in the hairy root induction rate. Within the 500-1500 lux range, the hairy root induction rate remained above 20%.

[0114] Table 4

[0115] Light intensity (lux) Number of runners forming hairy roots Total number of runners Positive rate (%) 0 3 36 8.33 500 8 36 22.22 1000 9 36 25.00 1500 7 32 21.88 2000 5 36 13.89

Claims

1. A rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes, characterized in that: The following steps are involved: (1) Transformation, culture, and treatment of Agrobacterium rhizogenes: The binary vector containing the target gene is transformed into Agrobacterium and cultured and activated; (2) Disinfection and treatment of Bermuda grass runner segments: The hydroponic Bermuda grass runner segments were disinfected and then subjected to streaking and acupuncture treatments; (3) Infecting the stem segments of Bermudagrass runners with Agrobacterium rhizogenes to induce the formation of hairy roots: Infecting the stem segments of Bermudagrass runners with Agrobacterium rhizogenes to culture and produce hairy roots; (4) Regeneration of transgenic bermudagrass plants: The bermudagrass runner segments that have grown hairy roots are further cultured to regenerate plants.

2. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The Agrobacterium rhizogenes strain in step (1) is ATCC15834; the binary vector includes any one of the pBI, pCAMBIA, and pEarleyGate series vectors.

3. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The activation of Agrobacterium rhizogenes in step (1) is as follows: Agrobacterium rhizogenes is resuspended in an infection buffer to an OD 600 Prepare 0.6-0.8% Agrobacterium infection solution and let it stand in the dark at room temperature for 2-3 hours.

4. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The method for disinfecting the Bermuda grass runner stem segments in step (2) is as follows: soaking and disinfecting in sodium hypochlorite solution for 10-20 seconds, soaking and washing in sterile water for 10-20 seconds, soaking and disinfecting in ethanol solution for 30-60 seconds, soaking and washing in sterile water for 10-20 seconds, and repeating the washing 4-5 times.

5. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The method of marking and acupuncture in step (2) is as follows: using a scalpel to gently mark the surface of the disinfected Bermudagrass runner segment, marking each stem segment about 5-10 times; further using a medical disposable syringe needle to acupuncture the runner node, the insertion depth is about 1-3 mm, and each node is acupunctured 3-5 times.

6. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The method for infecting the Bermudagrass runner segments with Agrobacterium rhizogenes in step (3) is as follows: vacuuming is performed to allow the Agrobacterium rhizogenes bacterial solution to fully penetrate into the Bermudagrass runner tissue.

7. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The vacuum condition in step (3) is preferably a negative pressure of 0.8-1 kg / cm 2 Continue vacuuming for 20-30 minutes, rest for 5-10 minutes, and continue vacuuming to a negative pressure of 0.8-1kg / cm 2 Do this for 5-10 minutes.

8. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The culture medium used for producing hairy roots in step (3) is Hoagland solid culture medium.

9. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The culture conditions for producing hairy roots in step (3) are 16 hours light (500-1500 lux) / 8 hours dark cycle, 28° C., and 30%-60% humidity.

10. The rapid and efficient genetic transformation method of Bermudagrass mediated by Agrobacterium rhizogenes according to claim 1, characterized in that: The substrate used for regenerating plants from the bermudagrass runner segments growing hairy roots in step (4) is 4-8 mm vermiculite.