Reagent for activating beta-casein expression, recombinant mammary epithelial cell, method for increasing beta-casein content in milk and application
By using the dCas9 protein expression vector and sgRNA targeting the β-casein encoding gene, β-casein expression in mammary epithelial cells is activated, which solves the problems of unstable expression and high cost in existing technologies and achieves efficient and stable β-casein activation, which is suitable for the dairy industry.
Patent Information
- Application Number
- CN202510921280.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2025-09-23
AI Technical Summary
The existing technology of activating β-casein expression in mammary epithelial cells through chemical induction is unstable, inefficient and costly, making it difficult to meet the dairy industry's large-scale demand for high-protein dairy products.
The dCas9 protein expression vector is combined with sgRNA targeting the β-casein encoding gene. The expression of β-casein in mammary epithelial cells is activated by electroporation or lentiviral transfection to establish recombinant mammary epithelial cells that stably and highly express β-casein.
The efficient activation and stabilization of β-casein expression in mammary epithelial cells were achieved, the induction cost was reduced, and it is suitable for large-scale application in scientific research or production practice.
Smart Images

Figure CN120683179A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of gene engineering technology, and in particular relates to a reagent for activating beta-casein expression, a method for recombining mammary epithelial cells and increasing the beta-casein content in milk and their application. Background Art
[0002] β-casein, a core functional protein that contributes to the nutritional value and processing properties of dairy products, not only directly affects the emulsification, gelling, and digestion and absorption efficiency of dairy products, but is also a key indicator of milk quality. However, the β-casein content in natural milk sources is limited by genetic background, physiological state, and environmental factors, making it difficult to meet the dairy industry's demand for large-scale high-protein dairy products.
[0003] The existing technology mainly uses chemical induction (hormone treatment) to induce an increase in the expression of β-casein in mammary epithelial cells. For example, the combined treatment of hydrocortisone, insulin and prolactin (PRL) can induce the lactation phenotype of mammary epithelial cells; the vitamin A derivative retinoic acid (RA) and PRL synergistically increase the expression of specific casein genes; and progesterone is used to induce cells in vitro to increase the expression of specific casein genes. However, the induction effect of chemical induction (hormone treatment) is uneven, the induction efficiency fluctuates greatly, the reproducibility is poor, and the production cost is high, and it cannot stably produce high-protein dairy products. Summary of the Invention
[0004] In view of this, the present invention provides a reagent for activating β-casein expression, which can effectively increase the expression level of β-casein in mammary epithelial cells and can be used to construct a cell line that stably expresses β-casein for a long time.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] The present invention provides a reagent for activating β-casein expression, characterized in that it includes a dCas9 protein or a dCas9 protein expression vector, and also includes an sgRNA targeting a β-casein encoding gene or a gene derivative containing the sgRNA;
[0007] The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.
[0008] Preferably, the gene-derived product comprises a recombinant vector.
[0009] Preferably, the backbone vector of the recombinant vector includes PB-CAG-U6Kan-MS2-noiScaffold-PGKpuro-T2A-BFP.
[0010] Preferably, the cloning site of the sgRNA in the backbone vector includes a Bbs1 multiple cloning site.
[0011] The present invention provides a recombinant mammary epithelial cell comprising the reagent.
[0012] The present invention provides an application of the reagent or the recombinant mammary epithelial cell in increasing the beta-casein content in milk or dairy products.
[0013] The present invention provides an application of the reagent or the recombinant mammary epithelial cells in constructing a β-casein-expressing dominant cell model.
[0014] The invention provides a method for increasing the content of beta-casein in milk or dairy products, and utilizes the reagent to activate the expression of beta-casein in mammary epithelial cells.
[0015] Preferably, the mammary epithelial cells include primate mammary epithelial cells or bovine mammary epithelial cells.
[0016] Preferably, the activation method comprises electrofection or lentiviral transfection.
[0017] Compared with the prior art, the present invention has the following advantages:
[0018] The present invention provides a reagent for activating β-casein expression, comprising a dCas9 protein or a dCas9 protein expression vector, and also comprising an sgRNA targeting a β-casein-encoding gene or a gene-derived product comprising the sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1. The dCas9 of the present invention is combined with the sgRNA targeting the β-casein-encoding gene to activate the expression of the target gene. The sgRNA targeting the β-casein-encoding gene of the present invention is designed based on the CSN2 gene. The sgRNA and dCas9 activation plasmid are transferred into bovine mammary epithelial cells by electroporation. After the cells recover, they are screened for drug resistance. The resulting cells are amplified and tested at the transcriptional and protein levels to obtain an sgRNA sequence with extremely high activation efficiency. The results of the examples of the present invention show that the reagent can efficiently activate the expression of β-casein, increase the expression of CSN2 gene RNA and β-casein, and the effect is stable after repeated experiments.
[0019] The present invention provides a method for increasing the β-casein content in milk or dairy products, using the reagent to activate the expression of β-casein in mammary epithelial cells. The present invention addresses the problems of unstable induction effect, low induction efficiency and high cost when inducing mammary epithelial cells to express β-casein. The present invention activates the β-casein encoding gene in mammary epithelial cells based on dCas9 gene editing technology, and increases the expression level of β-casein by increasing the expression level of CSN2 gene RNA. At the same time, the present invention is a genetic modification performed at the cellular level, thereby establishing a recombinant mammary epithelial cell line that stably and highly expresses β-casein. The method of the present invention does not require prolactin, has low induction cost and high efficiency, and is suitable for large-scale induction in scientific research or production practice. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is the result of electroporation of dCas9 and gRNA into bovine mammary epithelial cells;
[0021] Figure 2 This is the result of the detection of CSN2 gene expression level;
[0022] Figure 3 This is the result of immunofluorescence staining of β-casein in cells after electroporation;
[0023] Figure 4 This is the result of detecting the CSN2 protein expression level in electroporated cells. DETAILED DESCRIPTION
[0024] The present invention provides a reagent for activating β-casein expression, comprising a dCas9 protein or a dCas9 protein expression vector, and also comprising an sgRNA targeting a β-casein encoding gene or a gene-derived product comprising the sgRNA;
[0025] The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1 (AGUAGCUACAGACCUUGGCU).
[0026] In the present invention, β-casein is an important component of milk that directly affects dairy quality and is encoded by the CSN2 gene. dCas9 is created by mutating the amino acids in the two nuclease domains of Cas9, resulting in a Cas9 protein without nuclease activity, namely dCas9 (DeadCas9). It loses its DNA-cutting function but retains the ability to bind to DNA. The CRISPR / dCas9 system, composed of dCas9 and sgRNA, is commonly used for genomic transcriptional regulation, activating or inhibiting the expression of specific genes, thereby achieving the purpose of studying gene function. The present invention does not specifically limit the source of the dCas9 protein expression vector, which can be obtained from conventional commercial sources. In the embodiment of the present invention, the dCas9 protein expression vector is PB-CAG-dCas9vp64-T2A-M6H-IRES-BSD, which is consistent with the prior art (Gao X, Nowak-Imialek M*, Chen X*, Chen D, Herrmann D, Ruan D, Andy Chen CH Andy, Eckersley-Maslin M, Shakil A, Lee YL, Kobayashi T, Ryan D, Tam PLP, Ahmed A, Wu D, Nie T, Pei D, Surani A, Shang Z, Lai L, Yeung SBW, Teichmann S, Niemann H#, Liu P#. Establishment of Porcine and Human Expanded Potential Stem Cells. Nature Cell Biology (2019). 21, p687-699.). The sgRNA targeting the β-casein encoding gene of the present invention is designed based on the CSN2 gene. In the embodiment of the present invention, the bovine CSN2 gene information is compared with the human CSN2 gene information. By analyzing the CSN2 gene structure and calculating its promoter region, multiple sgRNAs with strong specificity (sgRNA1, sgRNA2 and sgRNA3) are designed. After being transferred into the host mammary epithelial cells, the expression level of β-casein at the transcriptional level of the recombinant cells is detected. The results show that sgRNA1 has the highest activation efficiency for β-casein. At the same time, the expression level of β-casein in the recombinant cells is detected at the protein level. The results show that the obtained recombinant cells can express β-casein at high levels, the effect is stable, and no prolactin is required, the induction cost is low, and it is suitable for large-scale induction in scientific research or production practice.
[0027] In the present invention, the gene-derived product preferably includes a recombinant vector. In an embodiment of the present invention, the backbone vector of the recombinant vector is PB-CAG-U6Kan-MS2-noiScaffold-PGKpuro-T2A-BFP, which is consistent with the prior art (Chen Y*, Ye X*, Zhong Y*, Kang X*, Tang Y, Zhu H, Pang C, Ning S, Liang S, Zhang F, Li C, Li J, Gu C, Cheng Y, Kuang Z, Qiu J, Jin J, Luo H, Fu M, Hui HX, Li L, Ruan D, Liu P, Chen X, Sun L#, Ai S#, Gao X#. SP6 controls human cytotrophoblast fate determinations and trophoblast stem cell establishment by targeting MSX2 regulator elements. Developmental Cell. 2024 Apr 5.). The cloning site of the sgRNA in the backbone vector preferably includes a Bbs1 multiple cloning site. The method for constructing the recombinant vector preferably includes annealing the forward primer and reverse primer of the sgRNA to form a DNA fragment, and obtaining a recombinant vector by enzyme digestion and ligation of the DNA fragment and the backbone vector. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 2 (AGTAGCTACAGACCTTGGCT), and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 3 (CAGCCAAGGTCTGTAGCTACT). The combination of the recombinant vector and the dCas9 protein or the dCas9 protein expression vector can efficiently activate the expression of β-casein in mammary epithelial cells.
[0028] The present invention provides a recombinant mammary epithelial cell comprising the reagent.
[0029] In the present invention, the host cells of the recombinant mammary epithelial cells preferably include primate mammary epithelial cells and / or bovine mammary epithelial cells, and more preferably include human mammary epithelial cells or bovine mammary epithelial cells. Mammary epithelial cells are the core functional units of mammalian milk synthesis and have unique secretion and synthesis capabilities. They are regarded as ideal target cells for constructing mammary bioreactors and are important tools for studying mammary function. The preparation method of the recombinant mammary epithelial cells preferably includes transferring the reagent into the host cells. The reagent can target the CSN2 gene in the host cells and activate the expression of β-casein. The transfer method preferably includes electrofection or lentiviral transfection. The system of the electrofection method is preferably OPTIMEM culture medium containing host cells, Pbase, dCas9 protein expression vector and recombinant vector. The system of the electrofection method is preferably 150 μL, preferably including the following components: host cells 1.0~1.2×10 6, 150 μl of OPTIMEM medium, 1 μg of Pbase, 3 μg of dCas9 protein expression vector, and 2 μg of recombinant vector. In the present embodiment, Pbase is consistent with that in the prior art (Gao X, Nowak-Imialek M*, Chen X*, Chen D, Herrmann D, Ruan D, Andy Chen CH Andy, Eckersley-Maslin M, Shakil A, Lee YL, Kobayashi T, Ryan D, Tam PLP, Ahmed A, Wu D, Nie T, Pei D, Surani A, Shang Z, Lai L, Yeung SBW, Teichmann S, Niemann H#, Liu P#. Establishment of Porcine and Human Expanded Potential Stem Cells. Nature Cell Biology (2019). 21, p687-699.). After transfection, recombinant mammary epithelial cells are preferably obtained by antibiotic screening, and the antibiotics preferably include puromycin and blasticidin. After obtaining the recombinant mammary epithelial cells, they are preferably continued to be cultured to obtain a cell line with high expression of β-casein. The continued culture time is preferably 36 hours or more, more preferably 46 hours or more, further preferably 48 hours or more, and most preferably 48 to 480 hours, and the temperature is preferably 37.5°C. The culture medium for continued culture is preferably 1640 medium containing fetal bovine serum and antibiotics, and the volume percentage of the fetal bovine serum is preferably 7% to 11%, further preferably 8% to 10%, and most preferably 9%. The antibiotics preferably include penicillin and streptomycin, and the total volume of the penicillin and streptomycin accounts for preferably 1% of the volume percentage of the culture medium. The results of the implementation of the present invention show that the expression of CSN2 gene RNA and β-casein expression in the recombinant mammary epithelial cells is significantly increased after continued culture.
[0030] Based on the characteristics of the reagent being able to increase the expression of CSN2 gene RNA and β-casein in mammary epithelial cells and the characteristics of the recombinant mammary epithelial cells that highly express β-casein, the present invention provides a use of the reagent or the recombinant mammary epithelial cells in increasing the β-casein content in milk or dairy products. In the present invention, the increasing the β-casein content in milk or dairy products preferably includes increasing the expression of CSN2 gene RNA and / or β-casein in mammary epithelial cells. The method for increasing the β-casein content in milk or dairy products is preferably to cultivate the recombinant mammary epithelial cells.
[0031] The present invention provides a use of the reagent or the recombinant mammary epithelial cells in constructing a β-casein-dominant cell model. In the present invention, the method for constructing the β-casein-dominant cell model is preferably the same as the method for preparing the recombinant mammary epithelial cells, and will not be repeated here.
[0032] The present invention provides a method for increasing the beta-casein content in milk or dairy products, and utilizes the reagent to activate the expression of beta-casein in mammary epithelial cells.
[0033] In the present invention, the mammary epithelial cells are preferably the same as the host cells of the recombinant mammary epithelial cells. The activation method preferably includes electrofection or lentiviral transfection. In an embodiment of the present invention, the reagent is transferred into the host mammary epithelial cells by electrofection to activate the expression of β-casein. The electrofection method is preferably the same as the electrofection method in the above-mentioned recombinant mammary epithelial cells, and will not be repeated here. The electrofection method applies a short pulse high-voltage electric field to the mammary cells, which can produce channels on the cell membrane that allow extracellular molecules (such as plasmids, DNA, RNA, etc.) to enter within a short period of time. The cells obtained after electrofection are further cultured to obtain a cell line with high expression of casein, and the culture medium for continued culture is preferably the same as the culture medium for continued culture of the above-mentioned recombinant mammary epithelial cells, and will not be repeated here. The embodiments of the present invention show that the expression of β-casein in the cells obtained after transfection is increased. The method of the present invention integrates dCas9 gene editing technology and mammary cell culture technology, which can effectively increase the β-casein content in milk, providing a new technical means for promoting animal lactation.
[0034] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0035] Sources:
[0036] Bovine mammary epithelial cells (MAC-T) were derived from the same source as the bovine mammary epithelial cells (BMECs) used in the prior art (Cheng Xiaoou. Mechanism of Staphylococcus aureus invading bovine mammary epithelial cells and inducing heterophagy [D]. Inner Mongolia University, 2021. DOI: 10.27224 / d.cnki.gnmdu.2021.000032.) and were maintained in Laboratory 432, College of Life Sciences, Inner Mongolia University. Fetal bovine serum was purchased from BI, and penicillin-streptomycin mixture (double antibody) (PS) and OPTIMEM medium were purchased from Gibco.
[0037] The freezing medium was fetal bovine serum (FBS) containing 10% (volume fraction) DMSO.
[0038] Example 1
[0039] Method for establishing a cell line expressing activated β-casein dependent on exogenous genes
[0040] 1. sgRNA Design
[0041] The specific steps for designing sgRNAs for the dCas9-VP64 activation system are as follows: Using databases such as Ensembl and UCSC, retrieve published dairy cow genome information, download the CSN2 gene sequence, mRNA sequence, and CDS sequence, and roughly delineate the gene's promoter region. Compare the bovine CSN2 gene information with that of the human CSN2 gene to detect conserved sequences in the promoter region. Using a published sgRNA library for the human dCas9 activation system, design three sgRNAs within the bovine CSN2 gene promoter or proximal region (typically near the TSS), ensuring that the appropriate PAM sequence (NGG) is present near the sgRNA target sequence.
[0042] The DNA sequences of the three sgRNAs are:
[0043] sgRNA1:AGTAGCTACAGACCTTGGCT(SEQ ID NO:2)
[0044] sgRNA2:ACTTCCGTGTGTCCAGCCA (SEQ ID NO:4)
[0045] sgRNA3: GTTTGAAATAAAACCAATAG (SEQ ID NO: 5)
[0046] The designed sgRNA was checked for potential nonspecific targets using the online tool CRISPOR to ensure that it only binds to dCas9 in the target gene region.
[0047] 2. Construction of recombinant plasmid
[0048] Synthesize sgRNA DNA fragments: First, design primers based on the sgRNA in front of the casein promoter, dilute the primers to 100 μM, take 25 μL of each upstream and downstream primers, anneal at 2°C for 1 minute, and anneal from 98°C to 40°C to form double-stranded sgRNA DNA fragments (COW-CSN2-ACT-gRNA1, COW-CSN2-ACT-gRNA2, and COW-CSN2-ACT-gRNA).
[0049] The vector PB-CAG-U6Kan-MS2-noiScaffold-PGK puro-T2A-BFP was linearized by digestion with the restriction endonuclease Bbs1, and the correctness of the plasmid was confirmed by polyacrylamide gel electrophoresis.
[0050] The sgRNA DNA fragments were ligated with the digested vector using the following ligation system: 0.2 μL of T4 DNA Ligase (Thermo Fisher Scientific), 2 μL of 10× ligation buffer, 4 μL of backbone vector DNA (PB-CAG-U6Kan-MS2-noiScaffold-PGKpuro-T2A-BFP), 4 μL of the sgRNA DNA fragments, and 11.8 μL of H2O. Ligation was performed at 16°C for 15 min, resulting in recombinant plasmids (PB-CAG-COW-CSN2-ACT-gRNA1, PB-CAG-COW-CSN2-ACT-gRNA2, and PB-CAG-COW-CSN2-ACT-gRNA3).
[0051] The recombinant plasmid was transformed into DH5α by adding 1 μL of recombinant plasmid to 50 μL of DH5α, incubating at 42°C for 45 seconds, on ice for 3 minutes, adding 1 mL of LB medium and shaking at 37°C and 250 rpm for 1 hour. After the completion of the experiment, 3 μL was taken and streaked on a solid medium containing kanamycin for culture. After 12 hours, it was observed whether colonies grew. If colonies grew, it was a false positive. The other 97 μL was placed in 15 mL of LB medium containing Amp and shaken at 37°C and 250 rpm for 12 hours.
[0052] Plasmid Extraction: Recombinant plasmids were extracted using an endotoxin-free plasmid miniprep kit (purchased from Tiangen Biochemical Technology Co., Ltd.). Specifically, add 500 μL (or 250 μL) of equilibration solution BL to the adsorption column CP4 (or CP3) (placed in a collection tube). Centrifuge at 12,000 rpm (~13,400 g) for 1 min. Discard the waste liquid from the collection tube and return the adsorption column to the collection tube. Add 15 μL of bacterial culture to a centrifuge tube and centrifuge at 12,000 rpm (~13,400 g) for 1 min. For larger volumes of bacterial culture, perform several centrifugations to collect the bacterial pellet into a single centrifuge tube. Add 500 μL (or 250 μL) of solution P1 to the centrifuge tube containing the bacterial pellet. Use a pipette or vortex mixer to thoroughly resuspend the bacterial cell pellet. Add 500 μL (or 250 μL) of solution P2 to the centrifuge tube and gently invert the tube 6-8 times to fully lyse the cells. Add 700μL (or 350μL) of solution P3 to the centrifuge tube, and immediately and gently turn it upside down 6 to 8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12000rpm (~13400g) for 10 minutes. Add the supernatant collected in the previous step to the filter column Cs (the filter column is placed in the collection tube), centrifuge at 12000rpm (~13400g) for 2 minutes, and carefully add the solution obtained in the collection tube after centrifugation to the adsorption column CP4 (or CP3) (the adsorption column is placed in the collection tube). Centrifuge at 12000rpm (~13400g) for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column CP4 (or CP3) in the collection tube. Add 500 μL of deproteinizing solution PD to the adsorption column CP4 (or CP3) and centrifuge at 12,000 rpm (~13,400 g) for 1 minute. Discard the waste liquid from the collection tube and place the adsorption column CP4 (or CP3) in the collection tube. Add 600 μL of rinse solution PW (please check that anhydrous ethanol has been added) to the adsorption column CP4 (or CP3) and centrifuge at 12,000 rpm (~13,400 g) for 1 minute. Discard the waste liquid from the collection tube and place the adsorption column CP4 (or CP3) in the collection tube. Repeat the rinsing step once. Return the adsorption column CP4 (or CP3) to the collection tube and centrifuge at 12,000 rpm (~13,400 g) for 2 minutes to remove any remaining rinse solution. Uncap the adsorption column CP4 (or CP3) and let it sit at room temperature for several minutes to completely dry any remaining rinse solution from the adsorption material. Place the adsorption column in a clean centrifuge tube, add 100 μL of elution buffer TB to the middle part of the adsorption membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12000 rpm (~13400g) for 1 minute to collect the recombinant plasmid solution into the centrifuge tube for later use.
[0053] 3. Culture and Passaging of MAC-T Cells
[0054] The growth morphology of MAC-T cells needs to be observed daily, and the medium should be changed on time every day to ensure that the cells have sufficient nutrition. Remove the MAC-T cells from the incubator, aspirate the culture medium in the wells, slowly add 1mL of DPBS buffer to the wells where they adhere to the wall, gently shake the culture plate several times, and aspirate the wash solution in the wells to remove dead cells and impurities. Immediately after aspirating the DPBS, add 500μL of preheated trypsin (TRYPSIN) and place in the incubator for 3 minutes. If the cells are basically no longer attached to the wall when observed under a microscope, add 1.5mL of preheated stop solution (cell culture medium), repeatedly pipette and shake several times, and aspirate the cell suspension into a 15mL centrifuge tube and centrifuge (1300rpm, 3min). Aspirate the supernatant in the centrifuge tube and the prepared M1640 medium containing 10% (volume percentage) FBS and 1% (volume percentage) PS, aspirate 1mL of culture medium to resuspend the cell pellet and then culture it on a 6-well plate.
[0055] 4. Electrotransfection of cells and cell line screening
[0056] The cultured MAC-T cells were counted, and 1.0-1.2×10 6 For electroporation. Preheat the culture medium containing 10% (volume percentage) FBS and 1% (volume percentage) PS at 1300 rpm for 3 minutes to harvest the cells. Remove the remaining medium after centrifugation and resuspend the cells in 1 mL of DPBS. Repeat this process at 1300 rpm for 3 minutes to remove the supernatant and rinse the cells. Add 1 mL of 1640 medium to the cell culture plate and place in the incubator to preheat. In the experimental group, cells were resuspended in 50 μl OPTIMEM medium, and 1 μg of Pbase, 3 μg of dCas9 expression vector (PB-CAG-dCas9vp64-T2A-M6H-IRES-BSD), and 2 μg of recombinant plasmid (PB-CAG-COW-CSN2-ACT-gRNA1, PB-CAG-COW-CSN2-ACT-gRNA2, or PB-CAG-COW-CSN2-ACT-gRNA3) were resuspended in 100 μl OPTIMEM medium. The total electroporation system was 150 μL.
[0057] Turn on the electroporator and adjust the parameters to L-024SW480 during electroporation. After the electroporation is completed, press the Home button and then turn off the power of the electroporator. After the electroporation is completed, add 1000μL of 1640 culture medium to the electrode cup, pipetting while adding, and do not repeatedly pipette. After aspirating the cells in the cup, add them to the cell culture plate for recovery culture. The cell culture plate has been added with 1mL of preheated 1640 culture medium containing 10% (volume percentage) FBS and 1% (volume percentage) PS. Place the cell culture plate in the incubator for culture, observe the cell status every day, and change the culture medium for the cells. When the cell density grows to 80%, the culture medium is replaced with a culture medium containing 0.8μg / mL puromycin (PURO) and 30μg / mL blasticidin (BSD) for several days until the cell density grows to 80% again.
[0058] The experimental group cells after drug screening were recorded as ACT-CSN2-gRNA1, ACT-CSN2-gRNA2 and ACT-CSN2-gRNA3, and the control group cells were recorded as con (the control group was MAC-T cells that were not electroporated). Figure 1 As shown, two days after electroporation, ACT-CSN2-gRNA1 and ACT-CSN2-gRNA2 cells grew normally, while ACT-CSN2-gRNA3 cells showed almost no growth. Ten days after drug screening, cells in the ACT-CSN2-gRNA1 and ACT-CSN2-gRNA2 experimental groups grew normally, while all cells in the control group had died. The cells were further expanded and cryopreserved in cryopreservative medium, and the cell lines obtained from the experimental groups were cultured long-term.
[0059] Example 2
[0060] Detection of related gene RNA and protein levels
[0061] Sampling was performed on the 10th day after electroporation of MAC-T cells, and electroporated CSN2 was detected at the gene mRNA and protein levels.
[0062] 1. RNA Level Assay: After removing the culture medium, add TRIzol reagent to the culture dish and pipette thoroughly to allow for complete reaction. After complete lysis of adherent cells, collect the cells into a centrifuge tube. After standing at room temperature for 5 minutes, add chloroform equal to one-fifth the volume of TRIzol reagent previously used. After standing at room temperature for 10 minutes, centrifuge at 4°C, 12,000 rpm, for 15 minutes. After centrifugation, tilt the tube 45 degrees and remove the supernatant. Collect the RNA in a new tube. Add isopropanol and allow to stand at room temperature for 10 minutes. Centrifuge at 4°C, 12,000 rpm, for 10 minutes. Vortex the collected pellet and resuspend it in fresh 75% ethanol. Centrifuge again at 4°C, 7,500 rpm, for 5 minutes. Remove the supernatant and invert the tube in a laminar flow hood until no ethanol residue remains. Resuspend the pellet in enzyme-free water using a micropipette and incubate the sample in a 55°C water bath for 10 minutes before removing. Measure RNA concentration using a UV spectrophotometer, label, and store at -80°C or proceed to the next step. Prepare the following reaction mixture in a PCR tube for a total volume of 10 μL: 7 μL of RNase-Free ddH2O, 1 μL of dNTP Mixture, 1 μL of Oligo dT Primer, and 1 μg of RNA template. Incubate the reaction mixture at 55°C for 5 minutes and then immediately cool on ice. Prepare the following reaction mixture in a total volume of 20 μL: 10 μL of prepared RNA substrate, 5 μL of RNase-Free ddH2O, 4 μL of 5× Prime Script Buffer, 1 μL of RNase Inhibitor, and 1 μL of Prime Script RNase. Mix gently and incubate the reaction mixture at 37°C for 1 hour. Then, incubate at 95°C for 5 minutes to inactivate the enzymes. Immediately cool the reaction mixture on ice or store it in a -80°C freezer for long-term storage. Then, in a dark-proof condition, prepare the following reaction mixture in a total volume of 20 μL in an opaque PCR tube: 10 μL of SYBR Premix Ex Taq, 2 μL of primers (1 μL each of forward and reverse primers), 2 μg of cDNA template, and 6 μL of RNase Free ddH2O. After accurately arranging the above reactants according to the gene, place them in the PCR instrument. Set the following cycle: pre-denaturation at 95°C for 2 minutes; high-temperature denaturation at 95°C for 30 seconds, low-temperature annealing at 58°C for 45 seconds, and extension at 72°C for 30 seconds for a total of 38 cycles before storing at 4°C. The primer sequences involved are as follows:
[0063] CSN2 forward primer: AGGAACAGCAGCAAACAG (SEQ ID NO: 6);
[0064] CSN2 reverse primer: TTTCCAGTCGCAGTCAAT (SEQ ID NO: 7);
[0065] GAPDH forward primer: ACGGCACAGTCAAGGCAGA (SEQ ID NO: 8);
[0066] GAPDH forward primer: GTGATGGCGTGGACAGTGG (SEQ ID NO: 9).
[0067] The final test results are as follows Figure 2 As shown. Figure 2 It can be seen that the expression level of CSN2 mRNA in the experimental group was higher than that in the control group, and the results of ACT-CSN2-gRNA1 were significantly better than those of ACT-CSN2-gRNA2.
[0068] 2. Immunofluorescence Detection: Remove the cell culture medium and wash three times with ice-cold PBS. Fix the cells with 4% paraformaldehyde for 15 minutes at room temperature. Remove the fixative and wash three times with 1× PBS. Permeabilize the cells with permeabilization buffer (0.01 mL Triton-X-100 dissolved in 10 mL PBS) for 10 minutes at room temperature. Remove the permeabilization buffer and wash three times with 1× PBS. Block the cells with blocking buffer (0.2 g BSA, 1.126 g Glysine, and 0.05 mL Tween 20 dissolved in 25 mL 1× PBS) at room temperature for one hour. Apply the primary antibody (CNS2) (purchased from Absin, Cat. No. abs155433) at a dilution of 1:500 in 500 μL of blocking buffer and incubate overnight at 4°C in the dark. Remove the primary antibody solution and wash three times with 1× PBS. Dilute the secondary antibody (Alex flour 488 Goat anti-mouse IgG) (purchased from Invitrogen, catalog number A-21206) at a ratio of 1:1000 in 500 μL blocking buffer and incubate on a shaker at room temperature in the dark for 1 hour. Remove the secondary antibody solution and wash three times with 1× PBS solution. Dilute 0.1 μg / mL DAPI in 500 μL blocking buffer and incubate on a shaker at room temperature in the dark for 5 minutes. Remove the DAPI solution and wash three times with 1× PBS solution. Cover the slides and perform confocal imaging using a scanning laser confocal microscope (NIS-Elements Viewer 4.20). Figure 3 The results showed that after electroporation, the expression of β-casein in the experimental group cells was significantly increased compared with the control group.
[0069] 3. Protein Level Assay: Add an appropriate amount of lysis buffer to the cells and lyse on ice for a period of time. Centrifuge at 4°C and collect the supernatant, which is the total protein extracted. Determine the protein concentration using a protein quantification kit such as the BCA assay. Prepare a separating gel and stacking gel, mix the protein sample with the loading buffer, and boil to denature.
[0070] Add the protein sample to the gel wells and perform electrophoresis to separate the proteins by molecular weight. After electrophoresis, transfer the proteins from the gel to a PVDF membrane. After transfer, place the membrane in blocking buffer and block at room temperature for 1 hour. After blocking, incubate the membrane with the primary antibody (CSN2) at 4°C overnight. After the primary antibody incubation, wash the membrane three times with TBST buffer for 10 minutes each time and incubate the membrane with the secondary antibody at room temperature for 1-2 hours.
[0071] After secondary antibody incubation, wash the membrane three times with TBST buffer for 10 minutes each time to remove unbound secondary antibody. Visualize the protein bands on the membrane using an ECL chemiluminescence kit. Photograph the developed membrane using a chemiluminescence imaging system or gel imaging system and save the image. Figure 4 The results showed that the expression level of β-casein in ACT-CSN2-gRNA1 after electroporation was significantly higher than that in the control group.
[0072] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A reagent for activating β-casein expression, characterized in that It includes a dCas9 protein or a dCas9 protein expression vector, and also includes an sgRNA targeting a β-casein encoding gene or a gene-derived product containing the sgRNA; The nucleotide sequence of the sgRNA is shown in SEQ ID NO:
1.
2. The reagent according to claim 1, characterized in that The gene-derived products include recombinant vectors.
3. The reagent according to claim 2, characterized in that The backbone vector of the recombinant vector includes PB-CAG-U6Kan-MS2-noiScaffold-PGKpuro-T2A-BFP.
4. The reagent according to claim 3, characterized in that The cloning site of the sgRNA in the backbone vector includes a Bbs1 multiple cloning site.
5. A recombinant mammary epithelial cell, characterized in that: The invention comprises the reagent according to any one of claims 1 to 4.
6. Use of the reagent according to any one of claims 1 to 4 or the recombinant mammary epithelial cells according to claim 5 for increasing the β-casein content in milk or dairy products.
7. Use of the reagent according to any one of claims 1 to 4 or the recombinant mammary epithelial cells according to claim 5 in constructing a β-casein-expressing dominant cell model.
8. A method for increasing the content of β-casein in milk or dairy products, characterized in that: The reagent according to any one of claims 1 to 3 is used to activate the expression of β-casein in mammary epithelial cells.
9. The method according to claim 8, characterized in that The mammary epithelial cells include primate mammary epithelial cells and / or bovine mammary epithelial cells.
10. The method according to claim 8 or 9, characterized in that: The activation method includes electro-transfection or lentiviral transfection.