Primer and probe composition for detecting nocardia seriolae based on TaqMan qPCR and application of primer and probe composition

By designing specific primers and probe combinations for TaqMan qPCR, the problem of rapid and accurate detection of Nocardia in yellowtail was solved, achieving early diagnosis of Nocardiosis and measurement of pathological severity, supporting the management and treatment of the aquaculture industry.

CN120683276APending Publication Date: 2025-09-23SUN YAT SEN UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510612616.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately detect Nocardia in yellowtail, resulting in difficulty in early diagnosis of nocardiosis and causing economic losses to the aquaculture industry.

Method used

Specific primer and probe combinations were designed for TaqMan qPCR detection of Nocardia seriola, including primers GntRs-F and GntRs-R and probe GntRs-P. Combined with TaqMan fluorescence quantitative PCR technology, a qualitative and quantitative detection method was established.

Benefits of technology

It has achieved rapid, specific, repeatable and accurate detection of Nocardia spp. in yellowtail, supported early diagnosis and measurement of pathology degree, guided aquaculture management and treatment, and provided an epidemiological survey tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683276A_ABST
    Figure CN120683276A_ABST
Patent Text Reader

Abstract

The invention discloses a primer and probe composition for detecting nocardia seriolae based on TaqMan qPCR (quantitative polymerase chain reaction) and application of the primer and probe composition. According to the invention, a qualitative and quantitative detection method for nocardia seriolae is established by utilizing the specific primers and probes, and the method is used for carrying out qualitative detection on water bodies and fish bodies of farms of snakeheads and hybrid snakeheads in different regions and detecting different tissues after the hybrid snakeheads counteract the nocardia seriolae, and has a very good detection effect. According to the invention, the purposes of nocardia seriolae monitoring, nocardia disease diagnosis, pathological degree measurement and the like can be realized, a reliable detection tool can be provided for nocardia seriolae epidemiological investigation, and nocardia disease can be diagnosed in an early stage so as to guide culture management and reasonable medication treatment; and a research basis and a technical support are provided for exploring epidemic characteristics and pathological mechanisms of nocardia seriolae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of Nocardia serrata detection, and more particularly to a primer and probe composition for detecting Nocardia serrata based on TaqMan qPCR and an application thereof. Background Art

[0002] Nocardiosis, caused by Nocardia seriola, is a chronic systemic disease with a long incubation period and a prolonged course. Early onset is asymptomatic and difficult to detect, while later onset is difficult to treat and results in high mortality, causing significant economic losses to the aquaculture industry. Rapid and accurate diagnosis is an effective means of preventing and controlling fish nocardiosis. Early, accurate, and precise detection of Nocardia seriola infection during the aquaculture process is crucial to enabling timely action and preventing subsequent economic losses. Traditional pathogen isolation and identification methods offer high accuracy, but are limited by the slow growth of Nocardia seriola. Isolation and identification typically require 10 to 14 days, or even longer. Conventional PCR, while offering advantages such as rapid detection, ease of use, and low cost, suffers from low sensitivity, poor specificity, and instability, often leading to false positives.

[0003] Probe-based real-time fluorescence quantitative PCR (TaqMan qPCR) involves adding a specific TaqMan fluorescent probe to a pair of primers during PCR amplification. Its binding site is located between the two primers. When the probe is intact, the fluorophore and quencher are in close proximity, quenching the fluorescent signal emitted by the fluorophore and making it undetectable by the instrument. During the PCR extension phase, Taq DNA polymerase reaches the probe binding site and activates its 5'-3' exonuclease activity, cleaving the fluorophore at the 5' end of the probe, separating it from the quencher and emitting fluorescence that can be detected by the instrument. The intensity of the fluorescence signal is proportional to the amount of PCR product. By measuring the fluorescence intensity during PCR, the amount of PCR product amplified can be determined. Compared to other molecular detection methods, TaqMan qPCR has been widely used in various fields due to its high sensitivity, strong specificity, excellent reproducibility, and wide linear range. These applications include quantitative and qualitative analysis of infectious diseases, detection of pathogenic microorganisms or viruses, detection of copy number in transgenic plants and animals, and detection of RNAi gene inactivation rates.

[0004] Hybrid snakeheads are a benthic fish belonging to the Channa genus of the family Channidae in the order Perciformes. They are a hybrid of the black snakehead (Channa argus) and the spotted snakehead (Channa maculata). Hybrid snakeheads possess excellent traits such as tolerance to hypoxia, low temperatures, and poor water quality, and their medicinal and edible properties make them popular with consumers and fish farmers. However, hybrid snakeheads are a frequent source of nocardiosis, a common infection. Furthermore, certain pathogens, such as Aeromonas schubertii, Mycobacterium tuberculosis, and Rickettsia-like bacteria, can cause symptoms such as visceral nodules that are similar to those of nocardiosis and are difficult to distinguish. Therefore, developing specific, rapid, sensitive, and accurate detection methods is crucial for early warning and pathogen monitoring of Nocardia in yellowtail during fish farming. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a primer and probe combination for detecting Nocardia spp. based on TaqMan qPCR and its application.

[0006] The first object of the present invention is to provide a primer and probe combination for detecting Nocardia seriola based on TaqMan qPCR.

[0007] The second object of the present invention is to provide a use of any of the primer and probe combinations in preparing a kit for detecting Nocardia seriola.

[0008] The third object of the present invention is to provide a kit for detecting Nocardia spp.

[0009] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0010] A primer and probe composition for detecting Nocardia seriola based on TaqMan qPCR comprises primers with nucleotide sequences shown in SEQ ID NOs. 1 and 2 and a probe with a nucleotide sequence shown in SEQ ID NO. 3.

[0011] GntRs-F: 5'-CGATTTCCACCGCGAGTA-3' (SEQ ID NO. 1);

[0012] GntRs-R: 5'-ATGATTCGATCCCGGGTTGG-3' (SEQ ID NO. 2);

[0013] The sequence of the probe GntRs-P is: 5'-CGCTGCTCATCGGCTTCTACGA-3' (SEQ ID NO. 3).

[0014] Preferably, the probe is modified with a fluorescent group at the 5' end and a quencher group at the 3' end.

[0015] More preferably, the fluorescent group is 6-FAM.

[0016] More preferably, the quencher group is BHQ1.

[0017] The present invention also claims the use of any of the above primer and probe combinations in preparing a kit for detecting Nocardia seriola.

[0018] Preferably, the detection of Nocardia seriola is a qualitative detection of Nocardia seriola.

[0019] Preferably, the detecting of Nocardia seriola is a quantitative detection of Nocardia seriola.

[0020] Preferably, the detecting of Nocardia seriola is detecting Nocardia seriola in water or fish.

[0021] The present invention also claims a kit for detecting Nocardia seriola, which contains any one of the primer and probe combinations.

[0022] Preferably, the kit further contains a positive plasmid, which is an amplification product connected to primers with nucleotide sequences as shown in SEQ ID NOs. 1 to 2.

[0023] Preferably, it also contains TaqMan qPCR reagents.

[0024] As a specific example, the reaction system of TaqMan-based qPCR is as follows: 10 μL (200 ng) of sample DNA, Blend Taq TM -Plus 1 μL, Blend Taq buffer 5 μL, 10 μM forward primer GntRs-F 1 μL, 10 μM reverse primer GntRs-R 1 μL, 2 mM dNTPs 5 μL, ddH2O 27 μL, a total of 50 μL;

[0025] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 15 sec; and final extension at 72°C for 7 min.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention utilizes specific primers and probes to establish a qualitative and quantitative detection method for Nocardia spp., which has good specificity, repeatability, applicability and accuracy.

[0028] This method was used to qualitatively detect Nocardia in yellowtail in water and fish from snakehead and hybrid snakehead farms in different regions, as well as quantitatively detect different tissues of hybrid snakehead after infection with Nocardia, thereby achieving the goals of Nocardia monitoring in yellowtail, diagnosing nocardiosis, and measuring the degree of pathology. It can not only provide a reliable detection tool for the epidemiological survey of Nocardia in yellowtail, but also enable early diagnosis of nocardiosis, thereby guiding aquaculture management and rational drug treatment, providing a research basis and technical support for exploring the epidemic characteristics and pathological mechanisms of Nocardia in yellowtail. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The cloning of the amberjack-specific amplicon GntRs (A) and the colony PCR identification of the standard positive plasmid containing the amplicon GntRs (B); in (A), M is a DNA marker; N is a negative control; 1 to 4 are the amplicon GntRs of the amberjack; in (B), M is a DNA marker; N is a negative control; 1 to 3 are the positive clones of the standard positive plasmid containing the amplicon GntRs.

[0030] Figure 2 The amplification curves (A) of the TaqMan qPCR of the GntRs amplicon specific to Nocardia serrata at different copy numbers and the resulting standard curve (B); 1 to 10 are: 10 10 copies / μL, 10 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL.

[0031] Figure 3 The TaqMan qPCR amplification curve is used for the specific detection of the standard curve; P is the positive control; N is the negative control; 1 is Nocardia sphenotype; 2 to 12 are Escherichia coli, Acinetobacter spp., Vibrio vulnificus, Streptococcus agalactiae, Vibrio harveyi, Priesteria raphe, Bacillus subtilis, Aeromonas hydrophila, Edwardsiella tarda, Aeromonas schubertii, and Staphylococcus aureus.

[0032] Figure 4TaqMan qPCR amplification curve for repeatability test of standard curve; A is: amplification curve of the first batch in the morning; B is: amplification curve of the second batch in the afternoon; C is: amplification curve of the third batch in the evening; 1 to 9 are: 10 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL.

[0033] Figure 5 This is the TaqMan qPCR amplification curve for the suitability test of the standard curve; P is the positive control; 1-8 are Nocardia from snakehead, Nocardia from hybrid snakehead, Nocardia from largemouth bass, Nocardia from seven-spotted sea bass, Nocardia from jewel bass, Nocardia from silver carp, Nocardia from golden pomfret, and Nocardia from catfish.

[0034] Figure 6 Comparison of the standard curve (A) and slope (B) formed by plasmid and genome in the accuracy test of the standard curve. In A, the standard curve equation and R of the three plasmid samples 2 Marked above the graph, from left to right, correspond to the blue dotted line, orange dotted line, and green dotted line; the standard curve equations of the three genomic samples and R 2 The markings are below the chart, corresponding to the blue solid line, orange solid line and green solid line from left to right.

[0035] Figure 7 Qualitative detection of Nocardia spp. in aquaculture water by TaqMan qPCR; A: 9 water samples (1-9) collected from hybrid snakehead fish ponds in Foshan City, Guangdong Province; B: 6 water samples (10-15) collected from snakehead fish ponds in Shangrao City, Jiangxi Province; C: 5 water samples (16-20) collected from snakehead fish ponds in Hanchuan City, Hubei Province.

[0036] Figure 8Qualitative detection of Nocardia in yellowtail fish tissues by TaqMan qPCR; A shows the detection of various parts of a hybrid snakehead suspected of having nocardiosis, with numbers 1 to 10 representing: liver, spleen, head kidney, body kidney, heart, brain, gills, stomach, intestines, and muscle; B shows the detection of various parts of a black snakehead suspected of having nocardiosis, with numbers 11 to 16 representing: liver, spleen, head kidney, body kidney, heart, and brain.

[0037] Figure 9 TaqMan qPCR was used to detect the bacterial load in various tissues of yellowtail after hybrid snakehead was infected with Nocardia spp. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0039] The manufacturers of the relevant instruments, reagents and materials used in the following examples are:

[0040] Clean bench (Zhixiang Company); biochemical incubator (Xinjiangnan Company); constant temperature shaker (Hualida Company); desktop high-speed centrifuge (Thermo Company); water bath (Qilin Bell Company); nucleic acid electrophoresis equipment (Baijing Company); conventional PCR instrument (Bio-Red Company); gel imager (Syngene Company); UV gel excision equipment (Qilin Bell Company); NanoDrop2000 (Thermo Company); qPCR instrument (Bio-Red Company); bacterial genomic DNA extraction kit, marine animal tissue genomic DNA extraction kit (Tiangen Company); Blend Taq-plus PCR enzyme kit and Ligation High ligation reagent (TOYOBO Company); EZNA Gel ExtraCqion Kit, EZNA Plasmid Mini Kit (Omega Company); linearized T vector pUCm-T (Sangon Biotechnology Company); 2×Taq PCR StarMix (GenStar Company); 2×FastProbe Mixture (Kangwei Century Company); Water Genomic DNA Extraction Kit (Fuji Biological Company); 100bp and 1kbp DNA Ladder (Guangzhou Dongsheng Company); DH5α competent cells (homemade); AP-9950 vacuum pump (Automaticscience); 0.22μm filter membrane (Jinteng Company).

[0041] Nocardia seriola was isolated and identified from diseased hybrid snakehead fish by Professor Li Kaibin of the Pearl River Fisheries Research Institute of the Chinese Academy of Fishery Sciences and was kindly donated.

[0042] Escherichia coli, Streptococcus agalactiae, Bacillus subtilis, Pseudomonas aeruginosa, Aeromonas schubertii, and Aeromonas hydrophila were isolated, identified, and preserved in our laboratory. Vibrio vulnificus, Acinetobacter, Staphylococcus aureus, Vibrio harveyi, and Edwardsiella tarda were kindly donated by the teams of He Jianguo and Huang Zhijian from the School of Life Sciences of Sun Yat-sen University.

[0043] Example 1 Design of specific primers and probes for Nocardia serrata and construction of standard curve plasmids

[0044] 1. Experimental Methods

[0045] (1) Design of specific primers and probes for Nocardia serrata

[0046] Based on the multiple amino acid sequence alignment of the GntR family transcription factors of different Nocardia species, it was found that their C-termini have intraspecies conserved and interspecies specific sequence properties. Specific primers GntRs-F and GntRs-R were designed based on the C-terminal sequence of Nocardia seriola, and the probe GntRs-P was designed. The TaqMan qPCR primers and probe designed for this amplicon are as follows. The primer and probe sequences were synthesized by Sangon Co., Ltd.

[0047] Forward primer (GntRs-F): 5'-CGATTTCCACCGCGAGTA-3' (SEQ ID NO: 1); reverse primer (GntRs-R): 5'-ATGATTCGATCCGGGTTGG-3' (SEQ ID NO: 2); probe (GntRs-P): 5'-6FAM-CGCTGCTCATCGGCTTCTACGA-BHQ1-3' (SEQ ID NO: 3).

[0048] (2) Standard curve plasmid construction

[0049] (a) The Nocardia seriola genome was extracted according to the instructions of the bacterial genomic DNA extraction kit. The concentration and quality of the extracted genome were detected by NanoDrop 2000 and agarose gel electrophoresis.

[0050] (b) Using the gDNA (genomic DNA) of Nocardia seriola as a template, primers GntRs-F and GntRs-R were used to amplify the Nocardia seriola-specific amplicon GntRs by PCR.

[0051] The PCR reaction system is: 10 μL (200 ng) of Nocardia serrata genomic DNA, Blend TaqTM -Plus 1 μL, Blend Taq buffer 5 μL, 10 μM forward primer GntRs-F 1 μL, 10 μM reverse primer GntRs-R 1 μL, 2 mM dNTPs 5 μL, ddH2O 27 μL, a total of 50 μL;

[0052] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 15 sec; and final extension at 72°C for 7 min.

[0053] (c) The PCR reaction solution was then subjected to agarose gel electrophoresis, and the target fragment was recovered according to the instructions of the EZNA Gel ExtraCqion Kit. After sequencing, the correctly sequenced recovered amplification product GntRs was retained.

[0054] (d) According to the instructions of Ligation High, the amplified product GntRs was ligated with the cloning vector pUCm-T, and then the recombinant plasmid pUC-GntRs was transformed into DH5α competent cells using the heat shock method and expanded.

[0055] (e) Plasmids were extracted according to the instructions of the EZNA Plasmid Mini Kit, and the extracted plasmids were sequenced. The plasmid with correct sequencing was retained as the standard curve plasmid pUCm-GntRs.

[0056] 2. Experimental Results

[0057] The results are as follows Figure 1 As shown, a 135 bp specific amplicon (SEQ ID NO: 4: ATGATTCGATCCGGGTTGGTCTCGCCCCGGCGCAGCGCC ACGCTGTTCAGCCGGCGCTGGCGTTCGCGCAGCGAGTCGTAGAAGCCGATGAGCAGC GGATTGTCGGCGGCCACCACGTACTCGCGGTGGAAATCG) was successfully amplified from the genome of Nocardia seriola. Positive clones containing the standard curve plasmid pUCm-GntRs were successfully screened by colony PCR. After expansion culture, the plasmid was extracted and the recombinant plasmid concentration was measured by NanoDrop 2000 to be 312.6 ng / μL. The copy number of the plasmid was calculated according to the formula: 9.72×10 10 copies / μL.

[0058] Example 2 Standard Curve Establishment and Sensitivity Detection

[0059] 1. Experimental Methods

[0060] (a) The standard curve plasmid pUCm-GntRs was diluted 10-fold in a continuous gradient to obtain: 9.72×10 10 copies / μL、9.72×10 9 copies / μL、9.72×10 8 copies / μL、9.72×10 7 copies / μL、9.72×10 6 copies / μL、9.72×10 5 copies / μL、9.72×10 4 copies / μL、9.72×10 3 copies / μL、9.72×10 2 copies / μL、9.72×10 1 copies / μL、9.72×10 0 copies / μL.

[0061] (b) The sequentially diluted plasmids were used as TaqMan qPCR templates, and qPCR was performed with three technical replicates for each gradient.

[0062] The qPCR reaction system was as follows: standard curve plasmid pUCm-GntRs DNA 1 μL, 2× Fast Probe Mixture 10 μL, 10 μM forward primer GntRs-F 1 μL, 10 μM reverse primer GntRs-R 1 μL, 10 μM probe GntRs-P 1 μL, ddH2O 6 μL, a total of 20 μL;

[0063] The qPCR reaction conditions were as follows: pre-denaturation at 95°C for 4 min, denaturation at 95°C for 5 sec, annealing / extension at 62°C for 30 sec, and 40 cycles.

[0064] After the reaction is completed, it is processed in Bio-Rad CFX manage software to obtain the standard curve and the minimum detection limit (LOD) of the yellowtail Nocardia spp.-specific GntRs amplicon at different copy numbers and its required Cq (Quantification Cycle) value.

[0065] 2. Experimental Results

[0066] The results are as follows Figure 2 As shown in the figure, it shows that the amplified products obtained by using the specific amplification of GntRs-F and GntRs-R designed in the embodiment have a good linear relationship with their required Cq values ​​at different copy numbers. 10copies / μL to 9.72×10 1 The copies / μL equation is: y = -3.3248x + 42.261, and the linear fit is R 2 =0.9962, amplification efficiency E = 99.9%; the lowest limit of detection (LOD) was 9.72×10 1 copies / μL (Cq=35.44), so when Cq≤35, the test result was judged as positive; when Cq>35, the test result was judged as negative, thereby determining the evaluation criteria for qualitative detection of Nocardia spp. by this method.

[0067] Example 3 A method for specific detection of Nocardia spp.

[0068] TaqMan qPCR reaction was performed on the gDNA of the sample to be tested using the following specific primers and probes: forward primer (GntRs-F): 5'-CGATTTCCACCGCGAGTA-3' (SEQ ID NO: 1); reverse primer (GntRs-R): 5'-ATGATTCGATCCGGGTTGG-3' (SEQ ID NO: 2); probe (GntRs-P): 5'-6FAM-CGCTGCTCATCGGCTTCTACGA-BHQ1-3' (SEQ ID NO: 3).

[0069] The qPCR reaction system is as follows: 1 μL of gDNA of the sample to be tested, 10 μL of 2×Fast Probe Mixture, 1 μL of 10 μM forward primer GntRs-F, 1 μL of 10 μM reverse primer GntRs-R, 1 μL of 10 μM probe GntRs-P, and 6 μL of ddH2O, for a total of 20 μL;

[0070] The qPCR reaction conditions were as follows: pre-denaturation at 95°C for 4 min, denaturation at 95°C for 5 sec, annealing / extension at 62°C for 30 sec, and 40 cycles.

[0071] Qualitative test: The presence of Nocardia spp. is determined based on the Cq of the sample to be tested: when Cq ≤ 35, the test result is considered positive; when Cq > 35, the test result is considered negative.

[0072] Quantitative detection: The bacterial load of Nocardia seriola in the sample to be tested was calculated using the Cq of the sample to be tested and the standard curve obtained in Example 2.

[0073] Example 4 Specificity of the method for detecting Nocardia spp.

[0074] 1. Experimental Methods

[0075] According to the instructions of the bacterial genomic DNA extraction kit, the genomes of 12 bacterial strains, including Nocardia seriola, Streptococcus agalactiae, Escherichia coli, Bacillus subtilis, Aeromonas schubertii, Vibrio vulnificus, Staphylococcus aureus, Aeromonas hydrophila, Priesteria pulex, Acinetobacter, Aeromonas versii, and Edwardsiella tarda, were extracted and used as templates for TaqMan qPCR. Specific detection of Nocardia seriola was performed according to the method of Example 3. Three technical replicates were set for each sample, and ddH2O was used as a negative control.

[0076] 2. Experimental Results

[0077] The results are shown in Table 1 and Figure 3 As shown, according to the method of Example 3, except for Nocardia seriola and the positive control, which were positive (Cq<35), the other 11 bacterial genomes and the negative control were negative (Cq>35).

[0078] Table 1 Cq values ​​and standard deviations (SD) of TaqMan qPCR for different bacterial genomes

[0079]

[0080]

[0081] Note: P stands for positive, N stands for negative.

[0082] Example 5 Repeatability of the method for detecting Nocardia spp.

[0083] 1. Experimental Methods

[0084] The standard curve plasmid pUCm-GntRs was diluted 10-fold in a series of steps: 9.72 × 10 10 copies / μL、9.72×10 9 copies / μL、9.72×10 8 copies / μL、9.72×10 7 copies / μL、9.72×10 6 copies / μL、9.72×10 5 copies / μL、9.72×10 4 copies / μL、9.72×10 3 copies / μL、9.72×10 2 copies / μL、9.72×10 1 copies / μL、9.72×10 0 copies / μL.

[0085] Using the gradient dilution standard curve plasmid pUCm-GntRs, the bacteria were reproducibly detected at different time points and under different environments. The specific method was as follows: the qPCR reaction system was prepared in the clean bench in different rooms in the morning, afternoon and evening, with 3 technical replicates for each gradient. ddH2O was used as a negative control. According to the method of Example 3, the gradient dilution standard curve plasmid pUCm-GntRs was used as the template for TaqMan qPCR. According to the method of Example 3, specific detection of Nocardia seriola was performed. The Cq value stability of each replicate well under different dilution gradients within each batch and the Cq value stability under the same dilution gradient between different batches were compared, and the respective Cq means, standard deviations, and coefficients of variation were calculated.

[0086] 2. Experimental Results

[0087] The results are shown in Tables 2 and 3. Figure 4 As shown, in batches repeated three times at different time periods and under different environments, the coefficient of variation within the same batch was stable between 0.07% and 1.09%; the coefficient of variation between different batches was stable between 0.45% and 2.28%. This shows that the detection method is relatively stable with a small degree of variation, whether it is the Cq value between different replicate wells in the same batch or the Cq value of the same dilution gradient in different batches at different time points and environments. This shows that the detection method is not affected by the environment and time, and has strong stability and good repeatability.

[0088] Table 2 Cq values, standard deviations, and coefficients of variation of TaqMan qPCR using different batches of standard curves

[0089]

[0090]

[0091] Table 3 Repeatability of the same batch and different batches

[0092]

[0093]

[0094] Example 6 Detection of different samples using the method for detecting Nocardia spp.

[0095] 1. Experimental Methods

[0096] According to the instructions of the bacterial genomic DNA extraction kit, the genomes of eight strains of Nocardia from different fish sources, including snakehead, hybrid snakehead, California sea bass, seven-star sea bass, jewel perch, golden pomfret, catfish, and mudskipper, were extracted and used as templates for TaqMan qPCR. Specific detection of Nocardia from yellowtail was performed according to the method of Example 3. Three technical replicates were set for each sample. A standard positive plasmid was used as a positive control, and ddH2O was used as a negative control.

[0097] 2. Experimental Results

[0098] The results are shown in Table 4 and Figure 5 As shown, in the genome detection of Nocardia in yellowtail from 8 different fish sources, the Cq values ​​were all less than 35. According to the method of Example 3, the test results can be determined to be positive. This shows that the applicability of this detection method depends on the type of Nocardia species infecting the fish, not the type of fish species. Based on the specificity of the primer probe designed by this method, it can be preliminarily concluded that this method is suitable for the detection of Nocardia in yellowtail from different fish sources.

[0099] Table 4 Cq values ​​and standard deviations of TaqMan qPCR for Nocardia spp. from yellowtail from different fish sources

[0100]

[0101]

[0102] Note: P: positive; N: negative

[0103] Example 6 Accuracy of the method for detecting Nocardia spp.

[0104] 1. Experimental Methods

[0105] The standard curve plasmid pUCm-GntRs was diluted 10-fold to 10 1 ~10 9 copies / μl; gDNA of Nocardia spp. was serially diluted 10-fold to 10 -1 ~10 5 pg / μl. The above samples were repeated three times.

[0106] A standard curve was established according to the method of Example 2, with three technical replicates for each gradient and ddH2O as a negative control. The slopes of the standard curves formed by the plasmid and genome were subjected to one-way ANOVA-Tukey test for significant differences.

[0107] 2. Experimental Results

[0108] The results are shown in Tables 5, 6 and Figure 6 As shown,

[0109] The calibration curve equations obtained for genomic gDNA are:

[0110] y=-3.2556x+43.259(R 2 =0.9909);

[0111] y=-3.3106x+43.294(R 2 =0.99);

[0112] y=-3.1775x+41.481(R 2 =0.9974);

[0113] The standard curve equations obtained from the standard curve plasmid pUCm-GntRs are:

[0114] y=-3.363x+35.596(R 2 =0.9937);

[0115] y=-3.296x+34.815(R 2 =0.9904);

[0116] y=-3.3258x+34.342(R 2 =0.9975).

[0117] The results showed that the standard curve equations formed by different samples of genomic gDNA and plasmid were similar and tended to overlap, and the linear correlation coefficients were all R 2 >0.99. According to the significance analysis, the slopes of the two calibration curves were basically consistent and parallel, with no significant difference (p>0.05). This indicates that changes in the content of the target amplicon GntRs detected by the recombinant plasmid can indirectly reflect changes in the abundance of Nocardia seriola. This further demonstrates the feasibility and accuracy of the standard curve constructed by the recombinant plasmid for the qualitative and quantitative detection of Nocardia seriola in actual samples.

[0118] Table 5 Cq values ​​and standard deviations of TaqMan qPCR for genomic samples

[0119]

[0120]

[0121] Table 6 Cq values ​​and standard deviations of TaqMan qPCR for different plasmid samples

[0122]

[0123]

[0124] Example 7 Qualitative detection of actual samples using the method for detecting Nocardia spp.

[0125] 1. Experimental Methods

[0126] A total of 20 water samples and 16 tissue samples were collected from snakehead and hybrid snakehead fish ponds suspected of nocardiosis in Foshan, Guangdong, Shangrao, Jiangxi, and Hanchuan, Hubei (Table 7).

[0127] Table 7 Collection of water or tissue samples

[0128]

[0129]

[0130] The genome of the water sample was extracted according to the instructions of the water genomic DNA extraction kit; the tissue sample was first crushed by magnetic bead grinding, and 50 mg / ml lysozyme was added to break the cell wall. The genome was extracted according to the instructions of the marine animal tissue genomic DNA extraction kit and used as a template for TaqMan qPCR. Specific detection of Nocardia seriola was performed according to the method of Example 3, with three technical replicates for each sample.

[0131] 2. Experimental Results

[0132] The results are shown in Table 8, Table 9, Figure 7 and Figure 8 As shown, in the detection of 20 water samples and 16 tissue samples, the positive detection rate of TaqManqPCR was 89.2%, and the pathogens were isolated as Nocardia seriola and Aeromonas schubertii from diseased fish in Foshan, Guangdong and Hanchuan, Hubei, respectively, further verifying the reason why the qPCR detection had a high positive rate in Foshan, Guangdong and a low positive rate in Hanchuan, Hubei; indicating that the detection method can perform qualitative detection of Nocardia seriola within a certain cycle number range.

[0133] Table 8 Results of TaqMan qPCR detection of Nocardia spp. in aquaculture water in different regions

[0134]

[0135]

[0136] Note: P: positive; N: negative

[0137] Table 9 Results of TaqMan qPCR detection of Nocardia spp. in different tissues of hybrid snakehead

[0138]

[0139]

[0140] Example 8 Quantitative detection of actual samples using the method for detecting Nocardia spp.

[0141] 1. Experimental Methods

[0142] Nine hybrid snakeheads (approximately 70-80 g / tail) were randomly selected and intraperitoneally injected with 100 μl of 1×10 7 CFU / mL of PBS containing Nocardia seriola was added. After 7 days, 10 tissues, including the liver, spleen, kidney, heart, brain, gill, stomach, intestine, and muscle, were collected from each fish. The genome of each tissue sample was extracted and used as a template for TaqMan qPCR. Specific detection of Nocardia seriola was performed according to the method of Example 3. The Nocardia seriola content in each tissue was calculated using a standard curve (Log copies / ng). Three technical replicates were set for each sample.

[0143] 2. Experimental Results

[0144] The results are shown in Table 10 and Figure 9 As shown in the data, the detection of hybrid snakehead song tissues infected with Nocardia seriola showed that the immune organs such as liver, spleen, and kidney, as well as digestive organs such as stomach and intestines, had a high Nocardia seriola bacterial load, which was significantly higher than that in the heart, brain, and gill tissues (p<0.05).

[0145] Table 10 Nocardia content in various tissues of hybrid snakehead after infection

[0146] organize Nocardia content (Log copies / ng) Standard deviation (SD) liver 2.61 0.41 spleen 2.67 0.34 head kidney 2.17 0.23 Kidney 2.64 0.33 heart 0.77 0.22 brain regions 0.27 0.20 gill 1.30 0.40 Stomach 2.85 0.34 Intestinal 2.92 0.37 muscle 2.38 0.25

[0147] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer and probe combination for detecting Nocardia serrata based on TaqMan qPCR, characterized in that: The primers contain nucleotide sequences as shown in SEQ ID NO.1-2 and the probe contains nucleotide sequence as shown in SEQ ID NO.

3.

2. The primer and probe combination according to claim 1, wherein The 5' end of the probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

3. The primer and probe composition according to claim 2, characterized in that The fluorescent group is 6-FAM.

4. The primer and probe combination according to claim 2, characterized in that The quenching group is BHQ1.

5. Use of the primer and probe combination according to any one of claims 1 to 4 in the preparation of a kit for detecting Nocardia seriola.

6. The use according to claim 5, characterized in that The detection of Nocardia seriola is a qualitative detection of Nocardia seriola.

7. The use according to claim 5, characterized in that The detection of Nocardia seriola is a quantitative detection of Nocardia seriola.

8. The use according to claim 5, characterized in that The detecting of Nocardia seriola is detecting Nocardia seriola in water or fish.

9. A kit for detecting Nocardia spp., characterized in that: The kit contains the primer and probe combination according to any one of claims 1 to 3.

10. The kit according to claim 1, wherein Also contains TaqMan qPCR reagents.

Citation Information

Cited By

  • Group of nocardia seriolae trehalose synthase genes and construction method of deletion strain of nocardia seriolae trehalose synthase genes

    CN121931148A