Recombinant Escherichia coli strains, their preparation methods and applications, and the synthesis method of oryzanol A.

By knocking out the pfkA gene in Escherichia coli BL21(DE3) and inserting it into the oryzanol A biosynthesis gene cluster, gltA activity was regulated, and a highly efficient recombinant Escherichia coli strain was constructed. This solved the problems of long fermentation cycle and low yield, and achieved efficient and economical production of oryzanol A.

CN120699860BActive Publication Date: 2026-07-17SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Filing Date
2025-03-13
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

In existing technologies, the fermentation production of oryzanol A using natural strains and heterologous expression systems suffers from problems such as long fermentation cycles, low yields, or high costs, which limit its large-scale production and application.

Method used

By knocking out the pfkA gene in Escherichia coli BL21(DE3) and inserting the oryzanol A biosynthesis gene cluster agmA, agmB, agmC, agmE and agmF to regulate gltA activity, combined with codon optimization and liquid-liquid phase separation technology, a highly efficient recombinant Escherichia coli strain was constructed.

Benefits of technology

It has achieved high-efficiency production of oryzanol A, with a fermentation cycle of less than 72 hours and a yield of 629-1205 mg/L. It uses inexpensive culture medium, which significantly improves production efficiency and economy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120699860B_ABST
    Figure CN120699860B_ABST
Patent Text Reader

Abstract

This invention discloses a recombinant *Escherichia coli* strain, its preparation method and application, and a method for synthesizing oryzanol A, relating to the field of bioengineering technology. The recombinant *E. coli* strain uses *E. coli* BL21(DE3) as the chassis cell and undergoes the following modifications (a) and (b): (a) knocking out the pfkA gene; or, knocking out the pfkA gene and mutating the 5′ untranslated region of the gltA gene from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2; (b) inserting exogenous genes agmA, agmB, agmC, agmE, and agmF. This recombinant *E. coli* strain exhibits rapid growth, a short fermentation cycle (within 72 hours), can utilize inexpensive and readily available culture media, and significantly increases the fermentation yield of oryzanol A compared to existing *E. coli* systems.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to recombinant Escherichia coli strains, their preparation methods and applications, and methods for synthesizing oryzanol A. Background Technology

[0002] Angustmycin A, also known as narrow-spectrum oryzanol, is a nucleoside compound with important biological activities. Since its first discovery in 1950, angustmycin A has attracted much attention due to its unique cytokinin activity. Among its applications, it holds great promise as a plant growth regulator in agricultural production. In recent years, with the development of genomics and synthetic biology technologies, research on the biosynthesis of angustmycin A has made some progress.

[0003] Currently, the production of oryzanol A mainly relies on two technical routes: fermentation production using natural strains and production using heterologous expression systems.

[0004] However, the method of producing oryzanol A through fermentation of natural strains has the following limitations: (1) the yield of wild strains is unstable; (2) the fermentation cycle is long (usually requiring 7-10 days); and (3) there are many by-products, making separation and purification difficult. For example, the agricultural microbial pesticide innovation team of Northeast Agricultural University isolated oryzanol A from the fermentation broth of Streptomyces caniferus NEAU6, which has the above-mentioned limitations.

[0005] The heterologous expression systems used for producing oryzanol A include Escherichia coli and Streptomyces expression systems. The limitations of existing E. coli expression systems for fermenting oryzanol A production include: (1) low product concentration, (2) the presence of byproducts, and (3) the need for complex plasmid maintenance systems. For example, the team led by Wenqing Chen at Wuhan University (Yu et al., 2021, Nat. Commun.) identified six essential genes (agmA-F) from Streptomyces angustmyceticus JCM 4053 through genome mining and constructed a three-plasmid expression system. After introducing this system into E. coli GYJ23, only 370 μg / mL of oryzanol A was obtained after 96 hours of fermentation, along with the byproduct oryzanol C (110 μg / mL). While existing Streptomyces expression systems for producing oryzanol A have significantly increased yields, they still suffer from the following problems: (1) slow growth rate of Streptomyces; (2) long fermentation cycle (5-7 days); (3) difficult genetic manipulation; and (4) high culture medium cost. For example, the Xiang Wensheng team at Northeast Agricultural University identified a homologous gene cluster (gvmA-F) from Streptomyces caniferus NEAU6 and cloned it into the expression plasmid pJTU2554-10H5. Through conjugation transfer, this plasmid was introduced into Streptomycescoelicolor M1154, and the resulting engineered strain produced oryzanol A after 7 days of fermentation.

[0006] In the above-mentioned existing technologies, when using natural strains and heterologous expression systems to ferment and produce oryzanol A,

[0007] The production and widespread application of oryzanol A are limited by problems such as long fermentation cycles (low production efficiency), low yields, and high costs. Therefore, developing an efficient, high-yield, and economical oryzanol A production system and method is of significant practical importance. Summary of the Invention

[0008] Based on the shortcomings of the prior art, the purpose of this invention is to provide recombinant Escherichia coli strains and their preparation methods and applications, as well as methods for synthesizing oryzanol A, aiming to solve the problems of long fermentation cycles, low yields of oryzanol A, or high costs when using natural strains and heterologous expression systems to produce oryzanol A.

[0009] The technical solution of the present invention is as follows:

[0010] In a first aspect, the present invention provides a recombinant Escherichia coli strain, wherein the recombinant Escherichia coli strain is modified using E. coli BL21(DE3) as the chassis cell, and is modified as follows (a) and (b):

[0011] (a) Knock out gene pfkA; or,

[0012] The pfkA gene was knocked out, and the untranslated region at the 5′ end of the gltA gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2;

[0013] (b) Insertion of exogenous genes agmA, agmB, agmC, agmE and agmF.

[0014] Optionally, when performing (b) modification, the following foreign genes with optimized codons are inserted: agmA, agmB, agmC, agmE, and agmF.

[0015] The nucleotide sequences of the codon-optimized exogenous gene agmA are shown in SEQ ID NO: 3, the codon-optimized exogenous gene agmB are shown in SEQ ID NO: 4, the codon-optimized exogenous gene agmC are shown in SEQ ID NO: 5, the codon-optimized exogenous gene agmE are shown in SEQ ID NO: 6, and the codon-optimized exogenous gene agmF are shown in SEQ ID NO: 7.

[0016] Optionally, when performing (b) modification, the following genes are specifically inserted: RIAD_agmA, codon-optimized exogenous gene agmB, gene RIAD_agmC, codon-optimized exogenous gene agmE, and codon-optimized exogenous gene agmF.

[0017] The nucleotide sequence of the gene RIAD_agmA is shown in SEQ ID NO: 8;

[0018] The nucleotide sequence of the codon-optimized exogenous gene agmB is shown in SEQ ID NO: 4;

[0019] The nucleotide sequence of the gene RIAD_agmC is shown in SEQ ID NO: 9;

[0020] The nucleotide sequence of the codon-optimized exogenous gene agmE is shown in SEQ ID NO: 6;

[0021] The nucleotide sequence of the codon-optimized exogenous gene agmF is shown in SEQ ID NO: 7.

[0022] Optionally, it also includes at least one of the following modifications (c) and (d):

[0023] (c) Overexpression of endogenous genes alsE and / or yaiE;

[0024] (d) Insert the gene RGG_RIDD, the nucleotides of which are shown in SEQ ID NO: 10.

[0025] A second aspect of the present invention provides a method for constructing the recombinant Escherichia coli strain described above, wherein the construction method comprises the following steps:

[0026] The gene pfkA was knocked out in E. coli BL21(DE3) to obtain the mutant strain E. coli Any-11;

[0027] The recombinant *E. coli* strain was obtained by inserting exogenous genes agmA, agmB, agmC, agmE, and agmF into the mutant strain *E. coli* Any-11; or,

[0028] The construction method includes the following steps:

[0029] The gene pfkA was knocked out in E. coli BL21(DE3) to obtain the mutant strain E. coli Any-11;

[0030] The untranslated region at the 5′ end of the gltA gene of mutant strain E.coli Any-11 was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain mutant strain E.coli Any-217;

[0031] The recombinant Escherichia coli strain was obtained by inserting exogenous genes agmA, agmB, agmC, agmE, and agmF into the mutant strain E. coli Any-217.

[0032] Optionally, the following steps are included:

[0033] The recombinant *E. coli* strain was obtained by inserting codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF into the mutant strain *E. coli* Any-11 or the mutant strain *E. coli* Any-217; or,

[0034] The recombinant Escherichia coli strain was obtained by inserting the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217.

[0035] Optionally, in the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted, and endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain; or,

[0036] In the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, the genes RIAD_agmA, codon-optimized exogenous genes agmB, RIAD_agmC, codon-optimized exogenous genes agmE and agmF are inserted, the endogenous genes alsE and / or yaiE are overexpressed, and the gene RGG_RIDD is inserted to obtain the recombinant Escherichia coli strain.

[0037] A third aspect of the present invention provides the application of the recombinant Escherichia coli strain described above and / or the recombinant Escherichia coli strain constructed using the construction method described above in the present invention in the synthesis of oryzanol A.

[0038] A fourth aspect of the invention provides a method for synthesizing oryzanol A, comprising the following steps:

[0039] The recombinant Escherichia coli strain described above and / or the recombinant Escherichia coli strain constructed using the construction method described above are fermented to synthesize oryzanol A.

[0040] Optionally, the culture medium used for fermentation includes the following components in varying amounts:

[0041] Na2HPO4 6.8g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, yeast extract 15g / L, MgSO4 2mM, CaCl2 0.1mM and glucose 20-40g / L.

[0042] Beneficial Effects: This invention expresses the oryzanol A biosynthetic gene cluster (agmA, agmB, agmC, agmE, and agmF) in *E. coli*, and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux. Furthermore, it regulates gltA activity by modifying several bases in the 5′ untranslated region of the mutant gltA gene, reducing its activity to 46% of its original level. This balances carbon flux distribution during fermentation, resulting in a rapid growth rate and short fermentation cycle (within 72 hours) for the recombinant *E. coli* strain. It can utilize inexpensive and readily available culture media, achieving an oryzanol A fermentation yield of 629 mg / L, a significant increase compared to existing *E. coli* systems. The recombinant *E. coli* strain provided by this invention offers advantages of high efficiency, high yield, and economy in the production of oryzanol A. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the biosynthetic pathway and chassis modification of oryzanol A.

[0044] Figure 2 The diagram shows the construction of different recombinant expression plasmids in Example 2, where (a) is recombinant expression plasmid 024, (b) is recombinant expression plasmid 068, and (c) is recombinant expression plasmid 082.

[0045] Figure 3 The results of detecting oryzanol A using liquid chromatography in Example 4 are shown in (a) and (b) are liquid chromatograms of oryzanol A standard and fermentation broth of recombinant strain E. coli Any-181.

[0046] Figure 4 The graph shows the yield of oryzanol A after fermentation of recombinant strains E. coli Any-49 and E. coli Any-60 in Example 4.

[0047] Figure 5 The graph shows the yield of oryzanol A after fermentation of recombinant strains E.coli Any-60 and E.coli Any-181 in Example 4.

[0048] Figure 6 The graph shows the yield of oryzanol A after fermentation of recombinant strains E. coli Any-181 and E. coli Any-233 under optimized fermentation conditions in Example 5. Detailed Implementation

[0049] This invention provides recombinant Escherichia coli strains, their preparation methods and applications, and a method for synthesizing oryzanol A. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0051] In this invention, for the same English abbreviation, italics represent genes, and upright text represents proteins or enzymes. For example, agmB represents the gene encoding phosphatase, i.e., the phosphatase gene; agmB represents phosphatase. Other English abbreviations follow the same principle.

[0052] This invention combines genetic engineering, metabolic engineering, and fermentation engineering technologies to develop a more efficient cell factory for the biosynthesis of oryzanol A.

[0053] This invention provides a recombinant Escherichia coli strain, wherein, as... Figure 1 As shown, the recombinant Escherichia coli strain was modified using E. coli BL21(DE3) (i.e., Escherichia coli BL21(DE3)) as the chassis cell in the following (a) and (b):

[0054] (a) Knock out gene pfkA; or,

[0055] The pfkA gene was knocked out, and the 5' untranslated region (5'-UTR) of the gltA gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2;

[0056] (b) Insertion of exogenous genes agmA, agmB, agmC, agmE and agmF.

[0057] This invention expresses the oryzanol A biosynthesis gene cluster (agmA, agmB, agmC, agmE, and agmF) in *E. coli*, and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux. Furthermore, it regulates gltA activity by modifying several bases in the 5′-UTR of the mutant gltA gene, reducing its activity to 46% of its original level. This balances carbon flux distribution during fermentation, resulting in a recombinant *E. coli* strain with rapid growth, a short fermentation cycle (within 72 hours), and the ability to use inexpensive and readily available culture media. The fermentation yield of oryzanol A reaches 629 mg / L, a significant increase compared to existing *E. coli* systems. The recombinant *E. coli* strain provided by this invention offers advantages of high efficiency, high yield, and economy in the production of oryzanol A.

[0058] Specifically, the 6-phosphofructokinase activity in the glycolysis pathway of *E. coli* is controlled by enzymes encoded by the pfkA and pfkB genes, with the pfkA gene (i.e., the 6-phosphofructokinase gene) accounting for 90% of the function. Knocking out the pfkA gene can redirect glucose as a carbon source to the synthesis pathway of oryzanol A while balancing cell growth and basal metabolic needs. The gltA gene encodes citrate synthase, the initiating enzyme of the TCA cycle (tricarboxylic acid cycle), which catalyzes the condensation of oxaloacetate and acetyl-CoA to produce citrate. By regulating the expression level or activity of gltA, the carbon flux distribution during fermentation can be balanced.

[0059] The exogenous genes agmA, agmB, agmC, agmE, and agmF are five genes from the genome of Streptomyces angustmyceticus JCM 4053. Among them, the gene agmA (encoding AMP phosphoribosylhydrolase), gene agmB (encoding phosphatase), gene agmC (encoding D-allulose-6-phosphate pyrophosphate kinase), gene agmE (encoding adenine phosphorallulose syltransferase), and gene agmF (encoding dehydratase) can be combined with the gene alsE (NC_000913.3) from E. coli BL21(DE3) that encodes D-allulose-6-phosphate isomerase to achieve the biosynthesis of oryzanol A.

[0060] In some embodiments, when performing (b) modification, specifically inserting codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF;

[0061] The nucleotide sequences of the codon-optimized exogenous gene agmA are shown in SEQ ID NO: 3, the codon-optimized exogenous gene agmB are shown in SEQ ID NO: 4, the codon-optimized exogenous gene agmC are shown in SEQ ID NO: 5, the codon-optimized exogenous gene agmE are shown in SEQ ID NO: 6, and the codon-optimized exogenous gene agmF are shown in SEQ ID NO: 7.

[0062] In some embodiments, when performing (b) modification, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF are specifically inserted.

[0063] The nucleotide sequence of the gene RIAD_agmA is shown in SEQ ID NO: 8. The gene RIAD_agmA is obtained by fusing a RIAD tag nucleotide sequence to the 5' end of the codon-optimized exogenous gene agmA through a linker. That is, the protein obtained by fusing a RIAD tag to the N-terminus of AMP phosphoribosylhydrolase (agmA) through a linker. The gene RIAD_agmA encodes the obtained protein.

[0064] The nucleotide sequence of the codon-optimized exogenous gene agmB is shown in SEQ ID NO: 4;

[0065] The nucleotide sequence of the gene RIAD_agmC is shown in SEQ ID NO: 9. The gene RIAD_agmC is obtained by fusing a RIAD tag nucleotide sequence to the 5' end of the codon-optimized exogenous gene agmC via a linker. That is, the protein obtained by fusing a RIAD tag to the N' end of D-allulose-6-phosphate pyrophosphate kinase (agmC) via a linker. The gene RIAD_agmC encodes the obtained protein.

[0066] The nucleotide sequence of the codon-optimized exogenous gene agmE is shown in SEQ ID NO: 6;

[0067] The nucleotide sequence of the codon-optimized exogenous gene agmF is shown in SEQ ID NO: 7.

[0068] In some implementations, such as Figure 1 As shown, it also includes at least one of the following modifications (c) and (d):

[0069] (c) Overexpression of endogenous genes alsE and / or yaiE;

[0070] (d) Insert the gene RGG_RIDD, the nucleotides of which are shown in SEQ ID NO: 10.

[0071] like Figure 1 As shown, phosphatase (agmB) can dephosphate adenosine monophosphate (AMP) to produce the byproduct adenosine. Adenosine accumulation inhibits the dehydratase (agmF) in the pathway, thereby reducing the yield of the target product, oryzanol A. Endogenous nucleoside phosphorylase (yaiE) in *E. coli* can convert adenosine to adenine, which is one of the substrates of adenine phosphorylalloulosyltransferase (agmE) in the pathway. Therefore, overexpression of the endogenous genes alsE and yaiE can increase the yield of oryzanol A.

[0072] This invention utilizes the properties of RGG sequences (repetitive sequences rich in arginine and glycine) and artificially designed RIAD / RIDD tags (possessing specific binding ability and bioorthogonality) to develop a highly efficient metabolic engineering tool. Specifically, after fusing the RGG sequence with the RIDD tag, droplets can spontaneously form in vivo, and proteins fused with the RIAD tag tend to aggregate within these droplets, thereby contributing to improved metabolic efficiency. Therefore, this invention fuses RIAD tags to the N-terminus of key enzymes agmA and agmC via a linker, inserts them into *E. coli*, and inserts the gene RGG_RIDD, which helps to increase the synthesis of oryzanol A. In other words, this invention combines liquid-liquid phase separation (LLPS) technology to construct enzyme catalytic microdomains, achieving synergistic synergistic effects on metabolic flux, ultimately significantly increasing the concentration of oryzanol A (achieving a yield of up to 1205 mg / L in 72 hours of fermentation).

[0073] This invention provides a method for constructing the recombinant Escherichia coli strain described above, wherein the construction method includes the following steps:

[0074] S11. Knock out the pfkA gene in E. coli BL21(DE3) to obtain the mutant strain E. coli Any-11;

[0075] S12. In the mutant strain E. coli Any-11, foreign genes agmA, agmB, agmC, agmE and agmF are inserted to obtain the recombinant Escherichia coli strain.

[0076] This invention expresses the oryzanol A biosynthesis gene cluster (agmA, agmB, agmC, agmE, and agmF) in *E. coli* and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux, resulting in a recombinant *E. coli* strain with rapid growth, a short fermentation cycle (within 72 hours), and the ability to use inexpensive and readily available culture media. The fermentation yield of oryzanol A reaches 629 mg / L, a significant increase compared to existing *E. coli* systems. The recombinant *E. coli* strain provided by this invention offers advantages of high efficiency, high yield, and economy in the production of oryzanol A.

[0077] In step S11, specifically, the pfkA gene in E. coli BL21(DE3) can be knocked out using the pEcCas / pEcgRNA editing tool.

[0078] In step S12, in some specific embodiments, codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF are inserted into the mutant strain E. coli Any-11 to obtain the recombinant Escherichia coli strain.

[0079] In some specific embodiments, the recombinant Escherichia coli strain is obtained by inserting the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF into the mutant strain E. coli Any-11.

[0080] In some specific embodiments, codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-11, and the endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain. This can further increase the production of oryzanol A. This step may specifically include:

[0081] The codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF, along with the alsE gene fragment cloned from the E. coli BL21(DE3) genome, were ligated into the first plasmid using the Gibson assembly method to obtain the first recombinant expression plasmid.

[0082] The genes yaiE and agmE were ligated to the second plasmid using the Gibson assembly method to obtain the second recombinant expression plasmid.

[0083] The first recombinant expression plasmid and the second recombinant expression plasmid were jointly transformed into the mutant strain E. coliAny-11 to obtain the recombinant Escherichia coli strain.

[0084] This invention employs a dual-plasmid expression system, which can improve genetic stability.

[0085] In some embodiments, the mutant strain E. coli Any-11 is modified by inserting the genes RIAD_agmA, codon-optimized exogenous genes agmB, RIAD_agmC, agmE, and agmF, overexpressing the endogenous genes alsE and / or yaiE, and inserting the gene RGG_RIDD to obtain the recombinant E. coli strain. This step may specifically include:

[0086] The gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized agmE, and the codon-optimized exogenous gene agmF, along with the alsE gene fragment cloned from the E. coli BL21(DE3) genome, were ligated to the third plasmid using the Gibson assembly method to obtain the third recombinant expression plasmid.

[0087] Using the Gibson assembly method, the genes yaiE and agmE, as well as the gene RGG_RIDD, were ligated to the fourth plasmid to obtain the fourth recombinant expression plasmid.

[0088] The third and fourth recombinant expression plasmids were co-transformed into the mutant strain E. coliAny-11 to obtain the recombinant Escherichia coli strain.

[0089] This invention provides a method for constructing the recombinant Escherichia coli strain described above, wherein the construction method includes the following steps:

[0090] S21. Knock out the pfkA gene in E. coli BL21(DE3) to obtain the mutant strain E. coli Any-11;

[0091] S22. The 5′-UTR of the gltA gene in mutant strain E.coli Any-11 was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain mutant strain E.coli Any-217.

[0092] S23. In the mutant strain E. coli Any-217, foreign genes agmA, agmB, agmC, agmE and agmF are inserted to obtain the recombinant Escherichia coli strain.

[0093] This invention expresses the oryzanol A biosynthesis gene cluster (agmA, agmB, agmC, agmE, and agmF) in *E. coli* and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux. Furthermore, it regulates gltA activity by modifying several bases in the 5′-UTR of the mutant gltA gene, reducing its activity to 46% of its original level. This balances carbon flux distribution during fermentation, resulting in a recombinant *E. coli* strain with rapid growth, a short fermentation cycle (within 72 hours), and the ability to use inexpensive and readily available culture media. The fermentation yield of oryzanol A reaches 629 mg / L, a significant increase compared to existing *E. coli* systems. The recombinant *E. coli* strain provided by this invention offers advantages of high efficiency, high yield, and economy in the production of oryzanol A.

[0094] In step S21, specifically, the pfkA gene in E. coli BL21(DE3) can be knocked out using the pEcCas / pEcgRNA editing tool.

[0095] In step S23, in some embodiments, codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain.

[0096] In some embodiments, the recombinant Escherichia coli strain is obtained by inserting the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF into the mutant strain E. coli Any-217.

[0097] In some embodiments, the codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-217, and the endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain. For specific steps, please refer to the above.

[0098] In some specific embodiments, the mutant strain E. coli Any-217 is modified by inserting the genes RIAD_agmA, codon-optimized exogenous genes agmB, RIAD_agmC, agmE, and agmF, overexpressing the endogenous genes alsE and / or yaiE, and inserting the gene RGG_RIDD to obtain the recombinant E. coli strain. The specific steps are described above.

[0099] By overexpressing endogenous genes alsE and / or yaiE, the inhibitory effect of byproduct adenosine accumulation on dehydratase (agmF) in the pathway is avoided, thereby increasing the yield of the target product oryzanol A. By inserting genes RIAD_agmA, RIAD_agmC, and RGG_RIDD, the RGG sequence is fused with the RIDD tag, which can spontaneously form droplets in the organism. Proteins fused with the RIAD tag tend to aggregate in the droplets, thereby helping to improve metabolic efficiency.

[0100] The present invention also provides the application of the recombinant Escherichia coli strain described above and / or the recombinant Escherichia coli strain constructed using the construction method described above in the synthesis of oryzanol A.

[0101] This invention also provides a method for synthesizing oryzanol A, comprising the following steps:

[0102] The recombinant Escherichia coli strain described above and / or the recombinant Escherichia coli strain constructed using the construction method described above are fermented to synthesize oryzanol A.

[0103] Because recombinant Escherichia coli strains have the advantages of rapid growth and high gene conversion efficiency, the synthesis method of oryzanol A provided by this invention has a short fermentation cycle (within 72 hours). Furthermore, the shake-flask fermentation product, oryzanol A, has a high yield (629–1205 mg / L), thereby improving production efficiency and demonstrating stronger economic competitiveness and application prospects in actual production.

[0104] In some embodiments, the culture medium used for fermentation comprises the following components in varying amounts:

[0105] Na2HPO4 6.8g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, (Yeast extract 15g / L, MgSO4 2mM, CaCl2 0.1mM and glucose 20-40g / L).

[0106] The culture medium has inexpensive components and can improve the yield of oryzanol A.

[0107] The present invention will be further described below through specific embodiments.

[0108] Unless otherwise specified, the reagents, raw materials, instruments, etc. used in the following examples are all commercially available products.

[0109] In the following embodiments, some symbols have the following meanings:

[0110] OD600 : The absorbance of a certain solution at a wavelength of 600nm.

[0111] Example 1

[0112] The pfkA gene in E. coli BL21(DE3) was knocked out using the pEcCas / pEcgRNA editing tool to obtain the mutant strain E. coli Any-11. Based on the mutant strain E. coli Any-11, the 5'-UTR sequence of the gltA gene was further mutated to reduce its activity to 46% of its original value, resulting in strain E. coli Any-217. The specific steps included are as follows:

[0113] (1) Knock out the pfkA gene in E. coli BL21(DE3) to obtain the mutant strain E. coli Any-11.

[0114] Using the E. coli BL21(DE3) genome as a template, PCR amplification was performed using primers for the left arm (pfkA-up-f and pfkA-up-r) and the right arm (pfkA-dn-f and pfkA-dn-r) to obtain the upstream homologous left arm and the downstream homologous right arm of pfkA. Fusion PCR amplification was then performed on the upstream homologous left arm and the downstream homologous right arm of pfkA using pfkA-up-f and pfkA-dn-r, and the knockout donor_pfkA fragment was obtained by gel excision and recovery.

[0115] Using the CHOPCHOP website, gRNAs were designed to knock out the pfkA gene in E. coli BL21(DE3). The most prominent gRNA sequence, tctgacatgatcaaccgtgg, was selected for knockout. (See SEQ ID NO: 11). Then, using the pEcgRNA plasmid (catalog number P34353, provided by Wuhan Miaoling Biotechnology Co., Ltd.) as a template, PCR amplification was performed using primers pEcgRNA-pfkA-f and pEcgRNA-pfkA-r. The linear fragment was then excised and recovered, followed by Gibson ligation to obtain positive clones, thus successfully constructing the knockout plasmid pEcgRNA-pfkA.

[0116] The pECcas9 plasmid (catalog number P31042, provided by Wuhan Miaoling Biotechnology Co., Ltd.), the knockout plasmid pEcgRNA-pfkA, and the knockout donor_pfkA fragment were transformed into E. coli BL21(DE3). Through homologous recombination screening, the mutant strain E. coli Any-11 was obtained.

[0117] (2) The 5'-UTR sequence of the gltA gene in the mutant strain E. coli Any-11 was mutated to obtain the mutant strain E. coli Any-217.

[0118] Using the E. coli BL21(DE3) genome as a template, PCR amplification was performed using primers for the left arm (gltA-up-f and gltA-up46-r) and the right arm (gltA-dn-f and gltA-dn46-r) to obtain the upstream homologous left arm and downstream homologous right arm of the gltA gene 5'-UTA. Fusion PCR amplification was then performed on the aforementioned upstream homologous left arm and downstream homologous right arm of the gltA gene 5'-UTA using gltA-up-f and gltA-dn46-r, and the mutant donor_gltA fragment was obtained by gel excision and recovery.

[0119] Using the CHOPCHOP website, gRNAs were designed to target the 5'-UTR sequence mutation of the gltA gene in E. coli BL21(DE3). The gRNA_gltA sequence, which ranks first in the sequence, was selected for mutation. The gRNA_gltA sequence is ggcgctaaggagaccttaaa (as shown in SEQ ID NO: 12). Using the pEcgRNA plasmid (with the same information as above) as a template, PCR amplification was performed using primers pEcgRNA1-gltA-F and pEcgRNA1-gltA-R. The linear fragment was then excised and recovered, followed by Gibson enzyme ligation. Positive clones were obtained, and the mutant plasmid pEcgRNA-gltA was successfully constructed.

[0120] The pECcas9 plasmid (specific information as above), the mutant plasmid pEcgRNA-gltA, and the mutant donor_gltA fragment were transformed into the mutant strain E. coli Any-11. Through homologous recombination screening, the mutant strain E. coli Any-217 was obtained.

[0121] The specific information about the primers used is shown in Table 1.

[0122] Table 1. Primer sequence information used in Example 1

[0123] pfkA-up-f (forward primer) SEQ ID NO: 13 gltA-up-f (forward primer) SEQ ID NO: 19 pfkA-up-r (reverse primer) SEQ ID NO: 14 gltA-up46-r (reverse primer) SEQ ID NO: 20 pfkA-dn-f (forward primer) SEQ ID NO: 15 gltA-dw-f (forward primer) SEQ ID NO: 21 pfkA-dn-r (reverse primer) SEQ ID NO: 16 gltA-dw46-r (reverse primer) SEQ ID NO: 22 pEcgRNA-pfkA-f (forward primer) SEQ ID NO: 17 pEcgRNA1-gltA-F (forward primer) SEQ ID NO: 23 pEcgRNA-pfkA-r (reverse primer) SEQ ID NO: 18 pEcgRNA1-gltA-R (reverse primer) SEQ ID NO: 24

[0124] Example 2

[0125] The construction of recombinant expression plasmids 024, 068, and 082 includes the following steps:

[0126] (1) Construction of recombinant expression plasmid 024

[0127] like Figure 2 As shown in (a), the nucleotide sequences of five genes, agmA, agmB, agmC, agmE, and agmF, derived from the genome of Streptomyces angustmyceticus JCM 4053, were codon optimized using the E. coli chassis. The nucleotide sequences of the codon-optimized genes agmA, agmB, agmC, agmE, and agmF are shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively. The alsE gene fragment was cloned from the E. coli BL21(DE3) genome.

[0128] PCR amplification was performed using primers agmA-F and agmA-R to obtain the amplification product agmA.

[0129] PCR amplification was performed using primers agmB-F and agmB-R to obtain the amplification product agmB.

[0130] PCR amplification was performed using primers agmC-F and agmC-R to obtain the amplification product agmC.

[0131] PCR amplification was performed using primers agmE-F1 and agmE-R1 to obtain the amplification product agmE.

[0132] PCR amplification was performed using primers agmF-F and agmF-R to obtain the amplification product agmF.

[0133] PCR amplification was performed using primers alsE-F and alsE-R to obtain the amplification product alsE;

[0134] The five codon-optimized genes (agmA, agmB, agmC, agmE, agmF) obtained after the amplification were ligated together with alsE to the backbone of plasmid pCDFDuet-1 (a common commercial vector) using the Gibson assembly method, thus obtaining recombinant expression plasmid 024. This recombinant expression plasmid 024 was transformed into E. coli DH5α strain, and the construction was successfully verified by sequencing.

[0135] (2) Construction of recombinant expression plasmid 068

[0136] like Figure 2 As shown in (b), the RIAD tag sequence is fused to the N-terminus of the key enzymes agmA and agmC via a linker to obtain the genes RIAD_agmA (the nucleotide sequence of which is shown in SEQ ID NO: 8) and RIAD_agmC (the nucleotide sequence of which is shown in SEQ ID NO: 9);

[0137] PCR amplification was performed using primers RIAD_agmA-F and agmA-R to obtain the amplification product RIAD_agmA.

[0138] PCR amplification was performed using primers agmB-F and agmB-R to obtain the amplification product agmB.

[0139] PCR amplification was performed using primers RIAD_agmC-F and agmC-R to obtain the amplification product RIAD_agmC.

[0140] PCR amplification was performed using primers agmE-F and agmE-R to obtain the amplification product agmE.

[0141] PCR amplification was performed using primers agmF-F1 and agmF-R1 to obtain the amplification product agmF.

[0142] PCR amplification was performed using primers alsE-F and alsE-R to obtain the amplification product alsE;

[0143] The amplified products alsE, agmB, agmE, agmF, RIAD_agmA, and RIAD_agmC were ligated together to the backbone of plasmid pCDFDuet-1 (a common commercial vector) using the Gibson assembly method to obtain recombinant expression plasmid 068. Recombinant expression plasmid 068 was transformed into E. coli DH5α strain, and the successful construction was verified by sequencing.

[0144] (3) Construction of recombinant expression plasmid 082

[0145] like Figure 2 As shown in (c), the gene yaiE (NC_000913.3) encoding nucleoside phosphorylase was amplified from the E. coli BL21(DE3) genome using primers (yaiE-F and yaiE-R) to obtain the PCR amplification product yaiE;

[0146] PCR amplification was performed using primers alsE-F2 and alsE-R2 to obtain the amplification product alsE.

[0147] PCR amplification was performed using primers RGG_RIDD-F and RGG_RIDD-R to obtain the synthesized gene fragment RGG_RIDD (as shown in SEQ ID NO: 10).

[0148] Then, using the Gibson assembly method, the PCR amplification products (yaiE, agmE) and the synthesized gene fragment RGG_RIDD were ligated with the backbone fragment of plasmid pET28a (a common commercial vector) to obtain recombinant expression plasmid 082. Recombinant expression plasmid 082 was transformed into E. coli DH5α strain, and the successful construction was verified by sequencing.

[0149] The specific information about the primers used is shown in Table 2.

[0150] Table 2. Primer sequence information used in Example 2

[0151]

[0152] Example 3

[0153] The construction of recombinant Escherichia coli strains includes the following steps:

[0154] The recombinant expression plasmid 024 was transformed into E. coli BL21(DE3) to obtain a recombinant E. coli strain, which was designated as recombinant strain E. coli Any-49.

[0155] The recombinant expression plasmid 024 was transformed into the mutant strain E. coli Any-11 to obtain a recombinant E. coli strain, denoted as recombinant strain E. coli Any-60;

[0156] Recombinant expression plasmids 068 and 082 were co-transformed into the mutant strain E. coli Any-11 to obtain a recombinant E. coli strain, denoted as recombinant strain E. coli Any-181.

[0157] Recombinant expression plasmids 068 and 082 were co-transformed into the mutant strain E. coli Any-217 to obtain a recombinant E. coli strain, denoted as recombinant strain E. coli Any-233.

[0158] Example 4: Production of oryzanol A by fermentation using recombinant Escherichia coli strain

[0159] The recombinant Escherichia coli strain constructed in Example 3 was used for fermentation to produce oryzanol A, specifically including the following steps:

[0160] M9Y culture medium is provided, which comprises the following components in the following concentrations: Na2HPO4 6.8 g / L, KH2PO4 3.0 g / L, NaCl 0.5 g / L, NH4Cl 1.0 g / L, yeast extract 15 g / L, MgSO4 2 mM and CaCl2 0.1 mM, with ultrapure water as the solvent.

[0161] Clones were picked from fresh transformation plates of recombinant strains E. coli Any-49, E. coli Any-60 and E. coli Any-181, and inoculated into 10 mL of M9Y medium supplemented with glucose (20 g / L), streptomycin (50 mg / L) and kanamycin (50 mg / L), respectively, and cultured at 37°C for 12 hours to prepare seed culture.

[0162] Subsequently, another 20 mL of M9Y medium supplemented with glucose (20 g / L), streptomycin (50 mg / L), and kanamycin (50 mg / L) was added to a 100 mL shake flask, and the mixture was adjusted to the initial OD value. 600 Seed culture was inoculated at a ratio of 1.0, and 50 μM IPTG (isopropyl-β-D-thiogalactoside) was added. Fermentation was carried out at 30℃ and 200 rpm for 72 hours, respectively. That is, the recombinant strains E. coli Any-49, E. coli Any-60 and E. coli Any-181 were fermented at 30℃ and 200 rpm for 72 hours, respectively.

[0163] After fermentation, 50 μL of fermentation broth supernatant was mixed with 200 μL of acetonitrile, centrifuged at 12000 rpm for 5 min, and the supernatant was filtered through a 0.45 μm filter membrane and transferred to a chromatographic bottle.

[0164] The yield of oryzanol A was determined using an Agilent 1290 high-performance liquid chromatograph equipped with a photodiode array detector; the column was an Agilent Poroshell 120EC-C18 (4 μm particle size, 4.6 × 250 mm). The injection volume was 5 μL, the mobile phase was A: 10 mM ammonium acetate aqueous solution, and the mobile phase B: acetonitrile; the elution program was 90% A / 10% B isocratic elution for 10 min, the flow rate was 0.5 mL / min, and the detection wavelength was 254 nm.

[0165] The results showed that chromatographic peaks consistent with those of oryzanol A standard (brand: MCE, catalog number: HY-101835) were detected in all samples, indicating that the constructed recombinant Escherichia coli strains were all capable of producing oryzanol A. The liquid chromatogram of the oryzanol A standard is shown below. Figure 3 As shown in (a), the liquid chromatogram of the fermentation broth of recombinant strain E. coli Any-181 is as follows. Figure 3 As shown in (b) of the diagram.

[0166] The yield of oryzanol A was quantitatively analyzed using a standard curve, and the results are as follows: Figure 4 and Figure 5As shown, the yields of oryzanol A in the fermentation broths of recombinant strains E. coli Any-49, E. coli Any-60, and E. coli Any-181 were 225 mg / L, 629 mg / L, and 667 mg / L, respectively.

[0167] Example 5

[0168] Fermentation conditions were optimized for recombinant strains E. coli Any-181 and E. coli Any-233. Similar to the method described in Case Study 4, the only differences were: increasing the glucose concentration in the M9Y medium from 20 g / L to 40 g / L and raising the fermentation temperature from 30℃ to 37℃, while keeping other conditions constant. Fermentation was then performed on both recombinant strains E. coli Any-181 and E. coli Any-233. The yield of oryzanol A after fermentation is shown below. Figure 6 As shown, after optimization of fermentation conditions, the yields of oryzanol A in the fermentation broths of recombinant strains E. coli Any-181 and E. coli Any-233 were 1058 mg / L and 1205 mg / L, respectively (corresponding to...). Figure 6 (Any-181* and Any-233* in the text).

[0169] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A recombinant Escherichia coli strain, characterized in that, The recombinant Escherichia coli strain E. coli BL21(DE3) is a chassis cell, and one of the following modifications (a) to (c) is performed: (a) Knockout gene pfkA Insertion of codon-optimized foreign genes agmA Codon-optimized foreign genes agmB、 Codon-optimized foreign genes agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF Overexpression of endogenous genes alsE ; (b) Knockout gene pfkA Inserting genes RIAD_agmA Codon-optimized foreign genes agmB、 Gene RIAD_ agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF Inserting genes RGG_RIDD Overexpression of endogenous genes alsE and yaiE; (c) Knockout gene pfkA and will gltA The 5′ untranslated region of the gene is mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2; [Inserted gene] RIAD_agmA Codon-optimized foreign genes agmB、 Gene RIAD_agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF Inserting genes RGG_ RIDD Overexpression of endogenous genes alsE and yaiE ; Among them, codon-optimized exogenous genes agmA The nucleotide sequence is shown in SEQ ID NO: 3, and the exogenous gene has been codon-optimized. agmB The nucleotide sequence is shown in SEQ ID NO: 4, and the exogenous gene has been codon-optimized. agmC The nucleotide sequence is shown in SEQ ID NO: 5, and the exogenous gene has been codon-optimized. agmE The nucleotide sequence is shown in SEQ ID NO: 6, and the exogenous gene is codon-optimized. agmF The nucleotide sequence is shown in SEQ ID NO: 7; Among them, genes RIAD_agmA The nucleotide sequence is shown in SEQ ID NO: 8; Gene RIAD_agmC The nucleotide sequence is shown in SEQ ID NO: 9; Gene RGG_RIDD The nucleotide sequence is shown in SEQ ID NO:

10.

2. A method for constructing the recombinant Escherichia coli strain according to claim 1, characterized in that, The construction method includes the following steps: Knockout E. coli BL21(DE3) gene pfkA, Obtain mutant strains E. coli Any-11; The mutant strain E. coli In Any-11, a codon-optimized exogenous gene is inserted. agmA、 Codon-optimized foreign genes agmB、 Codon-optimized foreign genes agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF Overexpression of endogenous genes alsE, The recombinant Escherichia coli strain was obtained; Alternatively, the construction method may include the following steps: Knockout E. coli BL21(DE3) gene pfkA, Obtain mutant strains E. coli Any-11; The mutant strain E. coli In Any-11, inserted genes RIAD_agmA Codon-optimized foreign genes agmB、 Gene RIAD_agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF Inserting genes RGG_RIDD Overexpression of endogenous genes alsE and yaiE, The recombinant Escherichia coli strain was obtained; Alternatively, the construction method may include the following steps: Knockout E. coli BL21(DE3) gene pfkA, Obtain mutant strains E. coli Any-11; mutant strains E. coli Any-11 gltA The 5′ untranslated region of the gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain a mutant strain. E. coli Any-217; The mutant strain E. coli In Any-217, inserted genes RIAD_agmA Codon-optimized foreign genes agmB、 Gene RIAD_agmC、 Codon-optimized foreign genes agmE and codon-optimized foreign genes agmF, Inserted gene RGG_RIDD, Overexpression of endogenous genes alsE and yaiE, The recombinant Escherichia coli strain was obtained.

3. The application of the recombinant Escherichia coli strain according to claim 1 in the synthesis of oryzanol A.

4. A method for synthesizing oryzanol A, characterized in that, Includes the following steps: The recombinant Escherichia coli strain described in claim 1 is fermented to synthesize oryzanol A.

5. The synthesis method according to claim 4, characterized in that, The culture medium used for fermentation includes the following components in varying amounts: Na2HPO4 6.8 g / L, KH2PO4 3.0 g / L, NaCl 0.5 g / L, NH4Cl 1.0 g / L, yeast extract 15 g / L, MgSO4 2 mM, CaCl2 0.1 mM and glucose 20~40 g / L.

Citation Information

Patent Citations

  • Method for efficiently synthesizing D-psicose by fermenting recombinant escherichia coli

    CN115074376A

  • Recombinant engineering strain for heterologous expression of narrow mycin as well as construction method and application of recombinant engineering strain

    CN118546849A