Application of probiotic composition in preparation of antioxidant drugs

Abstract

The invention discloses an application of a probiotic composition in preparation of an antioxidant drug. The probiotic composition is prepared from the following probiotics: lactobacillus paracasei (Lactobacillus paracasei) LPC12, lactobacillus rhamnosus (Lactobacillus rhamnosus) LRH10, lactobacillus helveticus (Lactobacillus helveticus) LH43, lactobacillus fermentum (LF26), and streptococcus thermophilus (Streptococcus thermophilus) ST30. The invention also discloses a preparation method of the probiotic composition. The probiotic composition is prepared from the following raw materials: Lactobacillus paracasei LPC12, Lactobacillus rhamnosus LRH10, Lactobacillus helveticus LH43, Lactobacillus fermentum LF26 and Streptococcus thermophilus ST30.

Description

Technical Field

[0001] The present invention relates to the preparation of antioxidant drugs, and in particular to the application of a probiotic composition in the preparation of antioxidant drugs, belonging to the technical field of drug preparation. Background Art

[0002] The human body contains two distinct types of adipose tissue: white fat and brown fat. The former is used to store energy, while the latter is used to burn it. Extensive clinical data demonstrates that excessive accumulation of adipose tissue can lead to mitochondrial dysfunction and electron leakage in the respiratory chain, resulting in excessive production of reactive oxygen species (ROS). ROS can damage cell membranes, proteins, and DNA, leading to cell dysfunction and death. Furthermore, ROS can activate inflammatory responses, causing chronic low-grade inflammation and further exacerbating obesity-related health problems.

[0003] When the reactive oxygen species produced in the human body exceeds the clearance capacity of the antioxidant system, it will lead to oxidative stress, which will further damage cells and tissues and cause various complications. When the antioxidant level in the human body is low, it will lead to the occurrence of diseases such as atherosclerosis and diabetes.

[0004] Antioxidant drugs are the simplest and most direct means of increasing the body's antioxidant levels. Their role in adipose tissue browning is primarily through reducing oxidative stress, thereby promoting adipose tissue browning and improving metabolic health.

[0005] Antioxidant drugs reduce oxidative stress by:

[0006] 1. Reduction effect: reduce the oxygen content in the food system and reduce the generation of free radicals.

[0007] 2. Interrupt the chain reaction: prevent the further progress of the oxidation process.

[0008] 3. Destroy the activity of oxidase: making it unable to catalyze oxidation reactions.

[0009] However, existing antioxidant drugs may have certain effects on the liver, cause gastrointestinal discomfort, or lead to allergies, etc. They have many side effects and are not suitable for long-term use. Summary of the Invention

[0010] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of a probiotic composition in the preparation of an antioxidant drug.

[0011] To achieve the above object, the present invention adopts the following technical solutions:

[0012] 1. Use of a probiotic composition in the preparation of an antioxidant drug, wherein the probiotic composition is composed of the following probiotics:

[0013] Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512;

[0014] Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513;

[0015] Lactobacillus helveticus LH43 was deposited in the China General Microbiological Culture Collection Center on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0016] The number is CGMCC NO.24511;

[0017] Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431;

[0018] Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

[0019] As one of the preferred technical solutions, anti-oxidation includes inducing browning of adipose tissue.

[0020] As one of the preferred technical solutions, the probiotic composition is prepared by the following method: adding Lactobacillus paracasei LPC12, Lactobacillus rhamnosus LRH10, Lactobacillus helveticus LH43, Lactobacillus fermentum LF26, and Streptococcus thermophilus ST30 to skim milk, the volume ratio of skim milk to probiotics is 657:1, the ratio of the number of live bacteria of LPC12, LRH10, LH43, LF26, and ST30 is 8:8:50:24:10, fermenting at 37°C for 16 hours, and spray drying to obtain the product.

[0021] As one of the further preferred technical solutions, the excipient used in the spray drying is maltodextrin, the liquid-solid mass ratio is 100:18, and the drying temperature is 150-160°C.

[0022] 2. Use of a probiotic composition in the preparation of a drug for preventing or treating obesity, wherein the probiotic composition is composed of the following probiotics:

[0023] Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512;

[0024] Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513;

[0025] Lactobacillus helveticus LH43 was deposited in the China General Microbiological Culture Collection Center on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0026] The number is CGMCC NO.24511;

[0027] Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431;

[0028] Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

[0029] 3. An antioxidant drug comprising a probiotic composition, wherein the probiotic composition is composed of the following probiotics:

[0030] Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512;

[0031] Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513;

[0032] Lactobacillus helveticus LH43, which was deposited with the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCCNO.24511;

[0033] Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431;

[0034] Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

[0035] 4. A drug for preventing or treating obesity, comprising a probiotic composition, wherein the probiotic composition is composed of the following probiotics:

[0036] Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512;

[0037] Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513;

[0038] Lactobacillus helveticus LH43, which was deposited with the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCCNO.24511;

[0039] Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431;

[0040] Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

[0041] Beneficial effects of the present invention:

[0042] The present invention discloses an application of a probiotic composition in the preparation of an antioxidant drug, which has no side effects on the human body and is suitable for long-term use. The probiotic composition is composed of the following probiotics: Lactobacillus paracasei LPC12, Lactobacillus rhamnosus LRH10, Lactobacillus helveticus LH43, Lactobacillus fermentum LF26, and Streptococcus thermophilus ST30.

[0043] The experimental results show that:

[0044] 1. After four weeks of taking the probiotic composition, the expression of the Sod and Gpx genes increased. After eight weeks of taking the probiotic composition, SOD enzyme activity increased. Therefore, it is inferred that the probiotic composition may enhance antioxidant capacity.

[0045] 2. After 4 and 8 weeks of probiotic composition administration, the size of epididymal white adipose tissue cells was reduced. After 4 weeks of probiotic composition administration, both the weight and relative weight of epididymal white adipose tissue were reduced. Therefore, it is inferred that probiotic compositions may have the ability to reduce fat.

[0046] 3. After 4 and 8 weeks of probiotic administration, the expression levels of Pparγ1, Pparγ2, and Prdm16 genes increased. Therefore, it is inferred that the probiotic composition may activate Pparγ1, Pparγ2, and Prdm16 to induce browning of white adipose tissue. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 For the antioxidant mechanism.

[0048] Figure 2 Mice were sacrificed four weeks after treatment with the probiotic composition. qPCR was used to analyze liver Sod and Gpx gene expression. Values ​​are mean ± SD, n = 8 mice / group. Statistical differences between the two groups were analyzed using the Mann-Whitney U test. mRNA expression levels were normalized to Gapdh, and ΔΔCt values ​​were calculated using the mean value of the placebo group. *p < 0.05, ***p < 0.001.

[0049] Figure 3 Mice were sacrificed after 8 weeks of probiotic treatment, and changes in liver SOD and GPx activities were analyzed. Values ​​are mean ± SD, n = 8 mice / group. Statistical differences between groups were analyzed using an unpaired t test. **p < 0.01.

[0050] Figure 4 Mice were sacrificed 4 weeks after treatment with the probiotic composition. (A) Epididymal adipose tissue (eWAT) and adipocyte size were observed using hematoxylin and eosin (H&E) staining. Four regions of each adipose tissue section were photographed at a fixed magnification. The area of ​​all adipocytes within the image (red area within the dashed line) was measured, and the mean and standard deviation were calculated. (B) Epididymal adipose tissue weight and relative weight. Values ​​are mean ± SD, n = 8 mice / group. Statistical differences in adipocyte size and epididymal adipose tissue weight between the two groups were analyzed using the Unpaired t test; statistical differences in relative epididymal adipose tissue weight between the two groups were analyzed using the Mann-Whitney U test. Relative epididymal adipose tissue weight = (epididymal adipose tissue weight / body weight) × 100%. eWAT: epididymal white adipose tissue.

[0051] Figure 5 Mice were sacrificed 8 weeks after treatment with the probiotic composition. (A) Epididymal white adipose tissue (eWAT) and adipocyte size were observed using hematoxylin and eosin (H&E) staining. Four regions of each adipose tissue section were photographed at a constant magnification. The area of ​​all adipocytes within the image (red area within the dashed line) was measured, and the mean and standard deviation were calculated. (B) Epididymal adipose tissue weight and relative weight. Values ​​are mean ± SD, n = 8 mice / group. Statistical differences in adipocyte size and epididymal adipose tissue weight between the two groups were analyzed using the Unpaired t test; statistical differences in epididymal adipose tissue relative weight between the two groups were analyzed using the Mann-Whitney U test. Relative epididymal adipose tissue weight = (epididymal adipose tissue weight / body weight) × 100%. eWAT: epididymal white adipose tissue.

[0052] Figure 6 Mice were sacrificed 4 weeks after the probiotic composition treatment, and the expression of Pparγ1, Pparγ2, and Prdm16 genes in inguinal white adipose tissue (iWAT) was analyzed by qPCR. Values ​​are mean ± SD, n = 7 mice / group. Statistical differences between the two groups were analyzed using the Mann-Whitney U test. mRNA expression levels were normalized to Gapdh, and ΔΔCt values ​​were calculated using the mean value of the placebo group. *p < 0.05, **p < 0.01. Pparγ: peroxisome proliferator-activated receptor γ; Prdm16: PR domain zinc-finger protein 16. iWAT: inguinal white adipose tissue.

[0053] Figure 7Mice were sacrificed 8 weeks after probiotic treatment, and the expression of Pparγ1, Pparγ2, and Prdm16 genes in inguinal white adipose tissue (iWAT) was analyzed by qPCR. Values ​​are mean ± SD, n = 7 mice / group. Statistical differences between the two groups were analyzed using the Mann-Whitney U test. mRNA expression levels were normalized to Gapdh, and ΔΔCt values ​​were calculated using the mean value of the placebo group. *p < 0.05, **p < 0.01. Pparγ: peroxisome proliferator-activated receptor γ; Prdm16: PR domain zinc-finger protein 16. iWAT: inguinal white adipose tissue.

[0054] Preservation Information

[0055] Classification name: Lactobacillus rhamnosus LRH10

[0056] Latin name: Lacticaseibacillus rhamnosus

[0057] Deposit Name: China General Microbiological Culture Collection Center Deposit Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit Date: March 11, 2022

[0058] Deposit number: CGMCC NO.24513

[0059] Classification name: Lactobacillus paracasei LPC12

[0060] Latin name: Lacticaseibacillusparacasei

[0061] Deposit Name: China General Microbiological Culture Collection Center Deposit Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit Date: March 11, 2022

[0062] Accession number: CGMCC NO.24512

[0063] Classification name: Lactobacillus fermentum LF26

[0064] Latin name: Limosilactobacillusfermentum

[0065] Deposit Name: China General Microbiological Culture Collection Center Deposit Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit Date: February 24, 2020

[0066] Accession number: CGMCC NO.19431

[0067] Classification name: Streptococcus thermophilus ST30

[0068] Latin name: Streptococcus thermophilus

[0069] Deposit Name: China General Microbiological Culture Collection Center Deposit Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit Date: March 11, 2022

[0070] Deposit number: CGMCC NO.24514

[0071] Classification name: Lactobacillus helveticus LH43

[0072] Latin name: Lactobacillus helveticus

[0073] Deposit Name: China General Microbiological Culture Collection Center Deposit Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit Date: March 11, 2022

[0074] Deposit number: CGMCC NO.24511 DETAILED DESCRIPTION

[0075] The present invention will be further described below with reference to the embodiments. It should be noted that the following description is only for explaining the present invention and does not limit the content thereof.

[0076] Example

[0077] The preparation method of the probiotic composition comprises the following specific steps:

[0078] Lactobacillus paracasei LPC12, Lactobacillus rhamnosus LRH10, Lactobacillus helveticus LH43, Lactobacillus fermentum LF26, and Streptococcus thermophilus ST30 were added to skim milk, the volume ratio of skim milk to probiotics was 657:1, the ratio of the viable counts of LPC12, LRH10, LH43, LF26, and ST30 was 8:8:50:24:10, the mixture was fermented at 37°C for 16 hours, and the mixture was spray-dried to obtain the probiotic.

[0079] Test example

[0080] This study used 5-week-old male ICR mice purchased from Lesco Biotech Co., Ltd. After a one-week acclimation period, the animals were randomly divided into two groups. At this point, the mice were 6 weeks old. During the experiment, they were fed a fixed-weight diet (MAINTENANCE DIET-RATS AND MICE, 1320) and reverse osmosis water. The animal room temperature was 22-25°C, the relative humidity was 50-70%, and the photoperiod was 12 hours light / 12 hours dark.

[0081] Mice were divided into two groups, 16 each. The first group received a placebo, while the second group received a probiotic composition. The placebo group received 0.12g / 0.03kg of placebo powder (same composition as the probiotic composition powder, but without the probiotic composition) dissolved in 0.2mL of 0.9% saline, while the probiotic composition group received 0.12g / 0.03kg of probiotic composition powder dissolved in 0.2mL of 0.9% saline. The mice were gavage-fed for 8 weeks, with 16 mice sacrificed at the 4th and 8th weeks, respectively.

[0082] 1. Antioxidant effect of probiotic composition

[0083] After the mice were sacrificed, the livers were removed and stored in a -80°C refrigerator for analysis of the expression of antioxidant genes (Sod and Gpx) using qPCR. Mini kit (QIAGEN, #74106) was used to extract RNA from the liver, and then RT-PCR was performed using a High-Capacity cDNA Reverse Transcription kit with RNase inhibitor (ThermoFisher SCIENTIFIC, #4374966) to reverse transcribe the RNA into cDNA. The PCR conditions were 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes. After the reaction was completed, the temperature was lowered to 4°C.

[0084] Take 1 μL of the cDNA to be detected and add 10 μL of SYBR Green (Applied Biosystems TM, A25776) and 1 μL of the forward and reverse primers for the gene to be tested (Table 1), then add DEPC-RNase-free water to a total volume of 20 μL. After mixing thoroughly, the sample was placed in a qPCR reactor (QuantStudio™ 3 real-time PCR systems, ThermoFisher SCIENTIFIC) to detect the expression level of the gene to be tested. The Q-PCR reaction conditions were: first stage (hold): 50°C for 2 minutes, 95°C for 10 minutes, for one cycle; second stage (PCR): 95°C for 15 seconds, 60°C for 1 minute per cycle for nucleic acid amplification, for a total of 40 cycles; third stage (melting): 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds, for a total of one cycle.

[0085] Table 1 Primer sequences of liver genes to be tested

[0086] Gene Forward primer (5'→3') Reverse primer (5'→3') Gpx CGACATCGAACCTGACATAGAA CAGAGTGCAGCCAGTAATCA Sod GTAGAGCCTTGCCTGTCTTATG AAACCCAGAGGCACCATTAC

[0087] Figure 1 This is the mechanism of antioxidant action. SOD enzyme converts superoxide radicals (O2 - ) converts hydrogen peroxide (H2O2) and oxygen (O2). Although H2O2 is oxidizing, it is more toxic than O2 - The GPx and Catalase enzymes convert hydrogen peroxide (H2O2) into water (H2O).

[0088] Figure 2 and Figure 3 The results show the antioxidant capacity of the probiotic composition after 4 and 8 weeks of treatment. The results show that after 4 weeks of treatment, the probiotic composition increased the expression of the Sod and Gpx genes. After 8 weeks of treatment, the probiotic composition increased SOD enzyme activity. Therefore, it is inferred that the probiotic composition may enhance antioxidant capacity.

[0089] 2. Effect of probiotic composition on white adipose tissue cell size

[0090] After mice were sacrificed, epididymal white adipose tissue was removed and weighed, then immersed in 10% formalin (Avantor, H121-08). Sections were then stained with hematoxylin and eosin (H&E) by Sids Biomedical Technology Co., Ltd. Four regions of each section of white adipose tissue were photographed at a fixed magnification. The area of ​​all adipocytes within the image (red area within the dashed line) was measured, and the mean and standard deviation were calculated.

[0091] Figure 4 and Figure 5 The effects of the probiotic composition on the size and weight of epididymal white adipose tissue (WAT) adipocytes after 4 and 8 weeks of administration were evaluated. The results showed that the probiotic composition reduced WAT cell size after 4 and 8 weeks of administration. Furthermore, the probiotic composition also reduced both WAT weight and relative WAT weight after 4 weeks of administration. Therefore, it is inferred that the probiotic composition may have the potential to reduce fat.

[0092] 3. Effect of probiotic composition on browning of white adipose tissue

[0093] Adipose tissue is composed of three types of adipocytes: white, brown, and beige. White adipocytes are primarily found in white adipose tissue and store energy in the form of lipids. Excessive amounts of these cells contribute to obesity. Brown adipocytes, primarily found in brown adipose tissue, consume energy to generate heat to combat cold and protect against obesity and metabolic diseases. Beige adipocytes, primarily found in white adipose tissue, may contribute to heat generation and protection against obesity and metabolic diseases under conditions that increase energy expenditure, such as cold and exercise (Bartelt, A., & Heeren, J., 2014).

[0094] After the mice were sacrificed, the inguinal white adipose tissue was removed and stored in a -80°C refrigerator for analysis of the expression of browning-related genes (Pparγ1 / 2 and Prdm16) using qPCR. Mini kit (QIAGEN, #74106) was used to extract RNA from inguinal white adipose tissue, and then RT-PCR was performed using a High-Capacity cDNA Reverse Transcription kit with RNase inhibitor (Thermo Fisher Scientific, #4374966) to reverse transcribe RNA into cDNA. The PCR conditions were 25°C for 10 minutes, 37°C for 120 minutes, and 85°C for 5 minutes. After the reaction was completed, the temperature was lowered to 4°C.

[0095] Take 1 μL of the cDNA to be detected and add 10 μL of SYBR Green (Applied Biosystems TM , A25776) and 1 μL of the forward and reverse primers for the gene to be tested (Table 2), then add DEPC-RNase-free water to a total volume of 20 μL. After mixing thoroughly, the sample was placed in a qPCR reactor (QuantStudio™ 3 real-time PCR systems, ThermoFisher SCIENTIFIC) to detect the expression level of the gene to be tested. The Q-PCR reaction conditions were: first stage (hold): 50°C for 2 minutes, 95°C for 10 minutes, for one cycle; second stage (PCR): 95°C for 15 seconds, 60°C for 1 minute per cycle for nucleic acid amplification, for a total of 40 cycles; third stage (melting): 95°C for 15 seconds, 60°C for 1 minute, 95°C for 15 seconds, for a total of one cycle.

[0096] Table 2 Primer sequences of genes to be tested in inguinal white adipose tissue

[0097] Gene Forward primer (5'→3') Reverse primer (5'→3') Pparγ1 TGAAAGAAGCGGTGAACCACTG TGGCATCTCGTGTCAACCATG Pparγ2 TCGCTGATGCACTGCCTATG GAGAGGTCCACAGAGCTGATT Prdm16 CAGCACGGTGAAGCCATTC GCGTGCATCCGCTTGTG

[0098] Figure 6 and Figure 7 The effects of probiotic administration on the expression of genes associated with browning in inguinal white adipose tissue after 4 and 8 weeks of treatment were analyzed. The results showed that the expression of Pparγ1, Pparγ2, and Prdm16 genes increased after 4 and 8 weeks of probiotic administration. Therefore, it is speculated that the probiotic composition may induce browning in white adipose tissue by activating Pparγ1, Pparγ2, and Prdm16.

[0099] Although the above describes the specific implementation methods of the present invention, it does not limit the scope of protection of the present invention. Based on the technical solution of the present invention, various modifications or variations that can be made by those skilled in the art without creative work are still within the scope of protection of the present invention.

Claims

1. The use of a probiotic composition in the preparation of an antioxidant drug, characterized in that: The probiotic composition is composed of the following probiotics: Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512; Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513; Lactobacillus helveticus LH43, which was deposited with the China General Culture Collection of Microorganisms on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24511; Lactobacillus fermentum LF26 was deposited at the China Center for the Preservation of General Microorganisms on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC NO.19431; Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

2. The use according to claim 1, characterized in that Antioxidant effects include inducing browning of adipose tissue.

3. The use according to claim 1, characterized in that The probiotic composition is prepared by the following method: adding Lactobacillus paracasei LPC12, Lactobacillus rhamnosus LRH10, Lactobacillus helveticus LH43, Lactobacillus fermentum LF26, and Streptococcus thermophilus ST30 to skim milk, wherein the volume ratio of skim milk to probiotics is 657:1, the ratio of the number of live bacteria of LPC12, LRH10, LH43, LF26, and ST30 is 8:8:50:24:10, fermenting at 37°C for 16 hours, and spray drying to obtain the probiotic composition.

4. The use according to claim 3, characterized in that The spray drying excipient used is maltodextrin, the liquid-solid mass ratio is 100:18, and the drying temperature is 150-160°C.

5. Use of a probiotic composition in preparing a drug for preventing or treating obesity, characterized in that: The probiotic composition is composed of the following probiotics: Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512; Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513; Lactobacillus helveticus LH43, which was deposited with the China General Culture Collection of Microorganisms on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24511; Lactobacillus fermentum LF26 was deposited at the China Center for the Preservation of General Microorganisms on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC NO.19431; Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

6. An antioxidant drug, characterized in that The invention comprises a probiotic composition, wherein the probiotic composition is composed of the following probiotics: Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512; Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513; Lactobacillus helveticus LH43, which was deposited with the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCCNO.24511; Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431; Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

7. A drug for preventing or treating obesity, characterized in that: The invention comprises a probiotic composition, wherein the probiotic composition is composed of the following probiotics: Lactobacillus paracasei LPC12, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24512; Lactobacillus rhamnosus LRH10, which was deposited at the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO. 24513; Lactobacillus helveticus LH43, which was deposited with the China General Microbiological Culture Collection on March 11, 2022, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCCNO.24511; Lactobacillus fermentum LF26, which was deposited with the China General Microbiological Culture Collection on February 24, 2020, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC NO.19431; Streptococcus thermophilus ST30, this strain was deposited in the China General Microbiological Culture Collection on March 11, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.24514.

Images