A complex active polypeptide composition with weight loss efficacy and a preparation method thereof

By combining the genetically engineered NT analog peptide ELP3 with mulberry leaf, bitter melon, sea cucumber, and oyster peptides, the problems of significant side effects and short-lasting effects of existing weight loss products have been solved, achieving safe and efficient weight loss, significantly reducing weight and improving blood lipid metabolism.

CN120733009BActive Publication Date: 2025-11-04TIANJIN YOUJIN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511220884.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-11-04
Estimated Expiration
2045-08-29

AI Technical Summary

Technical Problem

Existing weight loss products suffer from significant side effects and short-lasting effects. Furthermore, natural neurotrophic peptides are easily and rapidly degraded in the body and have difficulty crossing the blood-brain barrier, limiting their application in weight loss products.

Method used

The NT analog peptide ELP3 was designed using genetic engineering techniques and then compounded with mulberry leaf peptides, bitter melon peptides, sea cucumber peptides, and oyster peptides. By utilizing genetic engineering to overcome the stability and bioactivity limitations of NT analogs, and combining the synergistic effects of each peptide, a complex active peptide composition was prepared to regulate the neurotransmitter system, lipid metabolism, and metabolism.

Benefits of technology

It achieves safe, efficient, and lasting weight loss results, significantly reducing weight and fat content, improving blood lipid metabolism, avoiding the side effects of traditional weight loss products, and possessing good biocompatibility and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120733009B_ABST
    Figure CN120733009B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of biological medicine, and particularly relates to a compound active polypeptide composition with weight loss effect and a preparation method thereof. The compound active polypeptide composition comprises: NT analogue polypeptide ELP3, mulberry leaf polypeptide, bitter gourd polypeptide, sea cucumber peptide and oyster peptide; the amino acid sequence of the NT analogue polypeptide ELP3 is shown as SEQ ID NO. 1. The present application adds an artificial peptide segment AYYKSQWLVNGEGTP to the end of the wild type NT, has the activities of inhibiting gastric acid secretion and obviously inhibiting alpha-amylase. The NT analogue polypeptide ELP3 and the various polypeptide components play a synergistic effect, can effectively improve the blood lipid metabolism of obese mice, reduce the fat weight of the mice, can significantly inhibit the food intake of the mice, so as to achieve the purpose of reducing the body weight of the mice, and shows a good weight loss effect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a compound active polypeptide composition with weight loss efficacy and a preparation method thereof. BACKGROUND

[0002] With the change of people's lifestyle and the increase of high-calorie food intake, the number of obese people is showing an increasing trend year by year, and obesity has become a serious health problem. Obesity not only has a negative impact on the appearance of individuals, but is also closely related to the occurrence and development of many chronic diseases, such as cardiovascular disease, diabetes, hypertension and some types of cancer, etc., which has brought a heavy burden to personal health and social medical system.

[0003] At present, various weight loss products have emerged in the market, covering drugs, health products and special foods, etc. However, these products have exposed many problems in practical application. For example, although some weight loss drugs can achieve weight loss in a short period of time, they often have serious side effects, such as adverse reactions of the cardiovascular system, disorders of the nervous system, etc., which pose a potential threat to the health of users; many weight loss health products and foods have the problem of not lasting effect, and once stopped using, the weight is easy to rebound, making it difficult for weight losers to maintain the ideal weight status.

[0004] As a kind of substance with diverse biological activities, polypeptides have received extensive attention and in-depth research in the field of weight loss in recent years. Polypeptides of different sources each have unique physiological functions, providing new ideas and ways for the development of new weight loss products. For example, some polypeptides can regulate the fat metabolism process of the human body, promote the decomposition and consumption of fat; some polypeptides can act on the nervous system, inhibit appetite and reduce food intake; some polypeptides can improve the energy consumption level of the body and enhance metabolism. Therefore, by reasonably combining polypeptides with weight loss related functions, it is expected to develop safe, efficient and lasting weight loss products.

[0005] Neurotensin (NT) is a 13-amino acid (ELYENKPRRPYIL) polypeptide hormone produced by enteroendocrine cells. NT has multiple physiological functions in the gastrointestinal tract, including the activation of intracellular signaling pathways such as mitogen-activated protein kinase (MAPK) and WNT / β-catenin signaling pathways through binding to G protein-coupled receptors (e.g., NTSR1), thereby promoting the proliferation of intestinal mucosal cells. In addition, NT can regulate the contraction of gastrointestinal smooth muscle, regulate the secretory activity of the gastrointestinal tract, inhibit gastric acid secretion, and reduce appetite. These functions suggest that NT has potential therapeutic value in regulating energy metabolism and appetite. Related studies have shown that a fusion peptide of neurotensin and Xenin (Ac-NT / XN-8-Gln) reduces body fat content in high-fat diet-induced obese mice. These findings suggest that NT and its fusion peptides have great potential in the treatment of obesity. However, natural NT has some limitations in vivo, such as being easily degraded, having a short half-life, and thus maintaining a short biological activity, making it difficult to be directly applied; at the same time, the blood-brain barrier (BBB) has a strong blocking effect on it, limiting its entry into the brain to play a role, which greatly restricts the application of NT in actual weight loss products. In order to overcome the shortcomings of NT, it is necessary to modify it through genetic engineering means to obtain NT analogs. Genetic engineering technology can optimize the design of the amino acid sequence of NT, such as changing some amino acid residues that are easily enzymatically degraded through site-directed mutagenesis, or introducing specific modification groups to improve the stability and biological activity of NT analogs; at the same time, it is also conducive to large-scale production and preparation, effectively solving the problem of the source of polypeptides.

[0006] In addition, a variety of naturally derived polypeptides also show significant weight loss efficacy, and they work synergistically through different physiological mechanisms to enhance the overall weight loss effect. Specifically, mulberry leaf polypeptides can promote the increase of adiponectin, a protein closely related to fat metabolism that can activate the β-oxidation process, inhibit liver fat accumulation, and also resist oxidative stress, which has a positive significance in preventing diet-induced obesity; bitter gourd polypeptides can regulate blood glucose and lipid levels by inhibiting the activity of key enzymes in fat synthesis, reducing fat synthesis and accumulation in the body; sea cucumber peptides and oyster peptides are rich in various amino acids and bioactive substances, which can promote metabolism, regulate fat metabolism-related signaling pathways, and promote fat decomposition and transport, thereby achieving weight loss. These polypeptides each have unique physiological activities, and through synergistic action, they can significantly improve the weight loss effect. Therefore, by reasonably combining a variety of polypeptides with weight loss-related functions, it is expected to develop safe, efficient, and long-lasting weight loss products, providing more choices and hope for obese people.

[0007] To achieve the above objectives, the present invention provides a compound active polypeptide composition with weight loss effects and a method for preparing the same. Summary of the Invention

[0008] In order to overcome the shortcomings of the prior art, one of the objectives of the present invention is to provide a compound active polypeptide composition with weight loss effect.

[0009] The second objective of this invention is to provide a method for preparing a compound active polypeptide composition with weight loss effects.

[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0011] A compound active polypeptide composition with weight loss effect, the compound active polypeptide composition comprising the following raw materials in parts by weight: 15-25 parts of NT analog polypeptide ELP3, 10-18 parts of mulberry leaf polypeptide, 9-14 parts of bitter melon polypeptide, 5-8 parts of sea cucumber peptide, and 3-5 parts of oyster peptide; the amino acid sequence of the NT analog polypeptide ELP3 is shown in SEQ ID NO.1.

[0012] Furthermore, the composite active polypeptide composition comprises the following raw materials in parts by weight: 20 parts of NT analog polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter melon polypeptide, 7 parts of sea cucumber peptide, and 4 parts of oyster peptide.

[0013] Furthermore, the specific preparation steps of the NT analog polypeptide ELP3 are as follows:

[0014] (1) Design the amino acid sequence of the NT analog polypeptide ELP3, and reverse design to obtain the nucleotide sequence encoding the NT analog polypeptide ELP3. Link the nucleotide sequence encoding the NT analog polypeptide ELP3 with the vector to obtain the recombinant plasmid.

[0015] (2) The recombinant plasmid obtained in step (1) was transferred into competent cells, and expressed by IPTG to obtain cell pellet.

[0016] (3) The bacterial precipitate obtained in step (2) is separated and purified to obtain the NT analog polypeptide ELP3.

[0017] Furthermore, in step (2), the concentration of IPTG-induced expression is 0.3-0.5 mmol / L, and the IPTG-induced expression time is 5-10 h.

[0018] Furthermore, the specific operation of step (1) is as follows:

[0019] S1 Adding an artificial peptide segment AYYKSQWLVNGEGTP at the end of the amino acid sequence of wild type NT to obtain the amino acid sequence of NT analogue polypeptide ELP3, as shown in SEQ ID NO. 1;

[0020] S2 Reversely designing a gene sequence according to the amino acid sequence of NT analogue polypeptide ELP3, and performing codon optimization to obtain a nucleotide sequence encoding NT analogue polypeptide ELP3, as shown in SEQ ID NO. 2;

[0021] S3 Designing an upstream primer and a downstream primer amplifying the nucleotide sequence of NT analogue polypeptide ELP3 according to the nucleotide sequence obtained in step S2, and connecting the nucleotide sequence of NT analogue polypeptide ELP3 amplified by the primers with a pET30a vector to construct a recombinant plasmid.

[0022] Further, the sequence of the upstream primer in step S3 is shown in SEQ ID NO. 3; and the sequence of the downstream primer is shown in SEQ ID NO. 4.

[0023] Further, the preparation method of the mulberry leaf polypeptide is as follows: mulberry leaves are made into mulberry leaf powder, sodium bisulfite and water are added, and heating is performed at 55-65℃ for 1-3h, and then filtration is performed to obtain a crude mulberry leaf filtrate; the use amount ratio of the mulberry leaf powder, sodium bisulfite and water is 10g:1g:(90-110)mL; then enzymolysis is performed at 40-60℃ for 20-40min; then heating is performed at 90-100℃ for 10-15min, centrifugation is performed to obtain a supernatant, and a protein peptide solution is obtained; and filtration, concentration and freeze-drying are performed to obtain the mulberry leaf polypeptide.

[0024] Further, the preparation method of the bitter gourd polypeptide is as follows: fresh bitter gourds are made into bitter gourd powder, 10-14 times the weight of water is added, and water bath heating is performed at 50-60℃ for 4-6h, and then filtration is performed to obtain a bitter gourd protein solution; then enzymolysis is performed at 40-50℃ for 2-4h; after the enzymolysis, water bath inactivation is performed at 80-100℃ for 1-2h, and then cooling is performed to room temperature to obtain a crude bitter gourd polypeptide; and filtration, concentration and freeze-drying are performed to obtain the bitter gourd polypeptide.

[0025] Further, the preparation method of the sea cucumber peptide is as follows: fresh sea cucumbers are washed, and then frozen at-80℃ for 20-30min; 10-14 times the weight of water is added to obtain a sea cucumber slurry; enzymolysis is performed at 40-60℃ and pH 7-8 for 3-5h, and then enzyme inactivation is performed by water bath at 85-90℃ for 10-20min; after the enzyme inactivation, centrifugation is performed to collect a supernatant, and then filtration, concentration and freeze-drying are performed to obtain the sea cucumber peptide.

[0026] The preparation method of the oyster peptide is as follows: shell-less oysters are made into oyster meat homogenate, and then enzymolysis is performed at 40-50℃ for 3-5h; and then centrifugation, filtration and freeze-drying are performed to obtain the oyster peptide.

[0027] Among them, mulberry leaves are a traditional Chinese medicine, rich in various bioactive components, among which mulberry leaf peptides show significant effects in regulating lipid metabolism. Studies have found that mulberry leaf peptides can promote the increase of adiponectin, a protein closely related to fat metabolism, which can activate the beta-oxidation process, inhibit the accumulation of liver fat, and also resist oxidative stress of the body, which has a positive significance for preventing diet-induced obesity. In addition, mulberry leaf peptides can also regulate protein metabolism, reduce muscle protein decomposition, maintain the nitrogen balance of the body, and help maintain muscle mass during weight loss and avoid muscle loss caused by weight loss.

[0028] Bitter gourd peptides also have various beneficial physiological functions. They can regulate blood sugar and blood lipid levels, inhibit the activity of key enzymes in fat synthesis, and reduce the synthesis and accumulation of fat in the body. In addition, bitter gourd peptides have insulin-like effects, can promote cell glucose uptake and utilization, and improve the body's sensitivity to insulin, thereby indirectly affecting the fat metabolism process.

[0029] Sea cucumber peptides and oyster peptides are rich in various amino acids and bioactive substances, which can not only improve the body's immunity and enhance the body's resistance, but also promote metabolism and maintain normal physiological functions of the body. During weight loss, good metabolism helps to timely remove metabolic waste in the body and maintain the stability of the body's internal environment. At the same time, sea cucumber peptides and oyster peptides may regulate fat metabolism-related signal pathways, promote fat decomposition and transport, and provide support for weight loss.

[0030] The preparation method of the above-mentioned compound active peptide composition with weight loss effect comprises the following specific steps: weighing NT analogue peptide ELP3, mulberry leaf peptide, bitter gourd peptide, sea cucumber peptide and oyster peptide according to the above-mentioned weight parts, stirring and mixing uniformly, and then obtaining.

[0031] Compared with the prior art, the beneficial effects of the present application mainly include:

[0032] 1. Production of NT analog ELP3 by genetic engineering: By constructing a genetically engineered strain (such as E. coli), using induced expression and high-efficiency fermentation process, the bottleneck of low yield, high cost and easy production of harmful impurities by chemical synthesis can be broken through. Genetic engineering production ensures high consistency between batches, providing a reliable material basis for preclinical research, clinical trials and future large-scale drug applications for the treatment of obesity and other metabolic diseases. This method is controllable and easy to scale up, which is the key technology path to promote its industrialization application. At the same time, when designing the amino acid sequence, an artificial peptide segment AYYKSQWLVNGEGTP is added at the end of the amino acid sequence of natural NT to prepare NT analog polypeptide ELP3, and specific groups are introduced to modify the stability and biological activity of NT analog. Through genetic engineering, NT analog ELP3 is highly expressed and stable, and has the functions of inhibiting gastric acid secretion and significantly inhibiting alpha-amylase activity.

[0033] 2. Synergistic weight loss: The present application scientifically compounds the neurotensin (NT) analog ELP3 obtained by genetic engineering with mulberry leaf polypeptide, bitter gourd polypeptide, sea cucumber peptide and oyster peptide. The polypeptide components produce significant synergistic effects. Neurotensin (NT) analog can regulate neurotransmitter systems, precisely affect appetite and energy balance, act on related neural pathways in the brain, inhibit the transmission of appetite signals, reduce food intake, and regulate the expression of energy metabolism-related genes to increase energy consumption. Mulberry leaf polypeptide promotes the secretion of adiponectin, which can activate the beta-oxidation process in adipocytes, accelerate fat decomposition and consumption, and inhibit liver fat synthesis and accumulation, regulating lipid metabolism from multiple aspects. Bitter gourd polypeptide regulates blood glucose and lipid levels, inhibits the activity of key enzymes involved in fat synthesis, reduces fat synthesis in the body, and promotes fat decomposition and transport. Sea cucumber peptide and oyster peptide are rich in various amino acids and bioactive substances, which can improve the body's metabolism, enhance the body's absorption and utilization efficiency of nutrients, and possibly regulate fat metabolism-related signaling pathways to promote fat decomposition and consumption. These polypeptide components work together from multiple aspects such as regulation of nerves, metabolism, fat synthesis and decomposition, effectively improving the lipid metabolism of obese mice, reducing the fat weight of mice; at the same time, it can significantly inhibit the food intake of mice, thereby achieving the purpose of reducing the body weight of mice, significantly enhancing the weight loss effect, and providing a more effective weight loss solution for obese people.

[0034] 3 Preparation method advantage: the preparation method of each polypeptide in the application has the characteristics of simplicity and high efficiency. The raw materials are widely available, such as mulberry leaves, bitter gourd, sea cucumber and oyster, which are abundant in nature and easy to obtain, and the cost is relatively low, which provides a solid material basis for large-scale industrial production. In the preparation process, by optimizing the enzymolysis conditions and purification process, high-purity and high-activity polypeptide products can be accurately obtained. For example, in the preparation process of mulberry leaf polypeptide, by accurately controlling the enzymolysis temperature, pH value and time, and selecting the appropriate protease, the extraction rate and purity of mulberry leaf polypeptide can be effectively improved, and the biological activity is guaranteed. This optimized preparation method not only improves the production efficiency and reduces the production cost, but also guarantees the quality and efficacy stability of the composite active polypeptide composition, which is conducive to the large-scale promotion and application of the product.

[0035] 4 High safety: compared with traditional weight loss products, the composite active polypeptide composition of the application has significant safety advantages. Polypeptides are naturally occurring substances in living organisms, which have good biocompatibility in the human body, are easily absorbed and metabolized by the human body, and will not accumulate in the body to produce toxicity. At the same time, the polypeptide components used in the application are derived from natural biological materials or prepared by genetic engineering technology, and do not contain harmful chemical synthetic substances, avoiding the serious side effects of traditional weight loss products, such as adverse reactions of the cardiovascular system, liver and kidney function damage, etc. Therefore, the composite active polypeptide composition of the application provides a safe and reliable weight loss choice for obese people, which can achieve the goal of weight loss while maximizing the protection of the user's physical health. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 NT and ELP3 polypeptide inhibition rate of a-amylase;

[0037] Figure 2 Figure 4 is a graph of the effect of different composite active polypeptide compositions on the food intake of obese mice;

[0038] Figure 3 Figure 5 is a graph of the effect of different composite active polypeptide compositions on the body weight of obese mice;

[0039] Figure 4 Figure 6 is a graph of the effect of different composite active polypeptide compositions on the fat weight content of obese mice. DETAILED DESCRIPTION

[0040] The technical solutions of the application are further described below in conjunction with the specific embodiments. However, those skilled in the art should understand that the following examples are only used to illustrate the application, and should not be regarded as limiting the application. The specific conditions not mentioned in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, such as those not specifically mentioned, are conventional products obtained through market channels.

[0041] The preparation method of the mulberry leaf polypeptide used in the embodiment of the application is as follows:

[0042] (1) fresh mulberry leaves are washed, dried, crushed, and sieved to obtain mulberry leaf powder;

[0043] (2) sodium bisulfite and purified water are added to the mulberry leaf powder obtained in step (1), the pH value is adjusted to 8, and heating is performed at 60°C for 2h, and a mulberry leaf crude filtrate is obtained by filtration; the amount ratio of the mulberry leaf powder, the sodium bisulfite, and the purified water is 10g:1g:100mL;

[0044] (3) the mulberry leaf crude filtrate is enzymolyzed with a complex protease at a weight ratio of 30:1 at 50°C and a pH value of 7 for 30min, the weight ratio of alkaline protease to pectinase in the complex protease is 3:1; then heating is performed at 95°C for 12min, and the supernatant is obtained by centrifugation to obtain a protein peptide solution; filtration, concentration, and freeze-drying are performed to obtain a mulberry leaf polypeptide.

[0045] The specific preparation method of the bitter gourd polypeptide used in the embodiment of the application is as follows:

[0046] (1) fresh bitter gourds are washed, dried, crushed, and sieved to obtain bitter gourd powder;

[0047] (2) 12 times the weight of water is added to the bitter gourd powder obtained in step (1), the pH value is adjusted to 8, and water bath heating is performed at 55°C for 5h, and a bitter gourd protein solution is obtained by filtration;

[0048] (3) the pH value of the bitter gourd protein solution obtained in step (2) is adjusted to 7.0, a complex enzyme solution is added, and enzymolysis is performed at 50°C for 4h; the addition amount of the complex enzyme is 2% of the volume of the bitter gourd protein solution; the weight ratio of alkaline protease to flavor protease in the complex enzyme is 2:1; after enzymolysis, inactivation is performed by water bath heating at 90°C for 2h, the temperature is cooled to room temperature, impurities are precipitated, and insoluble substances are removed to obtain a clear bitter gourd crude polypeptide;

[0049] (4) the bitter gourd crude polypeptide obtained in step (3) is filtered through an ultrafiltration filter with a membrane pore size of 10KDa, and the filtrate is collected; the filtrate is concentrated and freeze-dried to obtain a bitter gourd polypeptide.

[0050] The specific preparation method of the sea cucumber polypeptide used in the embodiment of the application is as follows:

[0051] (1) fresh sea cucumber intestines are cleaned of mud and sand, are quickly frozen at-80°C for 25min, are sliced and ground, and are diluted with 12 times the weight of water to obtain a sea cucumber slurry;

[0052] (2) the sea cucumber slurry and the compound protease are enzymolyzed at 50 DEG C and pH 8 for 4h at a weight ratio of 12:1 to prepare the sea cucumber hydrolysate, wherein the weight ratio of papain, alkaline protease and flavor protease in the compound protease is 1:4:2;

[0053] (3) the sea cucumber hydrolysate obtained in step (2) is subjected to enzyme inactivation at 85 DEG C for 15 min, and then the sea cucumber hydrolysate after enzyme inactivation is separated by a centrifuge, the supernatant is collected, high-temperature sterilization is performed, and the filtrate is collected by passing through an ultrafiltration filter with a membrane pore size of 10KDa; the filtrate is concentrated and freeze-dried to obtain the sea cucumber peptide.

[0054] The specific preparation method of the oyster peptide used in the embodiment of the present application is as follows:

[0055] (1) the oyster without shell is high-pressure cooked, the viscera is removed, and then homogenized, 10% of the weight of the oyster meat is added with active dry yeast, 5% of the weight of the oyster meat is added with arabinose, and 6% of the weight of the oyster meat is added with β-cyclodextrin, and then high-pressure deodorization treatment is performed at 65 DEG C and 350MPa for 25 min to obtain the oyster meat homogenate;

[0056] (2) the oyster meat homogenate obtained in step (1) is added with compound protease, and enzymolyzed at 45 DEG C and pH 7.0 for 4h to prepare a mixed solution; the addition amount of the compound protease is 5% of the mass of the oyster meat; the weight ratio of alkaline protease to flavor protease in the compound protease is 2:1;

[0057] (3) the mixed solution obtained in step (2) is separated by a centrifuge, the supernatant is collected, and the filtrate is collected by passing through an ultrafiltration filter with a membrane pore size of 10KDa; freeze-drying is performed to obtain the oyster peptide.

[0058] The preparation method of the NT analogue polypeptide ELP3 used in the embodiment of the present application specifically comprises the following steps:

[0059] (1) an artificial peptide segment AYYKSQWLVNGEGTP is added at the end of the amino acid sequence of the wild type NT to obtain the amino acid sequence SEQ ID NO.1 of the NT analogue polypeptide ELP3; the gene sequence is designed reversely according to the amino acid sequence SEQ ID NO.1 of the NT analogue polypeptide ELP3, and the corresponding base sequence is codon optimized according to the codon bias of the Escherichia coli for expressing heterologous proteins to obtain the nucleotide sequence SEQ ID NO.2 encoding the NT analogue polypeptide ELP3.

[0060] SEQ ID NO.1:

[0061] ELYENKPRRPYILAYYKSQWLVNGEGTP;

[0062] SEQ ID NO. 2:

[0063] GAGCTGTACGAAAACAAACCGCGTCGTCCGTACATCCTGGCTTACTACAAATCCCAGTGGCTGGTTAACGGTGAAGGTACCCCG.

[0064] (2) According to the obtained nucleotide sequence SEQ ID NO. 2 encoding the NT analogue polypeptide ELP3, upstream and downstream primers for amplifying the corresponding nucleotide sequence of the NT analogue polypeptide ELP3 are designed, the sequence of the upstream primer is shown in SEQ ID NO. 3, which is CATATGGAGCTGTACGAAAACAA, containing a Nde I restriction site CATATG; the sequence of the downstream primer is shown in SEQ ID NO. 4, which is AAGCTTGGGGTACCTTCACCGTTA, containing a Hind III restriction site AAGCTT; using the nucleotide sequence SEQ ID NO. 2 of the NT analogue polypeptide ELP3 as a template, the NT analogue polypeptide ELP3 gene is amplified by PCR method, and the target fragment is purified by a gel recovery kit.

[0065] (3) The restriction endonuclease Nde I and Hind III are used to perform double enzyme digestion on the plasmid pET30a, and the double enzyme digestion reaction system is shown in Table 1. The amplified and recovered NT analogue polypeptide ELP3 gene fragment is connected to the target fragment of the expression vector pET30a using T4 DNA ligase, and the T4 DNA ligase reaction system is shown in Table 2. The constructed recombinant plasmid pET30a-ELP3 is transformed into E. coli DH5α competent cells, which are cultured in an LB plate containing 100 μg / mL kanamycin, and a single colony is picked for bacterial liquid PCR identification, and the plasmid is extracted for sequencing identification, and the recombinant plasmid pET30a-ELP3 is obtained.

[0066] Table 1 Double enzyme digestion reaction system

[0067]

[0068] Table 2 T4 DNA ligase reaction system

[0069]

[0070] (4) The recombinant plasmid pET30a-ELP3 constructed in step (3) is transformed into E. coli BL21 (DE3) competent cells, which are coated on an LB plate containing 100 μg / mL kanamycin, and are cultured in a 37°C incubator overnight to obtain a recombinant strain, which is named pET30a-ELP3 / BL21.

[0071] (5) The positive monoclonal colonies are selected and inoculated in LB culture solution containing 100 μg / mL kanamycin, and cultured at 37°C overnight, and then 0.4 mmol / L IPTG is added to induce the expression of NT analogue polypeptide ELP3 for 7 hours to obtain bacterial precipitate. The NT analogue polypeptide ELP3 is purified by affinity chromatography to obtain NT analogue polypeptide ELP3.

[0072] Example 1

[0073] A complex active polypeptide composition with weight ratio of 20 parts of NT analogue polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter gourd polypeptide, 7 parts of sea cucumber peptide and 4 parts of oyster peptide is provided.

[0074] The present embodiment also provides a preparation method of the complex active polypeptide composition with weight ratio of 20 parts of NT analogue polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter gourd polypeptide, 7 parts of sea cucumber peptide and 4 parts of oyster peptide, which specifically comprises the following steps: weighing 20 parts of NT analogue polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter gourd polypeptide, 7 parts of sea cucumber peptide and 4 parts of oyster peptide, and stirring and mixing them uniformly.

[0075] Example 2

[0076] A complex active polypeptide composition with weight ratio of 15 parts of NT analogue polypeptide ELP3, 10 parts of mulberry leaf polypeptide, 9 parts of bitter gourd polypeptide, 5 parts of sea cucumber peptide and 3 parts of oyster peptide is provided.

[0077] The present embodiment also provides a preparation method of the complex active polypeptide composition with weight ratio of 15 parts of NT analogue polypeptide ELP3, 10 parts of mulberry leaf polypeptide, 9 parts of bitter gourd polypeptide, 5 parts of sea cucumber peptide and 3 parts of oyster peptide, which specifically comprises the following steps: weighing 15 parts of NT analogue polypeptide ELP3, 10 parts of mulberry leaf polypeptide, 9 parts of bitter gourd polypeptide, 5 parts of sea cucumber peptide and 3 parts of oyster peptide, and stirring and mixing them uniformly.

[0078] Example 3

[0079] A complex active polypeptide composition with weight ratio of 25 parts of NT analogue polypeptide ELP3, 18 parts of mulberry leaf polypeptide, 14 parts of bitter gourd polypeptide, 8 parts of sea cucumber peptide and 5 parts of oyster peptide is provided.

[0080] The present embodiment also provides a preparation method of the complex active polypeptide composition with weight ratio of 25 parts of NT analogue polypeptide ELP3, 18 parts of mulberry leaf polypeptide, 14 parts of bitter gourd polypeptide, 8 parts of sea cucumber peptide and 5 parts of oyster peptide, which specifically comprises the following steps: weighing 25 parts of NT analogue polypeptide ELP3, 18 parts of mulberry leaf polypeptide, 14 parts of bitter gourd polypeptide, 8 parts of sea cucumber peptide and 5 parts of oyster peptide, and stirring and mixing them uniformly.

[0081] Comparative Example 1

[0082] The difference between Comparative Example 1 and Example 1 is that the NT analogue polypeptide ELP3 is omitted from the ingredients of the complex active polypeptide composition having weight loss efficacy, and the rest is the same as Example 1.

[0083] Comparative Example 2

[0084] The difference between Comparative Example 2 and Example 1 is that the NT analogue polypeptide ELP3 in the complex active polypeptide composition having weight loss efficacy is replaced by a wild-type NT polypeptide; and the rest is the same as Example 1.

[0085] The preparation method of the wild-type NT polypeptide is: replacing the amino acid sequence SEQ ID NO. 1 of the NT analogue polypeptide ELP3 in step (1) of the preparation method of the NT analogue polypeptide ELP3 used in the example with the amino acid sequence ELYENKPRRPYIL of the wild-type NT polypeptide to obtain the wild-type NT polypeptide.

[0086] Test Example 1

[0087] Inhibition rate of NT analogue polypeptide ELP3 on α-amylase:

[0088] In order to determine the inhibition rate of the NT analogue polypeptide ELP3 prepared in the example and the wild-type NT polypeptide prepared in Comparative Example 2 on α-amylase, the following experiment was performed. A PBS buffer with pH 7.0 and a concentration of 20 mmol / L was used to prepare 1 U / mL of α-amylase solution, 1% (w / w) of starch solution, 10 mg / mL of NT analogue polypeptide ELP3 solution, and 10 mg / mL of wild-type NT polypeptide solution. 10 μL of 1 U / mL of α-amylase solution was taken and added to a centrifuge tube, and 20 μL of NT analogue polypeptide ELP3 solution, 20 μL of wild-type NT solution, and 20 μL of PBS were added to each centrifuge tube, respectively, and were labeled as NT analogue polypeptide ELP3 group, wild-type NT group, and control group, respectively. The centrifuge tubes were placed in a 37°C shaker for 15 min to allow the polypeptides to fully contact with the α-amylase. Then, 500 μL of 1% (w / w) of starch solution was added to the centrifuge tubes, and the reaction was continued at 37°C for 5 min. Finally, 500 μL of reaction termination solution DNS was added, and the boiling water bath was maintained for 15 min. After the reaction was completed, the centrifuge tubes were cooled to room temperature, and the absorbance (A) of each well was measured at a wavelength of 540 nm using an enzyme marker. According to the control group (enzyme activity 100%), the α-amylase inhibition rate of the NT analogue polypeptide ELP3 and the wild-type NT solution was calculated.

[0089] The results are as follows: Figure 1The inhibition rate of different polypeptides on α-amylase is shown. As can be seen from the figure, the wild type NT has a certain inhibitory effect on α-amylase, and the inhibitory activity is 61%. The inhibitory effect of the NT analogue polypeptide ELP3 prepared by the application is the most significant, and the inhibitory activity is about 77%. It is shown that by adding the artificial peptide segment AYYKSQWLVNGEGTP at the end of the wild type NT, a specific group modification is introduced, thereby improving the stability and activity of the NT analogue, and enhancing the inhibitory activity of the NT analogue on α-amylase; the NT analogue polypeptide ELP3 can effectively reduce energy intake and maintain the stability of blood glucose level by reducing the digestion and absorption of starch, thereby achieving the effect of weight loss.

[0090] Test Example 2

[0091] Pharmacodynamic evaluation of the complex active polypeptide composition on an obese mouse model:

[0092] The following is the effect test of a complex active polypeptide composition with weight loss effect prepared in Examples 1-3 and Comparative Examples 1-2:

[0093] (1) 100 four-week-old male C57 mice were selected for the test, and were fed with high-fat feed for 6 weeks. 60 mice with a body weight greater than 35 grams were selected and randomly divided into 6 groups (Example 1 group, Example 2 group, Example 3 group, Comparative Example 1 group, Comparative Example 2 group, and model group), 10 mice in each group. In addition, 10 four-week-old male C57 mice were selected and fed with ordinary feed for 6 weeks as a normal control group.

[0094] (2) The Example 1 group, the Example 2 group, the Example 3 group, the Comparative Example 1 group, and the Comparative Example 2 group were respectively administered with the complex active polypeptide composition of the corresponding group, with a dose of 0.5 mg / kg / d, once in the morning and once in the evening, and ordinary feed was fed. The model group and the normal control group were administered with the same amount of normal saline.

[0095] (3) From the start of administration, the initial food intake of each group was recorded, and the remaining food was detected every 3-5 days. New mouse feed was continuously added and recorded, and the cumulative food intake curve was plotted, and the results are shown in Figure 2 .

[0096] The results are shown in Figure 2 , Figure 3 . Figure 2 , Figure 3 As can be seen from the figures, compared with the Comparative Example 1 and the Comparative Example 2, the complex active polypeptide composition with weight loss effect prepared in Examples 1-3 of the application can significantly inhibit the food intake of mice, thereby significantly reducing the body weight of obese mice.

[0097] (4) After 11 weeks of administration, the mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital 50 mg / Kg, combined with inhaled anesthetic isoflurane, to ensure that the mice breathe slowly and smoothly. MRI nuclear magnetic monitoring was performed to monitor the fat content, and the fat weight was calculated.

[0098] The results are shown in Table 3, which are the effects of different complex active polypeptide compositions on the fat weight content of obese mice. As can be seen from the table, compared with the comparative examples 1 and 2, the complex active polypeptide compositions prepared in the examples 1-3 of the present application can significantly reduce the fat weight of obese mice, and restore it to the normal level, thereby achieving the purpose of weight loss. Figure 4 Figure 4 The results are shown in Table 3, which are the effects of different complex active polypeptide compositions on the fat weight content of obese mice. As can be seen from the table, compared with the comparative examples 1 and 2, the complex active polypeptide compositions prepared in the examples 1-3 of the present application can significantly reduce the fat weight of obese mice, and restore it to the normal level, thereby achieving the purpose of weight loss.

[0099] (5) After 11 weeks of administration, the obese mice were taken blood from the eye socket, and the serum was collected and detected using a kit to detect the contents of high-density lipoprotein (HDL), triglyceride (TG), and low-density lipoprotein (LDL) in the serum of obese mice.

[0100] Table 3 is the effect of different polypeptides on the serum indicators of obese mice

[0101]

[0102] The results are shown in Table 3, which are the effects of different complex active polypeptide compositions on the fat weight content of obese mice. As can be seen from the table, compared with the comparative examples 1 and 2, the complex active polypeptide compositions prepared in the examples 1-3 of the present application can significantly reduce the fat weight of obese mice, and restore it to the normal level, thereby achieving the purpose of weight loss.

[0103] ​In summary, the NT analogue polypeptide ELP3 can effectively reduce energy intake, maintain stable blood glucose levels, and achieve the effect of weight loss by reducing starch digestion and absorption; mulberry polypeptide can promote the increase of adiponectin, activate the beta-oxidation process, inhibit the accumulation of liver fat, and resist oxidative stress of the body, which has a positive significance for preventing diet-induced obesity; bitter gourd polypeptide can regulate blood glucose and blood lipid levels, inhibit the activity of key enzymes of fat synthesis, and reduce the synthesis and accumulation of fat in the body; sea cucumber peptide and oyster peptide are rich in various amino acids and bioactive substances, can promote metabolism, regulate signal pathways related to fat metabolism, promote fat decomposition and transport, and achieve the effect of weight loss. The NT analogue polypeptide ELP3, mulberry polypeptide, bitter gourd polypeptide, sea cucumber peptide and oyster peptide play a synergistic effect, can effectively improve the blood lipid metabolism of obese mice, reduce the fat content of mice, and significantly inhibit the food intake of mice, thereby achieving the purpose of reducing the weight of mice, and showing good weight loss effect. The polypeptides in the compound active polypeptide composition of the present application have good biocompatibility in the human body, are green and non-toxic, meet the food safety requirements, and have a wide application prospect.

[0104] Finally, it should be pointed out that the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them. The basic principles and main features of the present application have been described above with specific embodiments, and some modifications or replacements can be made on the basis of the present application, but these modifications or replacements do not make the corresponding technical solutions deviate from the scope of the present application.

Claims

1. A complex active polypeptide composition having a weight-reducing effect, characterized in that, The complex active polypeptide composition comprises the following raw materials in parts by weight: NT analogue polypeptide ELP3 15-25 parts, mulberry leaf polypeptide 10-18 parts, bitter gourd polypeptide 9-14 parts, sea cucumber peptide 5-8 parts, and oyster peptide 3-5 parts; the amino acid sequence of the NT analogue polypeptide ELP3 is shown as SEQ ID NO.

1.

2. The complex active polypeptide composition with weight loss efficacy according to claim 1, characterized in that, The complex active polypeptide composition comprises the following raw materials in parts by weight: NT analogue polypeptide ELP3 20 parts, mulberry leaf polypeptide 14 parts, bitter gourd polypeptide 12 parts, sea cucumber peptide 7 parts, and oyster peptide 4 parts.

3. The complex active polypeptide composition with weight loss efficacy according to claim 1 or 2, characterized in that, The specific preparation steps of the NT analogue polypeptide ELP3 are as follows: (1) design the amino acid sequence of the NT analogue polypeptide ELP3, and reversely design the nucleotide sequence encoding the NT analogue polypeptide ELP3, link the nucleotide sequence encoding the NT analogue polypeptide ELP3 with a vector to obtain a recombinant plasmid; (2) transfer the recombinant plasmid obtained in step (1) into a competent cell, induce expression by IPTG, and obtain a bacterial precipitate; (3) separate and purify the bacterial precipitate obtained in step (2) to obtain the NT analogue polypeptide ELP3.

4. The complex active polypeptide composition with weight loss efficacy according to claim 3, characterized in that, The concentration of the IPTG induction expression in step (2) is 0.3-0.5 mmol / L, and the time of the IPTG induction expression is 5-10 h.

5. The complex active polypeptide composition with weight loss efficacy according to claim 3, characterized in that, The specific operation of step (1) is as follows: S1 add an artificial peptide segment AYYKSQWLVNGEGTP at the end of the amino acid sequence of the wild-type NT to obtain the amino acid sequence of the NT analogue polypeptide ELP3, which is shown as SEQ ID NO. 1; S2 reversely design the gene sequence according to the amino acid sequence of the NT analogue polypeptide ELP3, perform codon optimization to obtain the nucleotide sequence encoding the NT analogue polypeptide ELP3, which is shown as SEQ ID NO. 2; S3 design the upstream and downstream primers for amplifying the corresponding nucleotide sequence of the NT analogue polypeptide ELP3 according to the nucleotide sequence obtained in step S2, link the primer-amplified nucleotide sequence of the NT analogue polypeptide ELP3 with a pET30a vector to construct a recombinant plasmid.

6. The complex active polypeptide composition with weight loss efficacy according to claim 5, characterized in that, The sequence of the upstream primer in step S3 is shown as SEQ ID NO. 3; and the sequence of the downstream primer is shown as SEQ ID NO.

4.

7. The complex active polypeptide composition with weight loss efficacy according to claim 1, characterized in that, The preparation method of the mulberry leaf polypeptide is as follows: prepare mulberry leaves into mulberry leaf powder, add sodium bisulfite and water, heat at 55-65 ℃ for 1-3 h, filter to obtain a crude mulberry leaf filtrate; the use amount ratio of the mulberry leaf powder, sodium bisulfite and water is 10 g: 1 g: (90-110) mL; then perform enzymatic hydrolysis at 40-60 ℃ for 20-40 min; then heat at 90-100 ℃ for 10-15 min, centrifuge to obtain a supernatant, and obtain a protein peptide solution; filter, concentrate, freeze-dry to obtain the mulberry leaf polypeptide.

8. The complex active polypeptide composition with weight loss efficacy according to claim 1, characterized in that, The preparation method of the Momordica charantia polypeptide is as follows: fresh Momordica charantia is made into Momordica charantia powder, 10-14 times of water by weight is added, and water bath heating is carried out at 50-60 DEG C for 4-6 h to obtain Momordica charantia protein liquid; then enzymolysis is carried out at 40-50 DEG C for 2-4 h; after enzymolysis, 80-100 DEG C water bath inactivation is carried out for 1-2 h, and cooling to room temperature to obtain Momordica charantia crude polypeptide; after filtration, concentration and freeze-drying, the Momordica charantia polypeptide is obtained.

9. The complex active polypeptide composition with weight loss efficacy according to claim 1, characterized in that, The preparation method of the sea cucumber peptide is as follows: fresh sea cucumber is washed, and then frozen at-80 DEG C for 20-30 min; 10-14 times of water by weight is added to obtain sea cucumber slurry; enzymolysis is carried out at 40-60 DEG C and pH 7-8 for 3-5 h; enzyme inactivation is carried out by water bath at 85-90 DEG C for 10-20 min; after enzyme inactivation, the supernatant is collected by centrifugation; after filtration, concentration and freeze-drying, the sea cucumber peptide is obtained. The preparation method of the oyster peptide is as follows: shell-less oysters are made into oyster meat homogenate; then enzymolysis is carried out at 40-50 DEG C for 3-5 h; after centrifugation, filtration and freeze-drying, the oyster peptide is obtained.

10. The method for preparing a complex active polypeptide composition with weight loss efficacy according to any one of claims 1-9, characterized in that, The specific steps include: the NT analogue polypeptide ELP3, mulberry leaf polypeptide, Momordica charantia polypeptide, sea cucumber peptide and oyster peptide are weighed according to the weight parts, and then stirred and mixed uniformly to obtain the product.

Citation Information

Patent Citations

  • Therapeutic peptides and methods of use thereof

    CN107847554A

  • Preparation method of solid beverage containing sea cucumber peptide, urechis unicinctus peptide and oyster peptide

    CN113826907A