Aspergillus oryzae C02 and application thereof

Abstract

The invention relates to Aspergillus oryzae C02 and an application of the Aspergillus oryzae C02, and belongs to the technical field of microorganisms. The aspergillus oryzae C02 disclosed by the invention is preserved in Guangdong Microbial Culture Collection Center, and the preservation number of the aspergillus oryzae C02 is GDMCC NO.66457. The strain is obtained by separating, purifying and screening soil samples collected from botanical gardens in South China of Guangzhou; tests show that bacteriostatic active substances generated by fermentation of the strain have good bacteriostatic effects on pseudomonas putida, escherichia coli, staphylococcus aureus, burkholderia cepacia, candida albicans and propionibacterium acnes, and the bacteriostatic active substances have the characteristic of high temperature resistance and excellent preservative effect; the antibacterial preservative can be used as an antibacterial preservative raw material, is applied to the fields of food, health care products or daily chemical products and the like, and has wide application prospects and important conversion research values.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to an Aspergillus oryzae C02 strain and applications thereof. Background Art

[0002] Cosmetics typically contain nutrients such as oils, proteins, polysaccharides, and various moisturizing factors. While these ingredients contribute to the product's excellent performance, they also provide a favorable environment for the growth and reproduction of microorganisms. To ensure that the product does not deteriorate due to microbial contamination within the specified shelf life, thereby ensuring consumer safety and product stability, preservatives are often added to the formula to inhibit microbial proliferation.

[0003] However, currently widely used chemical preservatives often suffer from safety and compatibility deficiencies. For example, while phenoxyethanol possesses broad-spectrum antimicrobial properties, it has been linked to adverse skin reactions such as contact allergies, eczema, and urticaria. The safety of methylisothiazolinone (MIT) and methylchloroisothiazolinone (CMIT) is widely questioned due to their potential cytotoxicity and neurotoxicity. Traditional preservatives such as benzyl alcohol, sodium benzoate, and potassium sorbate can cause skin irritation or allergic dermatitis, and their antibacterial activity is limited by the pH value of the system, making their application more demanding. Furthermore, some preservatives have strong odors and affect formulation stability, limiting their use in high-end or sensitive skin products.

[0004] In recent years, natural plant-based antimicrobial ingredients have garnered attention due to their "green" and "mild" labels. However, most natural preservatives still have issues such as color and odor, phototoxicity risks, narrow antimicrobial spectrum, or high cost, and may affect the sensory properties and material state of the final product. Therefore, it is essential to develop a safe, effective, stable, and naturally derived antimicrobial ingredient to reduce the amount of preservatives used in cosmetic formulation development or to replace their use in order to achieve a high antimicrobial effect. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of the prior art and provide a strain of Aspergillus oryzae C02 that produces a highly active antibacterial substance. The strain was isolated, purified, and screened from a soil sample collected from the South China Botanical Garden in Guangzhou and has been deposited in the Guangdong Provincial Microbial Culture Collection with the deposit number GDMCC NO.66457.

[0006] In a first aspect, the present invention provides a strain of Aspergillus oryzae ( Aspergillus oryzae ), the bacteria was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66457, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0007] In a second aspect, the present invention provides the use of Aspergillus oryzae C02 described in the first aspect in the preparation of antibacterial active substances.

[0008] In a third aspect, the present invention provides a method for producing an antibacterial active substance by CO2 fermentation of Aspergillus oryzae according to the first aspect, comprising the following steps: S1. Seed liquid culture: Activate the frozen strain C02, pick out the culture block containing the colony after activation, add it to PDB liquid culture medium and culture it to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added for ultrasonic-assisted extraction. The mixture is allowed to stand at room temperature for extraction and then filtered to obtain an extract and a solid portion; S4. Collecting the extract and concentrating it to obtain the antibacterial active substance.

[0009] Preferably, in step S1, the culture temperature is 25-30° C., the culture speed is 180-220 rpm, and the culture time is 12-18 h.

[0010] Preferably, in step S2, the fermentation temperature is 25-30° C., and the fermentation time is 4-6 days.

[0011] Preferably, in step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction time at room temperature is 1-3h.

[0012] Preferably, the solid portion in step S3 is added with an equal volume of ethyl acetate and extracted at room temperature for 1-3 hours before filtration, and the extraction is repeated 2-3 times before combining the extracts.

[0013] Preferably, the extract in step S4 is concentrated until the solvent is completely removed.

[0014] In a fourth aspect, the present invention provides a daily chemical product comprising the Aspergillus oryzae C02 described in the first aspect.

[0015] In a fifth aspect, the present invention provides use of the antibacterial active substance prepared by the method described in the third aspect in the preparation of food, health products or daily chemical products.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The inventors of this application isolated, purified and screened Aspergillus oryzae C02 from soil samples collected from the South China Botanical Garden in Guangzhou.

[0017] 1. The results of the antibacterial test showed that the antibacterial active substance produced by the CO2 fermentation of Aspergillus oryzae isolated in the present invention had a broad-spectrum antibacterial effect on Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes. The diameters of the inhibition zones of the above six indicator bacteria were all greater than 15 mm.

[0018] 2. The results of the minimum inhibitory concentration test showed that the antibacterial active substances produced by the fermentation of strain C02 had a minimum inhibitory concentration (MIC) of less than 25 μg / mL against Staphylococcus aureus and Candida albicans, less than 50 μg / mL against Pseudomonas putida and Escherichia coli, less than 100 μg / mL against Burkholderia cepacia, and less than 12.5 μg / mL against Propionibacterium acnes.

[0019] 3. The results of the heat resistance test showed that the antibacterial active substance produced by the fermentation of strain C02 still had excellent antibacterial properties against Staphylococcus aureus, Candida albicans, and Propionibacterium acnes after being treated at 80°C and 60°C for 40 minutes, respectively, indicating that the antibacterial active substance prepared by the present invention has high temperature resistance.

[0020] 4. Antiseptic test results showed that the viable bacterial counts in both the bacterial and fungal groups showed a downward trend after 6 hours of exposure; after 7 days, the viable bacterial counts in each group were no higher than 90 CFU / mL; and after 14 to 28 days, the viable bacterial counts in both the bacterial and fungal groups were zero, indicating that the test substances passed the test and had excellent antiseptic properties. This suggests that the antibacterial active substances produced by CO2 fermentation of Aspergillus oryzae can be used as antibacterial and antiseptic raw materials, exhibiting excellent antiseptic properties when used in the preparation of foods, health products, or daily chemical products, and possess broad application prospects and important translational research value.

[0021] Biomaterial Deposit A strain of Aspergillus oryzae C02, classified and named Aspergillus oryzae , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66457, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the colony morphology of Aspergillus oryzae C02; Figure 2 is the phylogenetic tree of Aspergillus oryzae C02; Figure 3 This is a partial antibacterial effect diagram of the antibacterial active substance of Aspergillus oryzae C02 in Example 4; wherein S represents Staphylococcus aureus, E represents Escherichia coli, and H represents Burkholderia cepacia. DETAILED DESCRIPTION

[0023] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0024] Unless otherwise specified, other materials and reagents used in the examples can be obtained from commercial sources.

[0025] The culture medium involved in the present invention is: PDA medium: 20 g / L glucose, 12 g / L potato extract powder, 10 g / L yeast extract powder, 20 g / L agar, distilled water, natural pH.

[0026] PDB liquid medium: 20 g / L glucose, 12 g / L potato extract powder, 10 g / L yeast extract powder, distilled water, natural pH.

[0027] Solid fermentation medium: PDA medium.

[0028] All the above culture media must undergo a sterilization step, with the sterilization conditions being 121°C for 20 min.

[0029] Example 1: Isolation, purification and screening of strains Soil samples were collected from the South China Botanical Garden in Guangzhou, Guangdong Province, China. 10 g of soil sample was weighed, added to 90 mL of sterile water, and cultured at room temperature with shaking at 150 rpm for 30 min. Afterwards, the suspension was aspirated and the strains were isolated using a 10-fold gradient dilution method. 100 μL of the suspension was diluted 10 times. -4 , 10 -5 , 10 -6 The dilutions were spread onto PDA medium and incubated at 28°C. Observed daily, individual mold colonies were transferred to new PDA plates and repeatedly isolated and purified using the plate streak method. Purified strains were obtained and numbered. The strains were transferred to PDB liquid medium for liquid culture. After obtaining the bacterial suspension, sterile glycerol was added to prepare a strain freezing solution containing 30% glycerol, which was stored at -80°C.

[0030] The isolated mold strains were screened for antibacterial activity. The specific steps were as follows: Each mold strain was cultured overnight in PDB liquid medium at 28°C and 200 rpm. A 1% inoculum was then evenly spread onto a PDA plate and incubated at 28°C for 5 days. Upon completion of fermentation, the resulting product was collected, crushed, and extracted twice with equal amounts of ethyl acetate. Each extraction was allowed to stand for 2 hours before filtration. The ethyl acetate extract was concentrated to completely remove the solvent and then prepared with a methanol solution to a 10 mg / ml sample. The sample was sterilized by filtration using a 0.2 μm filter to obtain the test solution. The test solution was then tested for antibacterial activity against two common opportunistic pathogens, Escherichia coli and Staphylococcus aureus, using an agar diffusion assay. Initial screening experiments demonstrated that mold C02 exhibited significant antibacterial activity against both Escherichia coli and Staphylococcus aureus, prompting strain identification and subsequent validation experiments.

[0031] Example 2 Identification of bacterial species Morphological characteristics: After being cultured in PDA medium at 28°C for 3 days, the colonies of strain C02 were yellow-green oval in shape, with a light yellow reverse side and a velvety texture (e.g. Figure 1 As shown); Microscopic examination results showed that the conidia were spherical or oval, and the spore stalks were transparent.

[0032] Identification by molecular biology methods: 18S rRNA identification was performed. The genomic DNA of strain C02 was extracted as a template according to the operating instructions of the fungal genomic DNA extraction kit, and 18S rRNA was obtained by PCR amplification using universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3' (SEQ ID.NO 2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3' (SEQ IDNO.3)). Subsequently, BGI was commissioned to perform sequencing, and the sequence information obtained by sequencing (SEQ ID NO.1) was compared and homology analyzed in the NCBI database, and a phylogenetic tree was constructed using MEGA 12 software; the phylogenetic tree is shown in Figure 2. Figure 2 As shown, the results showed that strain C02 and Aspergillus oryzae The strains were clustered in the same branch with a sequence homology of 98.00%. Combined with its morphological characteristics, strain C02 was identified as Aspergillus oryzae and was classified as Aspergillus oryzae .

[0033] The 18S rRNA sequence of the strain is shown in SEQ ID NO.1: CCTATTCCCCGTGTTACGTTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTTAAGTTATTATGAATCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCCTT CCGAAGTCGAGGTTTTTAGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAAGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTATAAAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTATGTAACTACATG.

[0034] Example 3 Preparation of antibacterial active substances The preparation method of the antibacterial active substance ① specifically comprises the following steps: S1. Seed liquid culture: Activate the frozen strain C02. After activation, pick an area of ​​1cm 2 The culture block containing the colony was added to 200 mL of PDB liquid medium and cultured at 28°C and 200 rpm for 16 h to obtain seed solution; S2, solid fermentation: take 5% (volume / mass ratio) seed solution and evenly spread it on solid fermentation medium, ferment at 28℃ in the dark for 5 days; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, an equal volume of ethyl acetate is added, and ultrasonic-assisted extraction is performed at an ultrasonic power of 400W for 40 minutes. After the ultrasonic-assisted extraction, the mixture is immersed in the mixture at room temperature for 2 hours and then filtered to obtain an extract and a solid portion; the solid portion is then added with an equal volume of ethyl acetate and allowed to stand at room temperature for 2 hours and then filtered, and this step is repeated 3 times; the extracts obtained after all extractions are combined; S4. Concentrating the combined extracts until the solvent is completely removed to obtain the antibacterial active substance.

[0035] Antibacterial active substance ②: Compared with the preparation steps of antibacterial active substance ①, the only difference is that Aspergillus oryzae JAAS-32 with a preservation number of GDMCC No. 63725 (donated by Jiangsu Academy of Agricultural Sciences) is used instead of Aspergillus oryzae C02 in the present invention to prepare the antibacterial active substance through seed liquid culture, solid fermentation and other steps. The other steps and parameters are the same as those of antibacterial active substance ①.

[0036] Example 4 Antibacterial Test Test substances: The antibacterial active substances ① and ② prepared in Example 3 were dissolved in methanol to a concentration of 10 mg / mL, respectively, and then sterilized by filtration using a 0.2 μm filter membrane to obtain test solutions for antibacterial experiments; Indicator bacteria: Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans, and Propionibacterium acnes are selected; Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans, and Propionibacterium acnes are inoculated into appropriate culture media for activation and culture to obtain logarithmic test bacterial suspensions; The specific steps of the antibacterial test are as follows: The test used a double-layer agar diffusion method. 10 mL of sterilized 1% water agar medium was poured into a sterile plate and placed in an Oxford cup after solidification. 200 μL of indicator bacteria solution was added to 20 mL of nutrient agar medium at about 50°C and mixed evenly. The final concentration of the indicator bacteria was 4 × 10 7 CFU / mL, pour the mixed nutrient agar medium containing indicator bacteria into a sterile plate; after the nutrient agar medium is completely solidified, remove the Oxford cup and add 100 μL of the test substance to each well. The blank control group uses an equal amount of methanol instead of the test substance; Pseudomonas putida, Escherichia coli, Staphylococcus aureus, and Burkholderia cepacia are cultured at 36°C for 24 hours, Propionibacterium acnes is cultured in an anaerobic incubator at 36°C for 24 hours, and Candida albicans is cultured at 28°C for 72 hours. The diameter of the inhibition zone is measured; three parallel experiments are set for each indicator bacteria, and each inhibition zone is measured in three directions. The data are presented as the average value.

[0037] The test results are as follows Figure 3 (Only part of the experimental results are shown in the figure) and as shown in Table 1: The diameters of the inhibition zones of antibacterial active substance ① against Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes are 18.90 mm, 19.54 mm, 20.13 mm, 15.06 mm, 20.78 mm and 23.57 mm, respectively, indicating that the antibacterial active substance prepared by Aspergillus oryzae C02 fermentation has good antibacterial effect.

[0038] Combining the antibacterial effects of antibacterial active substances ① and ② in Table 1 on Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes, it can be seen that not all Aspergillus oryzae with antibacterial function has antibacterial effects on the above 6 bacteria. The Aspergillus oryzae C02 isolated and obtained in the present invention can be fermented to produce active substances with broad-spectrum antibacterial properties.

[0039] Table 1 Antibacterial test data

[0040] Note: Unit: (mm), “-” means no obvious antibacterial activity.

[0041] Example 5 Minimum Inhibitory Concentration (MIC) Detection Indicator bacteria: Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, Candida albicans and Propionibacterium acnes in the logarithmic phase were selected; the indicator bacteria were diluted to 1×10 7 CFU / mL concentration for later use; Test substance: The antibacterial active substance ① prepared in Example 3 was first prepared with DMSO to a concentration of 25 mg / mL, filtered through a 0.2 μm filter for sterilization, and then diluted with nutrient broth to concentrations of 250, 200, 100, 50, 25, and 12.5 μg / mL for minimum inhibitory concentration (MIC) testing. Experimental group: 100 μL of the test substance at concentrations of 250, 200, 100, 50, 25, and 12.5 μg / mL were added to rows 1 to 7 of a 96-well plate, followed by 100 μL of indicator bacteria per well and gently pipetting to mix. Blank control group: DMSO was added to each well of row 8 of a 96-well plate according to the amount of DMSO in the test substance at each concentration, and the volume was made up to 100 μL with nutrient broth medium. 100 μL of indicator bacteria was added and gently pipetting to mix. Three replicate wells were set for each indicator bacteria in each group. Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, and Candida albicans were cultured in a shaker at 30°C and 120 rpm for 36 h. Propionibacterium acnes was placed in anaerobic bags and cultured in a shaker at 30°C and 120 rpm for 36 h. Each well was observed for turbidity and the results were recorded. Data are presented as average values. It can be seen from the minimum inhibitory concentration (MIC) data in Table 2 that the antibacterial active substances prepared by fermenting Aspergillus oryzae C02 isolated from the soil in the present application have a minimum inhibitory concentration (MIC) of less than 25 μg / mL against Staphylococcus aureus and Candida albicans, a minimum inhibitory concentration (MIC) of less than 50 μg / mL against Pseudomonas putida and Escherichia coli, a minimum inhibitory concentration (MIC) of less than 100 μg / mL against Burkholderia cepacia, and a minimum inhibitory concentration (MIC) of less than 12.5 μg / mL against Propionibacterium acnes, indicating that the fermentation product of strain C02 has excellent antibacterial properties against the above-mentioned indicator bacteria.

[0042] Table 2 Minimum inhibitory concentration (MIC) data

[0043] Note: “+” means turbid, which means it cannot inhibit the growth of indicator bacteria; “-” means clear, which means it can inhibit the growth of indicator bacteria.

[0044] Example 6 Heat resistance test Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in methanol to a concentration of 10 mg / mL, and then sterilized by filtration using a 0.2 μm filter membrane to obtain a test solution for heat resistance test; The test substances were treated at 80°C and 60°C for 40 min, respectively, and then cooled to room temperature. Antibacterial tests were performed according to the method of Example 4. An equal amount of methanol was used instead of the test substance in the control group. Three parallel experiments were performed in each group, and the data are presented as the average value. Indicator bacteria: Use logarithmic test bacteria suspensions of Staphylococcus aureus, Candida albicans, and Propionibacterium acnes; The experimental results show that after the antibacterial active substance ① was treated at 80°C and 60°C for 40 minutes, respectively, an antibacterial test was carried out according to the antibacterial test steps described in Example 4. The experimental results show that the diameters of the inhibition zones of the antibacterial active substance ① after the above two treatment methods for Staphylococcus aureus, Candida albicans, and Propionibacterium acnes are almost consistent with the data in Table 1 in Example 4. The diameters of the inhibition zones of Staphylococcus aureus are 19.85 mm and 19.93 mm, respectively; the diameters of the inhibition zones of Candida albicans are 19.86 mm and 20.37 mm, respectively; and the diameters of the inhibition zones of Propionibacterium acnes are 23.05 mm and 23.32 mm, respectively. This indicates that the antibacterial active substance produced by Aspergillus oryzae CO2 fermentation still has excellent antibacterial properties after high-temperature treatment, and has high-temperature resistance.

[0045] Example 7 Anticorrosion Test Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in 1,3-butanediol to a mass fraction of 5%, and then sterilized by filtration using a 0.2 μm filter membrane to obtain a test solution; The test substance is added to the cosmetics as a natural preservative, and the preservative test is conducted with reference to the well-known microbial challenge test methods of the Cosmetic, Toiletries and Fragrance Association (CTFA) and the United States Pharmacopoeia. The specific test steps are as follows: First, a certain amount of preservative-free facial mask liquid was prepared according to the basic formula and randomly divided into two groups, with five facial mask liquids in each group. The test substances were added to make the final mass fraction of antibacterial active substance ① in the facial mask liquid reach 0.05%; the test bacteria Pseudomonas putida, Escherichia coli, Staphylococcus aureus, Burkholderia cepacia, and Candida albicans in the logarithmic growth phase were diluted to 4×10 9 CFU / mL, after mixing the bacterial solution, take an appropriate amount and add it to the mask solution. The bacterial group makes the final concentration of bacteria in the mask solution be 4×10 7CFU / mL, the fungus group made the final concentration of fungi in the mask liquid 4×10 6 CFU / mL, after being mixed evenly, the bacteria group was cultured in a 36℃ incubator, and the fungus group was cultured in a 28℃ incubator; according to the total colony count test method in Chapter 5 Microbiological Test Methods in the 2015 Edition of Cosmetics Safety Technical Specifications, the number of viable bacteria was determined 6h, 7d, 14d, and 28d after inoculation to judge the preservative efficacy of the cosmetics; the judgment standard is: when each sample is inoculated with bacteria, the number of surviving bacteria is reduced to no more than 0.1% of the initial concentration on the 7th day, and then gradually decreases, and no sterile growth is achieved on the 28th day; the preservative is effective and passes the test; otherwise, the preservative is ineffective and fails the test.

[0046] The antiseptic test results are shown in Table 3 (data presented as average values). After 6 hours of exposure, the viable bacterial counts in both the bacterial and fungal groups showed a downward trend. After 7 days, the viable bacterial counts in each group were no higher than 90 CFU / mL. After 14 to 28 days, the viable bacterial counts in both the bacterial and fungal groups were zero, indicating that the test substances passed the test and exhibited excellent antiseptic properties. This suggests that the antibacterial active substances produced by CO2 fermentation of Aspergillus oryzae can be used as antibacterial and antiseptic raw materials. Their excellent antiseptic properties when used in the preparation of foods, health products, or daily chemical products suggest broad application prospects and significant translational research value.

[0047] Table 3 Anticorrosion test data Group 6h 7d 14d 28d Bacterial viable count (CFU / mL) <![CDATA[6.34×10 5 ]]> 56 0 0 Fungal viable count (CFU / mL) <![CDATA[4.13×10 5 ]]> 84 0 0 Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A strain of Aspergillus oryzae ( Aspergillus oryzae ) C02, characterized in that Its deposit number is GDMCCNO.66457.

2. Application of Aspergillus oryzae CO2 as claimed in claim 1 in preparing antibacterial active substances.

3. A method for producing antibacterial active substances by using Aspergillus oryzae CO2 fermentation as claimed in claim 1, characterized in that: The following steps are involved: S1. Seed liquid culture: Activate the frozen strain C02, pick out the culture block containing the colony after activation, add it to PDB liquid culture medium and culture it to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added for ultrasonic-assisted extraction. The mixture is allowed to stand at room temperature for extraction and then filtered to obtain an extract and a solid portion; S4. Collecting the extract and concentrating it to obtain the antibacterial active substance.

4. The method according to claim 3, characterized in that In step S1, the culture temperature is 25-30° C., the culture speed is 180-220 rpm, and the culture time is 12-18 hours.

5. The method according to claim 3, characterized in that In step S2, the fermentation temperature is 25-30° C. and the fermentation time is 4-6 days.

6. The method according to claim 3, characterized in that In step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction time at room temperature is 1-3h.

7. The method according to claim 3, characterized in that An equal volume of ethyl acetate is added to the solid portion in step S3, and the mixture is allowed to stand at room temperature for 1-3 hours before being filtered. The extraction is repeated 2-3 times, and the extracts are combined.

8. The method according to claim 3, characterized in that In step S4, the extract is concentrated until the solvent is completely removed.

9. A daily chemical product, characterized in that: Containing the Aspergillus oryzae C02 as claimed in claim 1.

10. Use of the antibacterial active substance prepared by the method according to any one of claims 3 to 8 in the preparation of food, health products or daily chemical products.

Images