Method for transferring exogenous nucleic acid fragment into plant by using plant virus

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a method for transferring an exogenous nucleic acid fragment into a plant by using a plant virus. The technical problem to be solved by the invention is to provide a new method which can be applied to transferring an exogenous fragment into a plant. According to the technical scheme, the method for transferring the exogenous nucleic acid fragment into the plant by using the plant virus comprises the following steps: fusing the exogenous nucleic acid fragment into a 3'non-coding RNA region of TVMVwt to obtain a fused fragment, constructing the fused fragment onto an infectious clone skeleton vector, and transforming the plant. According to the invention, an exogenous coding sequence is inserted into a 3'non-coding RNA region of TVMVwt to construct an infectious cloning vector, the infectious cloning vector is transferred into a plant, and expression of the exogenous coding sequence is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for transferring exogenous nucleic acid fragments into plants by utilizing plant viruses. Background Art

[0002] As strictly intracellular parasites that rely heavily on host cells for replication, traditional genetic research on viruses has long been limited by their inability to culture in vitro and directly manipulate their genes. Breakthroughs in infectious cloning technology, particularly the development of efficient systems for constructing RNA viruses, have revolutionized this landscape. By reconstructing viral genomes in vitro and reproducing infectious particles, reverse genetics techniques have enabled systematic dissection of viral gene functions and their pathogenic networks. Infectious cloning vectors have been widely applied in numerous fields, including understanding viral gene function, pathogenicity, the use of expression vectors, virus-induced gene silencing (VIGS) for gene function verification, and cross-protection of attenuated strains. Infectious cDNA clones (icDNA) are infectious cDNAs or in vitro transcripts of cDNAs from RNA viruses that carry the complete viral genetic information. The first successful infectious clone was constructed for Brome mosaic virus (BMV), a plant RNA virus. At present, thanks to the continuous efforts of plant virologists, the efficient construction of infectious clones of various plant RNA viruses has been achieved, laying a technical foundation for the study of viral pathogenicity and disease resistance.

[0003] Earlier strategies for cloning infectious plant viruses were based on an in vitro transcription system using a prokaryotic promoter. The core process involved inserting the full-length viral genome sequence into a vector containing a prokaryotic promoter such as T3 / T7 / SP6. After linearizing the vector with restriction endonucleases, RNA polymerase was used to synthesize biologically active viral RNA in vitro. This technology has significant limitations: (1) Strict technical requirements: high-purity RNA products are required, and the operation is complex, requiring a high degree of reliance on the skills of the experimenter; (2) Stability: In vitro transcribed RNA is susceptible to RNase degradation, requiring strict temperature control and an enzyme-free environment; and (3) Cost constraints: reliance on expensive in vitro transcription kits and capping reagents.

[0004] Currently, the strategy for cloning infectious plant viruses is to construct the full-length plant virus cDNA downstream of the 35S promoter. The viral genome cDNA is inserted into a plant expression vector controlled by a eukaryotic promoter such as 35S, and then transferred into host cells through mechanical friction, Agrobacterium transformation injection, or gene gun bombardment to express complete virus particles with infectious activity. Compared with the in vitro transcription system, this technology has significant advantages: (1) Economy and ease of operation: no in vitro transcription kit and RNA purification steps are required, reducing experimental costs; (2) Improved transcription stability: transcription is completed by relying on the host cell's endogenous RNA polymerase, avoiding the risk of in vitro RNA degradation; (3) Structural optimization and innovation: the dual 35S promoter system enhances transcription efficiency and improves the success rate of virus rescue; (4) Ribozyme sequence with self-cleavage function: accurate generation of the 3' end of the viral genome is the key to efficient virus rescue.

[0005] Currently, the construction of infectious viral clones relies primarily on two strategies: seamless cloning (infusion) and double enzyme digestion. The double enzyme digestion method first requires homology analysis of the target gene and vector sequences to identify matching restriction sites for cleavage, generating complementary sticky or blunt ends. DNA ligase is then used to assemble the recombinant plasmid. A limitation of this method is that when the viral genome lacks naturally matching restriction sites, artificial modification of the vector or viral sequence (such as introduction of multiple cloning sites or segmented insertion) is required, significantly increasing the operational complexity. In contrast, seamless cloning technology overcomes the restriction of restriction sites by utilizing homologous recombination. Its core process involves designing 15-25 bp homology arms (which perfectly match the ends of the linearized vector) at both ends of the target fragment. The 3'→5' exonuclease activity of the infusion recombinase digests the ends of the linearized vector and insert fragment, forming complementary single-stranded DNA. Precise recombination is then achieved through the enzyme's inherent ligation activity. This technology does not require the introduction of additional restriction sites, and the recombinant plasmid construction can be completed in a single-step reaction, which significantly simplifies the experimental process. It is especially suitable for the efficient cloning of large viral genomes (such as multi-component viruses).

[0006] With the continuous advancement of molecular virology technologies, particularly in RNA viruses, methods and strategies for constructing infectious clones are becoming increasingly diverse. However, due to the significant variability of RNA viruses in terms of genome structure, replication mechanism, and host interaction patterns, researchers still face specific technical challenges when developing cloning systems for different viral systems. For example, full-length genomic cDNA clones or in vitro transcripts of Potyviruses often undergo unexpected recombination events during transformation into Escherichia coli. Studies have shown that such recombination may result from toxic proteins produced by viral genome expression in E. coli activating the host repair system, leading to aberrant recombination (such as spontaneous deletion or inversion of inserted sequences). This phenomenon not only reduces cloning fidelity but also may interfere with subsequent viral infectivity, highlighting the inherent limitations of prokaryotic expression systems for constructing complex RNA virus clones. In a related study, Zhao Guangyuan et al. cleverly utilized the yeast homologous recombination system to successfully construct an infectious clone of papaya ringspot virus (PRSV), opening up new avenues for research in this field.

[0007] There is no report in the prior art on the use of tobacco vein mottling virus (TVMV) infectious cloning vectors to carry exogenous fragments into plants. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a new method which can be applied to transfer exogenous fragments into plants.

[0009] The technical solution of the present invention is a method for transferring exogenous nucleic acid fragments into plants using plant viruses, comprising the following steps: fusing the exogenous nucleic acid fragments to the 3' non-coding RNA region of TVMVwt to obtain a fusion fragment, constructing the fusion fragment into an infectious cloning backbone vector, and transforming the plant.

[0010] Furthermore, the backbone vector is pLX. pLX was provided by Pasin F. For reference, see the article: Pasin F, Tseng XA, Bedoya LC, Heydarnejad J, Deng TC, García JA, et al. Streamlined generation of plant virus infectious clones using the pLX mini binary vectors. J Virol Methods. 2018;262:48–55. [PubMed: 30236898].

[0011] Specifically, the exogenous nucleic acid fragment is amiR-Su, PDS50, PDS100, CHLI100 or FR2.

[0012] Furthermore, the nucleotide sequence of the amiR-Su is shown in positions 161 to 249 of SEQ ID NO.1.

[0013] The nucleotide sequence of PDS50 is shown in positions 336 to 385 of SEQ ID NO.2.

[0014] Particularly, the nucleotide sequence of PDS100 is shown in positions 336 to 435 of SEQ ID NO.3.

[0015] The nucleotide sequence of CHLI100 is shown in positions 336 to 435 of SEQ ID NO.4.

[0016] Furthermore, the nucleotide sequence of FR2 is shown in positions 337 to 385 of SEQ ID NO.5.

[0017] Preferably, the plant is tobacco.

[0018] In particular, the conversion is to injection.

[0019] SEQ ID NO. 1, T-NbSu; 1-125 nt is TVMV CP, 126-160 nt is TVMV 3'UTR, 161-249 nt is amiR-Su, 250-466 nt is TVMV 3'UTR, 467-565 nt is pLX vector; Gcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactagtagagaagaatctgtataaccgtggtggacttcccgccgaaatcaaactgcgggaagtcaaccacggttacattggctcttcttactagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcccatttttatcatttctgatggtaaacattcaagtaagtttgcgcaataaatatatgtacttcctactattctatgattagattttcaacaaagcgaggagtacctccgttgtgatctagtcatcttatactgtcggagaaaaaaaaaaaaaaaaaaaaaaaaaatgcatgcctgcagatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcga。

[0020] SEQ ID NO.2, T-NbPDS50; 1 to 300 nt is TVMV CP, 301 to 335 nt is TVMV 3'UTR, 336 to 385 nt is PDS50, 386 to 464 nt is TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactgggtgcaaataccaattccaacatagactgattggggttgtaatattcctagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0021] SEQ ID NO.3, T-NbPDS100; 1 - 300 nt is TVMV CP, 301 - 335 nt is TVMV 3' UTR, 336 - 435 nt is PDS100, 436 - 514 nt is TVMV 3' UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactattgtagcatcaataatttctgagtcactacgatttatccactcttctgcgggtgcaaataccaattccaacatagactgattggggttgtaatattcctagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0022] SEQ ID NO.4, T-NbCHLI100; 1 - 300 nt is TVMV CP, 301 - 335 nt is TVMV 3'UTR, 336 - 435 nt is CHLI100, 436 - 514 nt is TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactctctcagctctgcatctctcacggtccccacttgggcatgcattccaaatcgatcaagaagttgtggcctaagttctccttcttcaggattacccgaaccagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0023] SEQ ID NO.5, T-FR2; 1 to 300 nt is TVMV CP, 301 to 336 nt is TVMV 3'UTR, 337 to 385 nt is FR2, 386 to 465 nt is TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaa tggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaa cacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatactggagacggtcgggt ccagatattcgtatctgtcgagtagagtgtgggctccagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc.

[0024] Beneficial Effects of the Invention: Disclosed herein is an infectious cloning vector constructed by inserting an exogenous coding sequence into the 3' non-coding RNA region (nt 10440-10441 or nt 10441-10442) of TVMVwt. Transplantation of this vector into plants does not inactivate the TVMV virus and successfully expresses the exogenous nucleic acid fragment. This infectious cloning vector utilizes the TVMV virus to express the exogenous nucleic acid fragment in plants, even throughout the entire plant. This increases the expression level of the exogenous nucleic acid fragment, shortens the expression cycle, and eliminates the need for transgenic technology. This invention demonstrates that exogenous nucleic acid fragments can be integrated and expressed in plants using viral vectors. The invention provides a novel method for transfecting exogenous fragments into plants. Specifically, the present invention uses an infectious clone of the TVMV virus to express FR2 in plants. Using a LUYOP-3104 Hand-Held UVLamp instrument, when irradiated with a light source of 472-507 nm, the TVMVFR2 virus particles exhibit distinct green fluorescence, enabling the detection of plant viruses by fluorescence. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1. Schematic diagram of a one-step assembly cloning strategy for constructing nucleic acid sequences into infectious clones of tobacco vein mottle virus. Using the pLX-TVMV (TVMVwt) infectious clone as a template, two cDNA fragments spanning the TVMV genome and the pLX backbone, including the insert, were assembled. The PCR primers used are indicated (orange and green arrows).

[0026] Figure 2 , Amplification and verification diagram of the insertion sequence of TVMVwt's 3' non-coding RNA; A. TVMV viral genome structure; B. Insertion sequences, TVMVSu, TVMVPDS50, TVMVPDS100, TVMVCHLI100 and TVMVFR2.

[0027] Figure 3 , construction of amplification verification diagram of TVMVSu infectious clone; A. Amplification of T-NbSu-1 target fragment; B. Amplification of TVMVSu vector background fragment; C. TVMVSu bacterial liquid PCR; D. TVMVSu sequencing results.

[0028] Figure 4 , construction of amplification verification diagrams of infectious clones of TVMVPDS50, TVMVPDS100 and TVMVCHLI100; A. Amplification of target fragments of TVMVPDS50, TVMVPDS100 and TVMVCHLI100; B. Amplification of background fragments of TVMVPDS50, TVMVPDS100 and TVMVCHLI100 vectors; C. PCR of TVMVPDS50 bacterial solution; D. PCR of TVMVPDS100 bacterial solution; E. PCR of TVMVCHLI100 bacterial solution.

[0029] Figure 5 , constructed sequencing maps of the infectious clones of TVMVPDS50, TVMVPDS100, and TVMVCHLI100; A. TVMVPDS50 sequencing results; B. TVMVPDS100 sequencing results; C. TVMVCHLI100 sequencing results.

[0030] Figure 6Detection of symptoms and viral accumulation of mutant virus clones; A. Infectious symptoms of TVMVwt, TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 9 days after inoculation; B. Western blot analysis of viral accumulation 9 days after inoculation; C. Infectious symptoms of TVMVwt, TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 30 days after inoculation; D. Western blot analysis of viral accumulation 30 days after inoculation. The antibody used was anti-TVMV CP, and the internal control was a Rubisco protein band. Numbers indicate quantification of band signals.

[0031] Figure 7 , RT-PCR results of infectious clones of TVMVSu, TVMVPDS50, TVMVPDS100 and TVMVCHLI100 9 days after injection in plants; A. RT-PCR amplified fragment of TVMVSu; B. RT-PCR amplified fragments of TVMVPDS50, TVMVPDS100 and TVMVCHLI100.

[0032] Figure 8 , construction of TVMVFR2 infectious clone verification diagram; A. Amplification of TVMVFR2 insert fragment; B. Amplification of TVMV vector background fragment; C. TVMVFR2 bacterial liquid PCR; D. TVMVFR2 sequencing peak diagram.

[0033] Figure 9 Detection of symptoms and viral accumulation of TVMVFR2 infectious clones; A. Infectious symptoms of TVMVwt and TVMVFR2 9 days after inoculation; B. Western blot analysis of viral accumulation; C. Infectious symptoms of TVMVwt and TVMVFR2 30 days after inoculation; D. Western blot analysis of viral accumulation 30 days after inoculation. The antibody used was anti-CP, and the internal control was a Rubisco protein band.

[0034] Figure 10 , Detection diagram of TVMVFR2 binding to the fluorescent dye DFHBI-1T; A. TVMVwt and TVMVFR2 virus particles bound to the fluorescent dye DFHBI-1T and imaged under a fluorescence stereoscope; B. Quantification of fluorescence signal intensity.

[0035] Figure 11 , Sequencing results of the RT-PCR amplified fragment of TVMVSu.

[0036] Figure 12 , Sequencing results of the RT-PCR amplified fragment of TVMVPDS50.

[0037] Figure 13 , E. Sequencing results of the RT-PCR amplified fragment of TVMVPDS100.

[0038] Figure 14 , Sequencing results of the RT-PCR amplified fragment of TVMVCHLI100. DETAILED DESCRIPTION

[0039] Generally, inserting exogenous nucleic acid fragments into the 3' UTR presents numerous challenges. For example, inserting an exogenous nucleic acid fragment may inactivate the virus, and the size of the inserted fragment can significantly impact the virus, interfering with the structural integrity of the viral genome, functional elements, and key steps in its life cycle (e.g., replication, packaging, and assembly). However, while the present invention does have some impact on viral infectivity, it does not inactivate the virus, and the exogenous nucleic acid fragment can still be successfully expressed. Therefore, the applicant attempted to construct an infectious cloning vector by inserting an exogenous nucleic acid fragment into the 3' UTR of the TVMV virus.

[0040] The present invention selected amiR-Su, PDS50, PDS100, CHLI, and FR2 as exogenous fragments to construct infectious clones. The exogenous nucleic acid fragments were inserted into the 10440-10441 nt or 10441-10442 nt 3' noncoding region of the TVMV virus to construct a plant-infectious cloning vector. Transformation of the plant did not result in inactivation of the TVMV virus, and the exogenous nucleic acid fragments were successfully expressed. This invention successfully demonstrated that the TVMV virus-infectious cloning vector can be used to carry exogenous nucleic acid fragments (amiR-Su, PDS50, PDS100, CHLI, and FR2) into plants and achieve successful expression.

[0041] The amiR-Su sequence is available in Appendix S3 of the supplementary figure data in the article (doi: 10.1093 / nar / gkad747). This sequence is a partial sequence from Nicotiana benthamiana. This sequence was selected because microRNAs are widely used in plants, but their production is limited by the transgenic expression of primary miRNA (pri-miRNA) precursors. To overcome this limitation, Cisneros et al. analyzed AtMIR390a-pri-miRNA in Arabidopsis thaliana and screened a large number of endogenous amiRNAs in Nicotiana benthamiana. They found that a chimeric precursor as small as 89 nt could produce the efficiently and precisely processed amiR-Su (89 bp). Silencing the amiR-Su resulted in albinism in Nicotiana benthamiana.

[0042] The PDS (full name: phytoene dehydrogenase gene) sequence is sourced from GenBank: AY484445.1, and the species is potato. PDS50 and PDS100 are partial sequences of the phytoene dehydrogenase gene. This sequence was selected because silencing the PDS gene produces a photobleaching phenotype and is therefore often used as a reference gene in virus-induced gene silencing systems.

[0043] The CHLI (full name: magnesium ion chelatase) sequence is sourced from NCBI Reference Sequence: XM_016604918.1, and the species is Nicotiana tabacum. CHLI100 is a partial sequence of magnesium ion chelatase. This sequence was selected because silencing the CHLI gene can lead to the obstruction of chlorophyll synthesis in plants, resulting in an albinism phenotype.

[0044] The FR2 sequence, sourced from GenBank: PV759412.1, is a synthetically constructed and cloned broccoli fluorescent aptamer. This sequence was chosen because it is an RNA fluorescent aptamer with a small molecular weight, stable structure, high fluorescence signal-to-noise ratio, and stable expression in cells. The DFHBI dye emits green fluorescence when bound to the aptamer FR2.

[0045] In the present invention, when the nucleotide sequences of SEQ ID NO. 1 to 5 involve synthesis, they were synthesized by Boshang Biotechnology (Shanghai) Co., Ltd. In order to further illustrate the technical means and effects adopted by the present invention to achieve the intended purpose of the invention, the following is a detailed description of the specific embodiments, structures, features and effects of the present invention in conjunction with the accompanying drawings and preferred embodiments.

[0046] The main reagents used in the following examples are as follows: Potassium chloride, calcium chloride (CaCl2·2H2O), glycerol, methanol, sodium chloride, isopropanol, n-butanol, chloroform, and hydrochloric acid were domestically produced analytical grade; 2× Phanta Flash Master Mix (Dye Plus) (Cat. No. P520) and Loading Buffer (Cat. No. P022-01-AA) were purchased from Novozymes; DNA agarose gel purification kit (Cat. No. PEG00-01) and Trizol (Cat. No. NG303M) were purchased from Welling; TaKaRa LA Taq® (Cat. No. RR002A) and DH5α competent cells (Cat. No. 9057) were purchased from TaKaRa; DFHBI-1T (Cat. No. 1539318-36-9) was purchased from Andy Biotechnology; Agarose (Cat. No. AG0100) and nucleic acid dye (Cat. No. GD001) were purchased from Aiwei Lebo Biotechnology; Tris (hydroxymethylaminomethane) (Product No. CT11411), dithiothreitol (DTT) (Product No. CD4941), sodium dodecyl sulfate (SDS) (Product No. CS9701), kanamycin (Kan) (Product No. CK6731), PEG6000 (Product No. CP311234100), dimethyl sulfoxide (DMSO) (Product No. 4731), tetramethylethylenediamine (TEMED) (Product No. CT10881), tryptone (Product No. CT34152510), Tween-20 (Tween-20) (Product No. C111551), and yeast extract powder (Product No. CY321217100) were purchased from Coollife. The protein marker (catalog number 180-6006) was purchased from Tianneng; Bromophenol blue (Cat. No. 115-39-9) was purchased from Thermo Fisher Scientific; Skim milk powder (Product No. 17757), disodium hydrogen phosphate (Na2HPO4) (Product No. S818118), and sodium dihydrogen phosphate (NaH2PO4) (Product No. S817780) were purchased from Maclean; TAE (catalog number T1060) and rifampicin (Rif) (catalog number R8011) were purchased from Solebol; The 1kb plus DNA Ladder (Cat. No. L1000P) was purchased from Lab; The color development solution (Cat. No. 10026384), PVDF membrane (Cat. No. 1620177), and 12% stain-free gel preparation kit (Cat. No. 1610185) were purchased from Bio-Rad. B610003 (product number G218KA4639) was purchased from Shenggong; The plasmid miniprep kit (Cat. No. A0229A) was purchased from Tiangen; β-Mercaptoethanol (Product No. MB0338) was purchased from BIO BASIC INC; Ammonium persulfate (APS) (Product No. 248614) was purchased from Sigma; Goat Anti-Rabbit IgG H&L (HRP) (Cat. No. AB205718) was purchased from Abcam; Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (Cat. No. AG11615) was purchased from X-Ray. Anti-TVMV CP antibody and C58C1 competent cells (catalog number: Spain, Juan Antonio Garcia's lab) were purchased from the National Center for Biotechnology, Spain.

[0047] Example 1 Construction of infectious cloning vector Based on cloning requirements, the insert gene sequence fragment was synthesized and inserted into a T-vector to obtain a plasmid vector. The insert fragment was amplified using the plasmid DNA sequence as a template. The vector background fragment was amplified using the wild-type pLX-TVMVwt viral infectious clone as a template. The two fragments were homologously recombined and connected using a one-step Gibson assembly enzyme to obtain a variant infectious clone ( Figure 1 The wild-type pLX-TVMVwt viral infectious clone uses pLX as a backbone vector and carries the wild-type TVMV virus. The infectious cloning vector carrying an exogenous nucleic acid fragment of the present invention also uses pLX as a backbone vector, with the exogenous nucleic acid fragment fused only to the 3' non-coding region of the wild-type TVMV virus.

[0048] According to the TVMVwt genome structure ( Figure 2 A), and then, based on the reported molecules or genes related to plant leaf albinism, the sequences of amiR-Su (89 bp), PDS (50 bp, 100 bp), CHLI (100 bp), and FR2 (49 bp) were inserted into the 3' non-coding region of TVMVwt ( Figure 2 B) Constructed and obtained viral infectious clones, namely TVMVSu, TVMVPDS50, TVMVPDS100, TVMVCHLI100 and TVMV FR2.

[0049] (1) Obtaining the target fragment of the TVMVSu infectious clone mutant Primers Nbsu-F / Nbsu-R were designed based on the T-NbSu plasmid DNA sequence (primers synthesized by Shanghai Shenggong Biotechnology Co., Ltd., see Table 1) to amplify a 565 bp insert, designated T-NbSu-1. PCR amplification was performed using TaKaRa LA Taq®. The PCR reaction system consisted of 0.5 μL of template (T-NbSu plasmid, SEQ ID NO. 1), 0.5 μL of 5 U / μL TaKaRa LA Taq, and 10× LA Taq Buffer II MgSO4. 2+Add 5 μL of 2.5 mM dNTPMixture 8 μL, 2 μL of Nbsu-F, 2 μL of Nbsu-R, and make up to 50 μL with ddH2O. The reaction procedure was: initial denaturation at 94°C for 30 s; denaturation at 98°C for 10 s; annealing at 60°C for 65 s for 30 cycles; and extension at 72°C for 10 min. The PCR product (565 bp T-NbSu-1, SEQ ID NO. 1) was stored at 12°C.

[0050] Primers TVMV-Su-F and TVMV-Su-R (Table 1) were designed based on the wild-type pLX-TVMVwt viral infectious clone (Zhao M, García B, Gallo A, et al. Home-made enzymatic premix and Illumina sequencing allow for one-step Gibson assembly and verification of virus infectious clones [J]. Phytopathol Res, 2020, 2:36). The vector background fragment (13184 bp) was amplified and designated TVMVSu-1. Using Novizan 2× Phanta Flash Master Mix (DyePlus), the PCR reaction system was as follows: 0.5 μL template (pLXB-TVMVwt plasmid), 25 μL 2× Phanta Flash Master Mix, 2 μL TVMV-Su-F, 2 μL TVMV-Su-R, and ddH2O to 50 μL. The PCR amplification program was as follows: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 60°C for 10 s; extension at 72°C for 2 min 10 s, 30 cycles; and final extension at 72°C for 1 min. The PCR product, TVMVSu-1, was stored at 12°C.

[0051] After separation by 1% agarose gel electrophoresis, a specific fragment of 565 bp was obtained. Figure 3 A) and a specific fragment of 13184 bp ( Figure 3B). The insert fragment T-NbSu-1 and the vector background fragment TVMVSu-1 were ligated using a 15 μL ligation system consisting of 5 μL of homemade enzyme, 8 μL of vector background fragment, and 2 μL of insert fragment. The reaction was performed at 50°C for 1 hour. The ligation product was transformed into E. coli DH5α competent cells and identified by PCR using primers Nbsu-F / Nbsu-R. A specific fragment of 565 bp was obtained ( Figure 3 C), after correct sequencing, plasmid was extracted to obtain the correct TVMVSu infectious clone ( Figure 3 D).

[0052] (2) Obtaining target fragments of TVMVPDS50, TVMVPDS100 and TVMVCHLI100 infectious clone mutants Primers PDS / CHLI-F / PDS / CHLI-R ( Table 1 ) were designed based on the DNA sequences of T-NbPDS50, T-NbPDS100, and T-NbCHLI100 plasmids (i.e., SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4) to amplify inserts of 464 bp (T-NbPDS50) and 514 bp (T-NbPDS100 and T-NbCHLI100) ( Figure 4 A) The inserts were named PDS50, PDS100, and CHLI100. PCR amplification was performed using TaKaRa LA Taq®. PCR reaction system: template (T-NbPDS50, T-NbPDS100, and T-NbCHLI100 plasmids) 0.5 μL, TaKaRa LA Taq 5 U / μL 0.5 μL, 10× LA TaqBuffer II MgCl2 (pH 7.0). 2+ Add 5 μL, 8 μL of each 2.5 mM dNTP Mixture, 2 μL of PDS / CHLI-F, 2 μL of PDS / CHLI-R, and make up to 50 μL with ddH2O. PCR amplification program: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 50°C for 10 s; extension at 72°C for 2 min 10 s, 30 cycles; and complete extension at 72°C for 1 min. PCR products were stored at 12°C.

[0053] Primers TVMV-CHLI PDS-F / TVMV-CHLIPDS-R were designed based on the wild-type pLX-TVMVwt virus infectious clone to amplify the vector background fragment (13247 bp, Figure 4B) The vector background fragment was designated TVMV-. PCR was performed using Novizan 2× Phanta Flash Master Mix (DyePlus). The reaction system consisted of 0.5 μL of template (pLXB-TVMVwt plasmid), 25 μL of 2× Phanta Flash Master Mix, 2 μL of TVMV-CHLI PDS-F, 2 μL of TVMV-CHLI PDS-R, and ddH2O to 50 μL. The PCR amplification program was as follows: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 55°C for 10 s; extension at 72°C for 2 min 10 s, 30 cycles; and complete extension at 72°C for 1 min. The PCR product, TVMV-, was stored at 12°C.

[0054] The insert fragments PDS50, PDS100, and CHLI100 were ligated to the vector background fragment TVMV- using one-step Gibson assembly enzyme. The three ligation products were transformed into Escherichia coli DH5α competent cells and identified by PCR using primers 2F / 2R. Specific bands of 960 bp and 1010 bp were obtained for TVMVPDS50 and TVMVPDS100 ( Figure 4 C, Figure 4 D) The TVMVCHLI100 bacterial culture was amplified using primers PDS / CHLI-F / PDS / CHLI-R to obtain a 514 bp band ( Figure 4 E). Sequencing verification results after plasmid extraction showed that TVMVPDS50, TVMVPDS100 and TVMVCHLI100 were successfully connected, and correct TVMVPDS50, TVMVPDS100 and TVMVCHLI100 infectious clones were obtained ( Figure 5 A, Figure 5 B, Figure 5 C).

[0055] (3) Obtaining the target fragment of the TVMVFR2 infectious clone mutant Using PDS / CHLI-F / PDS / CHLI-R as primers and T-FR2 plasmid (SEQ ID NO.5) as template, a specific fragment of FR2 (465 bp) was amplified ( Figure 8 A). PCR amplification was performed using TaKaRa LA Taq®. PCR reaction system: template (T-FR2 plasmid) 0.5 μL, TaKaRa LA Taq 5 U / μL 0.5 μL, 10× LA Taq Buffer II MgCl2 2+Add 5 μL, 8 μL of each 2.5 mM dNTP Mixture, 2 μL of PDS / CHLI-F, 2 μL of PDS / CHLI-R, and make up to 50 μL with ddH2O. PCR amplification program: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 50°C for 10 s; extension at 72°C for 2 min 10 s, 30 cycles; and complete extension at 72°C for 1 min. Store PCR products at 12°C.

[0056] Using TVMV-CHLI PDS-F / TVMV-CHLI PDS-R as primers and pLX-TVMwt plasmid as template, a vector fragment of 13253 bp was obtained by PCR amplification ( Figure 8 B) PCR was performed using Novizan 2× Phanta Flash Master Mix (DyePlus). The reaction system consisted of 0.5 μL of template (pLX-TVMwt plasmid), 25 μL of 2× Phanta Flash Master Mix, 2 μL of TVMV-CHLI PDS-F, 2 μL of TVMV-CHLI PDS-R, and ddH2O to 50 μL. The PCR amplification program was as follows: initial denaturation at 98°C for 30 s; denaturation at 98°C for 10 s; annealing at 55°C for 10 s; extension at 72°C for 2 min 10 s, 30 cycles; and complete extension at 72°C for 1 min. PCR products were stored at 12°C.

[0057] One-step Gibson assembly enzyme was used to connect FR2 to the vector fragment, and the ligation product was transformed into Escherichia coli DH5α competent cells. Primers PDS / CHLI-F / PDS / CHLI-R were used for bacterial liquid PCR identification. A specific band of 465 bp was obtained for TVMVFR2 ( Figure 8 C) After plasmid extraction, sequencing verification results showed that TVMVFR2 was successfully connected and the correct TVMVFR2 infectious clone was obtained ( Figure 8 D).

[0058] Table 1 Primer sequences .

[0059] Example 2 Transformation of Invasive Clones The infectious clone plasmids of TVMVwt (i.e., pLX-TVMVwt in Example 1), TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 were transformed into Agrobacterium C58C1 competent cells. Figure 6Observe the virus infection symptoms after 9 days.

[0060] (1) Observation of infection symptoms After the leaves of Nicotiana benthamiana were inoculated with the infectious clone, the symptoms and disease progression were observed 9 days after the injection. The systemically infected leaves of Nicotiana benthamiana were collected and stored in a -80℃ refrigerator for future use.

[0061] (2) Extraction of crude viral protein Approximately 0.2 g of diseased leaf tissue was frozen in liquid nitrogen, ground into a powder, and 2 volumes of 5% SDS solution were added. The mixture was vortexed and mixed until a homogenous slurry was obtained. The mixture was then incubated in a boiling water bath at 95°C for 5 minutes and centrifuged at 12,000 rpm at 4°C for 10 minutes. The supernatant was mixed with 2× protein lysis buffer at a 1:1 ratio. The mixture was reheated in a boiling water bath at 95°C for 5 minutes, centrifuged at 12,000 rpm at 4°C for 10 minutes, and stored at -20°C until further use.

[0062] (3) Western blot detection a. Gel Preparation: First, prepare the lower layer of separating gel. Add 500 μL of isopropanol or water. After 20 minutes, allow the separating gel to solidify. Then, tilt and pour out the isopropanol or water. Let it stand at room temperature for 3 minutes. Then, prepare the upper layer of stacking gel. Insert a comb into the gel and let it stand for 1 hour. Remove the comb and set aside. b. Electrophoresis: Place the prepared gel into the electrophoresis apparatus, add 1× SDS-PAGE running buffer, and load 5 μL of protein sample and 2 μL of protein marker. Set the voltage of the stacking gel to 90 V and the separating gel to 120 V. Stop the electrophoresis when the bromophenol blue band moves to the bottom of the gel. c. Imaging: Observe the protein electrophoresis results using a gel imaging system and take photos for storage; d. Transfer (wet transfer): Mark the polyvinylidene fluoride (PVDF) membrane and activate it with methanol for 20 seconds. Transfer the membrane to transfer buffer and set aside. Soak the filter paper and sponge in transfer buffer. After prying the glass plate to remove the protein gel, cut off the top layer of concentrated gel and clamp the membrane in the order of "membrane positive, gel negative" (negative electrode - sponge - filter paper - protein gel - PVDF membrane - filter paper - sponge - positive electrode). Insert the membrane into the transfer core and place it in the transfer apparatus. Pour 1× SDS-PAGE transfer buffer, cool the outer tank with ice packs, set the voltage to 60 V, and stop the transfer after 1 hour. e. Blocking: Place the membrane in 5% blocking buffer and place on a decolorizing shaker at 70 rpm at room temperature for 2-3 hours. After blocking, wash the membrane 2-3 times in 1× TBST solution to remove excess skim milk powder. f. Primary Antibody Incubation: Incubate the membrane in primary antibody diluted in 1× TBST (TVMV CP primary antibody dilution ratio 1:100,000, PVY CP primary antibody dilution ratio 1:5000) and incubate overnight at 4°C or at room temperature for 1 hour. Remove the membrane and place it in 1× TBST solution on a destaining shaker at 70 rpm. Wash three times for 10 minutes each. g. Secondary antibody incubation: Place the membrane in goat anti-rabbit secondary antibody (1:2000) on a decolorizing shaker at room temperature for 1 hour. After the secondary antibody incubation is complete, remove the membrane and wash it three times in 1× TBST solution for 10 minutes each. h. ECL Development: According to the instructions, mix developer solutions A and B in a 1:1 ratio. Use a pipette to evenly add the mixed developer solution onto the PVDF membrane, spreading the developer solution evenly over the membrane. Place the membrane on an imaging system to acquire images for quantitative analysis.

[0063] (4) Extraction of total RNA from Nicotiana benthamiana a. Grind fresh Nicotiana benthamiana leaves thoroughly in liquid nitrogen. Add 0.1 g of the powder to a pre-chilled centrifuge tube and quickly add 1 mL of TRNzol reagent. b. After thorough vortex mixing, the homogenate was allowed to stand at room temperature for 5 minutes, and then centrifuged at 12,000 rpm for 10 minutes at 4°C. The supernatant was collected. c. Add 0.2 mL of chloroform to the supernatant, shake vigorously for 20 seconds, let stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C. d. Transfer the upper aqueous phase (approximately 400 μL) to a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and incubate at room temperature for 10 minutes. e. Centrifuge at 12,000 rpm for 10 min at 4°C. Carefully discard the supernatant and wash the pellet with 1 mL of 75% ethanol prepared with RNase-free ddH2O. f. Centrifuge at 7500 rpm for 5 min at 4°C and discard the supernatant. g. Incubate at room temperature for 5 minutes. Add 50–100 μL of RNase-free water and gently swirl the tube to fully dissolve the RNA. Measure RNA concentration and purity using a NanoDrop analyzer. Store in a -80°C freezer.

[0064] (5) Reverse transcription is performed using RNA as a template to synthesize cDNA.

[0065] After removing gDNA, the reaction system was 20 μL (Table 2, Table 3). First, prepare Mix 1 (Table 2) at 42°C for 2 min; then prepare Mix 2 (Table 3) at 37°C for 15 min; 85°C for 5 s; and store at 4°C.

[0066] Table 2 Components of cDNA synthesis system Mix 1 required for PCR .

[0067] Table 3 Components of cDNA synthesis system Mix 2 required for PCR .

[0068] (6) Virus particle purification method a. Collect leaves with obvious disease, remove the veins and weigh 100 g, freeze with liquid nitrogen, and grind thoroughly into powder; b. Add 4°C pre-cooled 0.2 M pH 7.2 phosphate buffer containing 1% β-mercaptoethanol at a weight: volume ratio of 1:2; c. Filter through four layers of sterile gauze, retaining the supernatant to obtain the initial extract. Add a 10% chloroform:n-butanol mixture (1:1) to the supernatant while stirring. Continue stirring at 4°C for 15 minutes. Centrifuge at 4°C, 10,000 rpm, for 20 minutes. d. Remove the supernatant and add 4% NaCl and 4% polyethylene glycol (PEG 6000) to the supernatant while stirring at 4°C. Continue stirring at 4°C for 1.5 h. Centrifuge at 4°C, 10,000 rpm, for 15 min. e. Retain the precipitate and add 0.01 M phosphate buffer (pH 7.2). Continue stirring on ice for 1 h. Centrifuge at 10,000 rpm for 20 min at 4°C. f. Repeat step d. g. Retain the precipitate and resuspend it in 0.01 M phosphate buffer (pH 7.2). Centrifuge at 8000 rpm for 5 min at 4°C. h. Take the supernatant to obtain the desired virus particles.

[0069] (7) DFHBI-1T dye binding method DFHBI-1T was prepared in DMSO to a 20 mM stock solution. A working concentration of 200 μM dye stock solution was then prepared using the following formula: 400 μL of 5× fluorescence buffer, 20 μL of the 20 mM dye stock solution, and 1580 μL of ultrapure water. The RNA aptamer-virion binding mixture was prepared using the following formula: 2 μL of 5× fluorescence buffer, 5 μL of 1 μg / μL viral particles, 10 μL of the 200 μM dye stock solution, and 3 μL of ultrapure water. The 5× fluorescence buffer solution consisted of 4 mL of 0.5 M HEPES (pH 7.4), 1.25 mL of 4 M KCl, 0.05 mL of 1 M MgCl₂, 1.25 mL of 12.5% ​​DMSO, and water to a final volume of 10 mL.

[0070] The results showed that 9 days after injection, the leaves of plants inoculated with mutant viruses TVMVSu, TVMVPDS100 and TVMVCHLI100 showed less wrinkling than those of plants infected with TVMVwt, and the disease severity of plants inoculated with mutant virus TVMVPDS50 was the same as that of plants infected with TVMVwt ( Figure 6 A). Western blot analysis was performed on leaves from the upper system to detect viral accumulation. The results showed that the amount of virus accumulated in plants infected with TVMVwt and TVMVPDS50 was consistent; compared with plants infected with TVMVwt, the amount of virus accumulated in plants infected with TVMVSu was slightly lower, the amount of virus accumulated in plants infected with TVMVPDS100 was significantly reduced, and no virus accumulation was detected in plants infected with TVMVCHLI100 ( Figure 6 B). After the plants continued to grow for 30 days, the virus infection symptoms were observed and it was found that the plants infected with TVMVPDS100 and TVMVCHLI100 showed obvious dwarfing ( Figure 6 C). Similarly, western blot was used to detect virus accumulation. Compared with the virus accumulation in TVMVwt-infected plants, the virus accumulation in TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100-infected plants decreased, and a small amount of virus accumulation was also detected in TVMVCHLI100 ( Figure 6 D). RT-PCR was performed on the plants grown for 30 days after injection, and fragments of the exogenous gene were detected ( Figure 7 A and 7B), the fragments obtained by RT-PCR were further sequenced and verified by Sanger sequencing ( Figures 11-14 ), all confirming the presence of the fragment. After transient expression in Nicotiana benthamiana, the above virally infectious clones were found to infect Nicotiana benthamiana, demonstrating that the 3' non-coding RNA of TVMVwt can be inserted into exogenous genes and transfer exogenous nucleic acid fragments into plants.

[0071] The plasmids for TVMVwt and TVMVFR2 infectious clones were transformed into Agrobacterium C58C1 competent cells. Using an Agrobacterium-mediated transient expression system, the Agrobacterium culture of TVMVwt and TVMVFR2 infectious clones was adjusted to an OD600 of 0.6 and injected into Nicotiana benthamiana plants. Plants inoculated with TVMVwt and healthy Nicotiana benthamiana served as controls. Symptoms were observed 9 days after injection. The results showed that compared with plants infected with TVMVwt, plants inoculated with the mutant virus TVMVFR2 exhibited less leaf wrinkling ( Figure 9 A). Western blot analysis was performed on leaves from the upper system to detect viral accumulation. The results showed that compared with plants inoculated with TVMVwt, the protein accumulation in plants inoculated with TVMVFR2 was reduced ( Figure 9 B). After the plants continued to grow for 30 days, the symptoms of virus infection were observed. It was found that the plants infected with TVMVFR2 were higher than those inoculated with TVMVwt, and there was no difference in symptoms ( Figure 9 C). Western blot analysis of virus accumulation showed that the virus accumulation in plants infected with TVMVwt and TVMVFR2 was similar ( Figure 9 D).

[0072] Furthermore, fluorescence observation was performed on TVMVFR2-infected plants. After the TVMVFR2-injected plants were grown for 30 days, the upper systemic leaves were collected to extract virus particles. When the DFHBI-1T dye required for FR2 small RNA was used for binding, the results showed that the TVMVFR2 virus particles emitted obvious green fluorescence after irradiation with 472nm excitation light ( Figure 10 A). The fluorescence quantification results were consistent with the fluorescence results ( Figure 10 B).

[0073] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents disclosed above. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A method for transferring exogenous nucleic acid fragments into plants using plant viruses, comprising the following steps: fusing the exogenous nucleic acid fragment to the 3' non-coding RNA region of TVMVwt to obtain a fusion fragment, constructing the fusion fragment into an infectious cloning backbone vector, and transforming the plant.

2. The method according to claim 1, wherein: The backbone vector is pLX.

3. The method according to claim 1, wherein: The exogenous nucleic acid fragment is amiR-Su, PDS50, PDS100, CHLI100 or FR2.

4. The method according to claim 3, wherein: The nucleotide sequence of the amiR-Su is shown in positions 161 to 249 of SEQ ID NO.

1.

5. The method according to claim 3, wherein: The nucleotide sequence of PDS50 is shown in positions 336 to 385 of SEQ ID NO.

2.

6. The method according to claim 3, wherein: The nucleotide sequence of PDS100 is shown in positions 336 to 435 of SEQ ID NO.

3.

7. The method according to claim 3, characterized in that: The nucleotide sequence of CHLI100 is shown in positions 336 to 435 of SEQ ID NO.

4.

8. The method according to claim 3, wherein: The nucleotide sequence of FR2 is shown in positions 337 to 385 of SEQ ID NO.

5.

9. The method according to claim 1, wherein: The plant is tobacco.

10. The method according to claim 1, wherein: The conversion was performed for injection.

Images