New application of mir-210a-5p and target gene thereof

Abstract

The invention relates to the technical field of poultry breeding, and particularly provides mir-210a-5p and new application of a target gene thereof. The molecular marker is miR-210a-5p and / or a target gene RASL11B of the miR-210a-5p, and the molecular marker is a target gene RASL11B of the miR-210a-5p. According to the invention, laying hens are used as poultry representatives, miRNA sequencing analysis is carried out on uterus of laying hens with different day ages, and a potential factor miR-210a-5p for inhibiting aging of chicken uterine epithelial cells is explored. Experiments prove that the miR-210a-5p can inhibit the senescence of the uterine epithelial cells and relieve the senescence secretion phenotype of the uterine epithelial cells. The target gene of the gene is further explored to be RASL11B, and the research finds that the expression of the RASL11B gene in senescent uterine tissues is obviously increased, the RASL11B gene has the functions of promoting cell senescence and inflammatory response, and senescence phenotypes can be obviously improved by interfering the expression of the RASL11B gene.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry breeding, and in particular to new applications of mir-210a-5p and its target gene. Background Art

[0002] With the development of the poultry industry, extending the peak egg-laying period, improving egg quality, and increasing the healthy lifespan of laying hens have become critical issues that need to be addressed. Studies have shown that tissue and organ aging, particularly the decline in the function of the oviduct and uterus, is one of the key factors limiting egg production and eggshell quality. Cellular senescence plays a central regulatory role in this process, involving multiple molecular signaling pathways and post-transcriptional regulatory mechanisms. In recent years, microRNAs (miRNAs), a class of small noncoding RNAs, have garnered extensive attention in the regulation of aging. MiRNAs bind to the 3′ untranslated region (3′UTR) of target mRNAs, inhibiting their translation or promoting their degradation, thereby regulating the expression of downstream genes and participating in aging-related biological processes such as the cell cycle, DNA repair, oxidative stress responses, and the expression of inflammatory factors. Studies have shown that several miRNAs are closely associated with cellular senescence. For example, miR-34a, miR-146a, and miR-29 have all been shown to influence cell fate decisions by targeting key aging regulators such as SIRT1 and CCNA2, thereby modulating the p53 or NF-κB pathways. However, research on the screening, functional verification and downstream target gene mechanisms of miRNAs related to uterine aging in laying hens is still very limited. Summary of the Invention

[0003] Building on existing miRNA research, this study further focuses on the role of miRNA in chicken uterine tissue aging. Using a transcriptome sequencing system, miR-210a-5p was identified as significantly downregulated in the late egg-laying period. Furthermore, miR-210a-5p was validated for its ability to influence cellular aging phenotypes and inflammatory states by targeted regulation of specific gene expression in uterine epithelial cells. This in-depth understanding of the biological functions and molecular targets of miR-210a-5p and its target genes will provide new theoretical foundations and technical support for the analysis of poultry tissue aging mechanisms and the development of intervention strategies. Therefore, this study provides novel applications for miR-210a-5p and its target genes.

[0004] In order to achieve the above object, the technical solution of the present invention is: In a first aspect, the present invention provides an application of a molecular marker in the preparation of a poultry tissue aging assessment product, wherein the molecular marker is miR-210a-5p and / or the target gene RASL11B of miR-210a-5p.

[0005] Preferably, the product further comprises a reagent for detecting the expression level of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues.

[0006] Further preferably, the qPCR method is used to detect the expression level of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues; wherein the primers used to detect miR-210a-5p have the sequence shown in SEQ ID NO.3; and / or, the primers used to detect the target gene RASL11B of miR-210a-5p have the sequences shown in SEQ ID NO.26 and SEQID NO.27.

[0007] In a second aspect, the present invention provides primers for detecting the expression level of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues, the primers for detecting miR-210a-5p have the sequence shown as SEQ ID NO. 3; and / or, the primers for detecting the target gene RASL11B of miR-210a-5p have the sequences shown as SEQ ID NO. 26 and SEQ ID NO. 27.

[0008] In a third aspect, the present invention provides the use of a reagent for enhancing or promoting miR-210a-5p expression or a reagent for reducing miR-210a-5p adsorption in the preparation of anti-aging products for poultry tissues, wherein the reagent is miR-210a-5p mimics, and the miR-210a-5p mimics has a sequence as shown in SEQ ID NO.4.

[0009] In a fourth aspect, the present invention provides the use of an agent that reduces or inhibits RASL11B gene expression or an agent that promotes RASL11B adsorption in the preparation of anti-aging products for poultry tissues, wherein the agent is si-RASL11B-1, si-RASL11B-2 or si-RASL11B-3; wherein, si-RASL11B-1 has the sequence shown as SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has the sequence shown as SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has the sequence shown as SEQ ID NO.32 and SEQ ID NO.33.

[0010] Preferably, the reagent is si-RASL11B-1.

[0011] In a fifth aspect, the present invention provides an anti-aging product for poultry tissue, comprising at least one of the following ingredients: miR-210a-5p mimics, si-RASL11B-1, si-RASL11B-2, and si-RASL11B-3; wherein, miR-210a-5pmimics has a sequence as shown in SEQ ID NO.4, si-RASL11B-1 has a sequence as shown in SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has a sequence as shown in SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has a sequence as shown in SEQ ID NO.32 and SEQ ID NO.33.

[0012] In a sixth aspect, the present invention provides a method for delaying anti-aging of poultry tissues for non-therapeutic and non-diagnostic purposes, comprising: transfecting at least one of the following components into chicken uterine epithelial cells: miR-210a-5p mimics, si-RASL11B-1, si-RASL11B-2, and si-RASL11B-3; wherein, miR-210a-5p mimics has the sequence shown in SEQ ID NO.4, si-RASL11B-1 has the sequence shown in SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has the sequence shown in SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has the sequence shown in SEQ ID NO.32 and SEQID NO.33.

[0013] Compared with the prior art, the present invention has the following beneficial effects: Using laying hens as representative poultry, this study, through miRNA sequencing analysis of the uteri of laying hens of different ages, identified miR-210a-5p, a potential factor that inhibits uterine epithelial cell aging in chickens. Experiments confirmed that miR-210a-5p can inhibit uterine epithelial cell aging and alleviate the aging secretory phenotype. Further investigation revealed that its target gene is RASL11B. The study found that RASL11B expression is significantly elevated in aged uterine tissue and has the function of promoting cell aging and inflammatory responses. Interfering with its expression can significantly improve the aging phenotype, indicating that RASL11B is a key driver of uterine aging. This study provides a new theoretical basis and important technical support for the analysis of the mechanisms of poultry tissue aging and the development of intervention strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings: Figure 1 This is an analysis of the morphological and molecular characteristics of uterine aging in laying hens in Example 1 of the present invention. A and B show that the weight and length of the oviduct of laying hens decrease significantly with age; C and D show that eggshell thickness and strength decrease significantly in older laying hens; E shows that H&E staining of uterine tissue from 350-, 500-, and 700-day-old laying hens reveals gradual glandular atrophy and disorganized epithelial structure; immunohistochemical staining for Lamin B and p53 shows that Lamin B expression decreases with age, while p53 expression gradually increases. FI shows that qPCR results show that the mRNA expression levels of the aging marker genes p21 and p53, as well as the inflammatory factors IL-6 and IL-8, increase significantly with age.

[0015] Figure 2 The following are the changes in miRNA expression during the aging process of uterine tissue of laying hens in Example 2 of the present invention; wherein, A: TOP 20 differentially expressed miRNAs in uterine tissue of laying hens at 350, 500, and 700 days of age; B: principal component analysis of differentially expressed miRNAs between different ages; CE: volcano plot analysis of differentially expressed miRNAs between different ages; F: Venn diagram analysis showing differentially expressed miRNAs that are common in all comparison groups; GP: relative expression level analysis of common differentially expressed miRNAs among the three groups.

[0016] Figure 3Figure 2 shows that miR-210a-5p inhibits the aging and inflammatory response of chicken uterine epithelial cells in Example 2 of the present invention; wherein, A: cell morphology observation 24 h, 48 h, and 72 h after isolation of chicken uterine epithelial cells; B: PCR detection of the expression of highly expressed epithelial cell-specific genes in cultured cells; C and D: immunofluorescence staining showing the expression levels of ESRα and KRT18 in cultured chicken uterine epithelial cells; E: qPCR detection of changes in the expression level of miR-210a-5p after transfection with mimic or inhibitor; F and G: qPCR detection of changes in the mRNA expression of aging-related genes (P16, P21, P53, and MDM2) after transfection with miR-210a-5p mimic or inhibitor; HJ: Western blot detection of changes in the expression of P21, P53, and MDM2 proteins, and grayscale value analysis of the bands using ImageJ software; K: SA-β-gal The level of cell senescence was detected by staining; LO: After transfection of miR-210a-5p mimic or inhibitor, the mRNA levels of inflammatory factors (IL-1, IL-6, IL-8, and TNF-α) were detected by qPCR, and the secretion of corresponding cytokines in the cell supernatant was detected by ELISA.

[0017] Figure 4 The present invention shows the transcriptome changes during the aging process of uterine tissue of laying hens in Example 3; wherein, A: gene expression distribution diagram of uterine tissue of laying hens at 350, 500 and 700 days of age; B: heat map of representative genes up- and down-regulated during aging; C: principal component analysis of differentially expressed genes between different ages; DF: volcano plot analysis of differentially expressed genes between different ages; G: Venn diagram analysis showing differentially expressed genes that are common in all comparison groups; H and I: relative expression level analysis of common differentially expressed genes among the three groups; J and K: heat maps of genes related to cellular senescence and SASP (senescence-associated secretory phenotype).

[0018] Figure 5 Figure 3 shows the combined analysis results of mRNA-seq and miRNA-seq data in Example 3 of the present invention, where A is the Venn diagram analysis result of differentially expressed miRNAs (DEMs) predicting target genes; B is the KEGG pathway enrichment analysis result of 235 overlapping genes; C is the target gene prediction result; D is the analysis of miR-210a-5p and RASL11B binding sites; and E-F are the results of dual-luciferase reporter assays.

[0019] Figure 6RASL11B promotes senescence and inflammatory response of chicken uterine epithelial cells (UECs) in Example 3 of the present invention; wherein, A: qPCR detection of RASL11B expression level after si-RASL11B interference and RASL11B overexpression treatment; B and C: changes in mRNA expression of aging-related genes (P16, P21, P53 and MDM2) after interference or overexpression of RASL11B (qPCR detection); DF: Western blot detection results of P21, P53 and MDM2 protein levels; band intensity was quantitatively analyzed using ImageJ software; G: SA-β-gal staining to assess cell senescence status and compare the si-RASL11B and OE-RASL11B treatment groups; HK: gene expression (qPCR) and secretion levels (ELISA) of inflammatory factors (IL-1, IL-6, IL-8 and TNF-α) were detected after interference and overexpression of RASL11B. DETAILED DESCRIPTION

[0020] In the description of the present invention, it should be noted that if specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0021] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0022] Example 1

[0023] This example analyzes the morphological and molecular characteristics of uterine aging in laying hens, as follows: (1) Animal ethics and sample collection In this example, 120 Jingfen No. 6 laying hens were purchased from Beijing Huadu Yukou Poultry Co., Ltd. (China). All laying hens were housed individually in a standardized environment with free access to commercial laying feed and clean drinking water. The lighting regime was 16 hours of light and 8 hours of darkness per day (16L:8D). Hens were randomly selected and sacrificed at three different stages of their laying cycle: 350 days of age (early senescence), 500 days of age (mid-senescence), and 700 days of age (late senescence). Six hens were randomly selected at each time point for tissue collection and subsequent experimental manipulations. Immediately after sacrifice, the oviducts were dissected and the uterine segments (shell glands) were isolated. Tissues were weighed and measured for morphological characteristics. Some tissues were fixed with 4% paraformaldehyde for histological and immunohistochemical analysis; the remaining tissues were quickly frozen in liquid nitrogen and stored at -80°C for RNA and protein extraction and high-throughput sequencing. All animal experiments were performed in strict accordance with the management regulations of the Animal Welfare Ethics Committee of Sichuan Agricultural University (ethics approval number: 2023102023).

[0024] (2) Egg quality testing Twenty eggs were randomly collected from laying hens at 350, 500, and 700 days of age for egg quality testing. Test parameters included eggshell thickness and eggshell strength. Eggshell thickness was measured at the blunt end, equator, and tip using a micrometer screw, and the average value was calculated. Eggshell strength was measured using an eggshell strength tester (Bulader, Beijing, China), and data were recorded in Newtons (N).

[0025] (3) Histological and immunohistochemical analysis Uterine tissue was fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and sectioned (5 μm thickness). Histological analysis was performed using hematoxylin and eosin (H&E) staining to observe changes in uterine epithelial structure. For immunohistochemical analysis, paraffin sections were dewaxed, rehydrated, and antigen retrieval treated before incubation with primary antibodies (Lamin B and p53, ABclonal, Wuhan, China) followed by horseradish peroxidase (HRP)-conjugated secondary antibodies (ABclonal). DAB was used for color development, and nuclei were counterstained with hematoxylin. Stained sections were observed and photographed under a light microscope (Olympus, Tokyo, Japan).

[0026] (4) RNA extraction and quantitative PCR (qPCR) Total RNA was extracted from uterine tissue or cultured cells using TRIzol reagent (TaKaRa, Otsu, Japan) according to the manufacturer's instructions. cDNA was synthesized using the PrimeScript RT Reagent Kit (TaKaRa). Quantitative PCR was performed on the CFXConnect™ Real-Time PCR System (Bio-Rad, Hercules, USA). The genes tested were p21, p53, IL-6, and IL-8. Primers are listed in Table 1, and the reaction system used was SYBR Green Master Mix (TaKaRa). The reaction system is shown in Table 2. Gene expression was analyzed for relative quantification using GAPDH as an internal control using the 2–ΔΔCt method.

[0027] Table 1 Primer sequences of genes involved

[0028] Table 2 qPCR reaction system

[0029] qPCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; followed by denaturation at 95°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 20 s, for 40 cycles; during the melting curve generation stage, the temperature was increased from 65°C to 95°C (at a rate of 0.5°C / s).

[0030] Experimental results: The egg quality test results showed that in the late egg laying period, the eggshell thickness and eggshell strength decreased significantly with the increase of egg age ( Figure 1 C and D). By weighing and measuring the length of the oviducts of laying hens at 350 days, 500 days, and 700 days of age, it was found that the oviducts of laying hens showed a decrease in weight and a decrease in length with increasing age ( Figure 1 A and B). Subsequently, HE staining of tissue sections showed that the uterus at 500 and 700 days old showed glandular atrophy, disordered epithelial cell arrangement, and functional degeneration. Immunohistochemistry results showed that with age, the expression of Lamin B gradually decreased in the uterus of laying hens, while the expression of p53 gradually increased ( Figure 1 In addition, qPCR results showed that the mRNA expression levels of aging marker genes p21 and p53 gradually increased with age. At the same time, the expression of inflammation-related genes IL-6 and IL-8 also showed the same trend ( Figure 1 In summary, the experimental results show that in the late egg-laying period, the uterine part of the oviduct of laying hens shows an aging phenotype with increasing age.

[0031] Example 2

[0032] In this example, transcriptome sequencing technology was used to discover miRNAs that regulate cell aging phenotypes and inflammatory states in laying hen uterine tissue at different aging stages, and their functions were verified as follows: (1) miRNA sequencing (miRNA-seq) analysis To investigate changes in miRNA expression profiles in uterine tissue of laying hens at different aging stages, this example, based on Example 1, selected uterine tissue from 350-day-old, 500-day-old, and 700-day-old laying hens for small RNA library construction and high-throughput sequencing analysis. Three biological replicates were selected at each time point, for a total of nine samples used for subsequent miRNA-seq. Total RNA was extracted using TRIzol reagent (TaKaRa, Japan), and RNA concentration and integrity were measured using a Nanodrop 2000 spectrophotometer and an Agilent 2100 bioanalyzer. RNA samples that met the library construction criteria were used for small RNA library construction.

[0033] Small RNA library construction involved enriching 18–30 nt small RNA fragments from total RNA, ligating 5' and 3' end adapters, and then reverse-transcribing to cDNA. PCR amplification was performed using primers F: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO. 1) and R: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO. 2). The reaction system is shown in Table 3. The library was quality-controlled using an Agilent 2100 and then subjected to single-end sequencing (SE50) on an Illumina NovaSeq6000 platform. Sequencing was performed by Beijing Novogene. Raw sequencing data (raw reads) were subjected to adapter trimming, filtering for low-quality sequences, and removal of contaminating sequences to generate high-quality clean reads. Clean reads were aligned to the chicken reference genome (GRCg6a) using Bowtie software. Known miRNAs were annotated with reference to the miRBase database, and novel miRNAs were predicted using miRDeep2. Expression levels were normalized using TPM (transcripts per million). Differentially expressed miRNAs (DEMs) were screened using the DESeq2 software package, with a threshold of |log2FC| ≥ 1 and padj < 0.05. Expression profile differences were visualized using principal component analysis (PCA), heatmaps, and volcano plots. Target genes of differentially expressed miRNAs were predicted using a cross-analysis of the miRDB and RNAhybrid databases. GO functional annotation and KEGG pathway enrichment analysis (p < 0.05) were then performed on the target genes to explore their potential functions in cellular aging, immune regulation, and metabolism.

[0034] Table 3 qPCR reaction system

[0035] qPCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; followed by denaturation at 95°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 20 s, for 40 cycles; during the melting curve generation stage, the temperature was increased from 65°C to 95°C (at a rate of 0.5°C / s).

[0036] Experimental results: Figure 2 Figure A shows the TOP20 differentially expressed miRNAs. Subsequently, principal component analysis showed that the three age groups showed significant separation, with large differences between 350 days, 500 days, and 700 days, and small differences between 500 days and before 700 days ( Figure 2Middle B). Volcano plot analysis showed that with increasing age, the number of downregulated miRNAs was greater than that of upregulated miRNAs, and the number of differential miRNAs between 350d and 500d was much greater than that between 500d and 700d ( Figure 2 This result once again proves that 350d-500d is the critical period for uterine aging in laying hens. Through Wayne analysis, we found 10 miRNAs with significant differential expression among the three groups ( Figure 2 Among them, 7 were down-regulated with age, and 1 was up-regulated with age ( Figure 2 Finally, the present invention selected miR-210a-5p for subsequent research.

[0037] (2) miRNA transfection and expression regulation The miR-210a-5p mimic, inhibitor, and their corresponding negative control (NC) were synthesized by GenePharma, and their sequences are shown in Table 4. These oligonucleotides were transfected into cultured chicken uterine epithelial cells (UECs) using Lipofectamine 3000. Quantitative quantitative PCR was performed 24 hours after transfection to verify changes in miRNA expression levels. The primer sequence for miR-210a-5p was AGCCACTGACTAACGCACATTG (SEQ ID NO. 3), and the downstream primer was AGCCACTGACTAACGCACATTG (SEQ ID NO. 3). The qPCR reaction system and reaction conditions were the same as (1).

[0038] Table 4 miR-210a-5p mimic and inhibitor sequences

[0039] Note: In the sequence table, the base 'U' is uniformly represented by 'w'.

[0040] (3) Epithelial cell isolation and culture Fresh uterine tissue was washed in sterile PBS, the endometrium was removed, and minced. The tissue was then digested with 1 mg / mL type I collagenase at 37°C for 60 minutes. After digestion, the tissue was resuspended in F12 complete medium (10% FBS and 1% penicillin-streptomycin) and filtered. Uterine epithelial cells with a purity greater than 95% were obtained by differential adherence purification. Immunofluorescence was performed to verify cell type using ESRα (antibody: WX948351, Abclonal, 1:200 dilution) and KRT18 (antibody: A1022, Abclonal, 1:200 dilution).

[0041] (4) qPCR detection Total cellular RNA was extracted using TRIzol and reverse transcribed into cDNA using the PrimeScript RT kit. qPCR was performed using SYBR Green Master Mix on a Bio-Rad CFX Connect system. Gene expression was analyzed using the 2^−ΔΔCt method, with GAPDH as an internal control. The genes tested and their primers are shown in Table 5. The reaction system and reaction conditions were similar to those in Example (1).

[0042] Table 5 Gene and primer sequences

[0043]

[0044] (5) Western blot detection Total cellular protein was extracted and quantified by the BCA assay, followed by SDS-PAGE separation and membrane transfer. Proteins were incubated with specific primary antibodies targeting p53, p21, and MDM2, and developed with HRP-labeled secondary antibodies. The antibody information used is shown in Table 6. Images were acquired using the ChemiDoc XRS+ imaging system, and the grayscale of the bands was quantitatively analyzed using ImageJ software.

[0045] Table 6 Antibody information

[0046] (6) β-galactosidase staining (SA-β-gal) Beyotime's senescent cell detection kit was used. Cells were fixed with 4% paraformaldehyde for 15 minutes and then stained with X-Gal. The cells were incubated overnight at 37°C. Three random fields of view were photographed, and the percentage of β-gal-positive areas was analyzed using ImageJ software.

[0047] (7) ELISA The cell supernatant was used to detect the secretion of inflammatory factors using an ELISA kit from R&D Systems, and the absorbance was read at 450 nm using a microplate reader.

[0048] All experimental data from (2) to (7) are expressed as mean ± standard error (SEM). Comparisons between groups were performed using Student's t test or one-way analysis of variance (ANOVA) combined with Tukey's test using SPSS 19.0 software. P < 0.05 was considered statistically significant. Figure 3 As shown, Figure 3Figure A shows that after culturing uterine epithelial cells for 24 hours after isolation, the cell confluence was approximately 70%, reaching 90% after 48 hours, and approaching 100% after 72 hours. Subsequently, PCR gel electrophoresis results showed that the cells isolated in this example highly expressed uterine epithelial cell-specific genes ( Figure 3 Middle B). Immunofluorescence results also showed that the positive cell rate of uterine epithelial cell-specific proteins ESRα and KRT18 was above 95% ( Figure 3 The above experimental results show that the chicken oviduct uterine epithelial cells were successfully isolated in vitro in this example with high purity and can be used for subsequent molecular experiments.

[0049] The results of transfecting miR-210a-5p mimic and inhibitor into uterine epithelial cells showed that miR-210a-5p inhibitor significantly downregulated the expression of miR-210a-5p in uterine epithelial cells, while miR-210a-5p mimic significantly upregulated the expression of miR-210a-5p in uterine epithelial cells ( Figure 3 Subsequent functional validation experiments revealed that interfering with miR-210a-5p significantly upregulated the expression of aging-related genes P16, P21, and P53 mRNA, as well as the expression of P21 and P53 proteins, and downregulated the expression of MDM2 mRNA and protein. Overexpression of miR-210a-5p significantly downregulated the expression of P16, P21, and P53 mRNA, as well as the expression of P21 and P53 proteins, and upregulated the expression of MDM2 mRNA and protein. Figure 3 In addition, interference with miR-210a-5p significantly increased the positive ratio of β-gal, a senescence marker in uterine epithelial cells, while overexpression of miR-210a-5p significantly reduced the positive ratio of β-gal in uterine epithelial cells ( Figure 3 Moreover, knockdown of miR-210a-5p significantly increased the expression of inflammation-related genes (IL-1, IL-6, IL-8, and TNF-α) and increased the secretion of inflammatory factors. However, overexpression of miR-210a-5p showed the opposite trend ( Figure 3 These experimental results demonstrate that miR-210a-5p can inhibit uterine epithelial cell senescence and alleviate its senescent secretory phenotype. Furthermore, by measuring miR-210a-5p expression in uterine epithelial cells, the degree of senescence in chicken tissue cells can be preliminarily assessed, for example, by qPCR. Therefore, miR-210a-5p could be used as a molecular marker to develop a kit for assessing poultry tissue senescence.

[0050] Example 3

[0051] The target genes of miR-210a-5p and their functional verification are as follows: (1) Transcriptome sequencing analysis Three biological replicates of uterine tissue samples were randomly selected from each age group of Jingfen No. 6 laying hens for transcriptome analysis. For mRNA sequencing, poly(A)+ RNA was first enriched using Oligo(dT) magnetic beads. RNA fragmentation, first- and second-strand cDNA synthesis, end-repair, A-tailing, adapter ligation, and PCR amplification were then performed to construct mRNA sequencing libraries. For miRNA sequencing, small RNA sequences (18–30 nt) were isolated from the samples, ligated with 5′ and 3′ adapters, and reverse transcribed and amplified to generate miRNA libraries. Library quality was confirmed using an Agilent 2100 system. All libraries were subjected to high-throughput sequencing on the Illumina NovaSeq 6000 platform. Sequencing was performed by Beijing Novogene. After quality control, adapter removal, and filtering for low-quality sequences, the raw sequencing data were aligned to the chicken reference genome (GRCg6a) using HISAT2, and the miRNA-seq data were aligned using Bowtie. mRNA expression levels are expressed in FPKM. Differentially expressed genes (DEGs) were screened using DESeq2, with a |log2FC| ≥ 1 and a corrected P value < 0.05. Principal component analysis (PCA) was used to assess overall differences between samples of different ages. Expression patterns were visualized using volcano plots and heat maps in R software. GO and KEGG functional enrichment analysis was performed using the clusterProfiler package, with P < 0.05 considered significant.

[0052] The experimental results are as follows Figure 4 As shown in the figure, the gene expression distribution diagram shows that the overall expression levels of samples in each group are relatively consistent, but with the increase of age, the transcriptional activity shows a slight downward trend ( Figure 4 Heat map analysis revealed significant changes in gene expression patterns at different time points, with the pathways involved being closely related to cell senescence, uterine degeneration, and immune regulation ( Figure 4 Middle B). Principal component analysis (PCA) showed a clear separation between different age groups, with the most significant difference between 350 and 700 days of age, suggesting that systematic transcriptional remodeling occurs during aging ( Figure 4 Middle C). Volcano plot analysis showed that with increasing age, the number of up-regulated genes was greater than the number of down-regulated genes, especially between 350 and 700 days of age, where the difference was most significant, suggesting that this stage may be a critical period for uterine aging ( Figure 4 Venn diagram analysis identified 14 genes that were differentially expressed at the three time points, of which 4 genes were downregulated with age and 6 genes were upregulated ( Figure 4 Further heat map analysis of genes associated with aging revealed that the expression levels of p53 and ATM increased significantly with age, while genes related to cell cycle, mitochondrial function, and cell homeostasis showed a downward trend ( Figure 4 In addition, genes related to the senescence-associated secretory phenotype (SASP) were significantly upregulated at 500 and 700 days of age ( Figure 4 In conclusion, the period from 350 to 500 days of age may be a critical period for uterine aging in laying hens, characterized by significant transcriptional remodeling and changes in the expression of typical cellular aging molecular markers.

[0053] (2) Study on target genes of miR-210a-5p To further investigate the miRNA-mediated regulation of mRNA expression during uterine aging, this study combined mRNA-seq and miRNA-seq data. Venn diagram analysis revealed that 235 of the target genes predicted by differentially expressed miRNAs (DEMs) between 350 and 700 days were also significantly differentially expressed in the mRNA-seq data ( Figure 5 A KEGG pathway enrichment analysis of these overlapping genes revealed that they are mainly involved in processes such as cell adhesion, ECM-receptor interaction, MAPK signaling pathway, calcium signaling pathway, and inflammatory response, suggesting that miRNAs may play a role in uterine aging by regulating these key biological pathways ( Figure 5 Target gene prediction and expression analysis revealed that miR-210a-5p is a potential regulator of RASL11B. During aging, miR-210a-5p expression gradually decreases, while RASL11B expression increases (Figure 5, C and D). Dual-luciferase reporter assays further confirmed that miR-210a-5p directly binds to and regulates the 3′ UTR of RASL11B, suggesting that miR-210a-5p may play a key role in uterine aging by regulating RASL11B expression (Figure 5, E and F).

[0054] (3) Primary culture of chicken uterine epithelial cells (UECs) Uterine tissue was freshly isolated from healthy laying hens, washed with sterile PBS, and the connective and non-peripheral tissues were removed before dissection. The endometrium was gently excised, minced, and digested with 1 mg / mL type I collagenase. The cells were incubated at 37°C in a water bath for 60 minutes with intermittent gentle shaking. After digestion, complete F12 medium (F12 + 10% fetal bovine serum + 1% penicillin-streptomycin) was added. The cell suspension was filtered through a 70μm cell strainer and centrifuged at 2000 rpm for 5 minutes. The cells were resuspended in F12 medium and sorted for adherence. After 3 hours of culture, the culture medium was changed and cultured again. After 48 hours, the medium was replaced to remove non-adherent non-epithelial cells. Cell purity was confirmed by PCR detection of epithelial-specific genes and immunofluorescence staining (ESRα and KRT18), with a positive rate exceeding 95%.

[0055] (4) RNA oligonucleotide synthesis and vector construction RASL11B siRNAs and corresponding negative controls (NC) (shown in Table 7) were synthesized by GenePharma (Shanghai). For overexpression constructs, the full-length coding sequence of RASL11B was cloned into the pcDNA3.1(+) vector (Geneseed, Guangzhou). All constructs were verified by sequencing. Transfection experiments were performed using Lipofectamine 3000 reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer's instructions. Transfection efficiency was verified by qPCR 24 hours after transfection. The primer sequences for RASL11B were: RASL11B-F: GCTCAGTCACCTGTACCACC (SEQ ID NO. 26), RASL11B-R: AGAGGACGTGGAAGGCATTG (SEQ ID NO. 27). The qPCR reaction system and conditions were similar to those in Example 1.

[0056] Table 7 siRNAs and negative control (NC) sequences of the RASL11B gene

[0057] Full-length coding sequence of RASL11B (SEQ ID NO.36): ATGCGCCTGACGCAGAGCATGTGCACCATCGCCGAGTGCGCGCCCGGCGGTGAGGGCTGCCCCGCGGCTCGGCCTCGCCTGGTCAAGATCGCCGTGGTGGGGGGCAGCGGAGTGGGCAAGACAGCGCTCGTGGTGCGGTTCCTGACGCGGCGCTTCATCGGCGACTACGAGCGGAACGCAGGTAACCTCTACAGCCGGCACATCCAGATCGACGGGGAGGTGCTGGCCATCCAAGTGCAGGACACCCCGGGTGTGCAGATCCACGAACACAGCCTGGATTGCAACGAGCAGCTGAACAGATGCATTCGCTGGGCGGACGCCCTGGTGATCGTCTTCTCCATCACAGACTATAAGAGCTATGAACTGCTCAGTCACCTGTACCACCACGTTCGGCAGATGCATCCGGGGAATGCTGTCCCTGTTGTCATCGTAGCGAACAAAGCTGACCTCTTGCATATTAAAGAGGTGGAGCCTCAGCATGGACTTCAGCTGGCCAACATGCTGGGCTGTGCTTTCTATGAAGTGTCTGTCAGCGAAAACTACAACGACGTCTTCAATGCCTTCCACGTCCTCTGCAAAGAAGTCAGTAAACAACAGACCACCAGCACCCCCGAGAGACGGAGAACTTCTCTCATTCCACGGCCCAAATCGCCCAACATGCAGGATCTGAAGAGGAGGTTTAAGCAAGCTCTGTCTGCCAAAGTGAGGACTGTCACGTCTGTCTGA。

[0058] (S5)Western blot Proteins were extracted using RIPA lysis buffer (BestBio, Shanghai), and their concentrations were determined before separation by SDS-PAGE electrophoresis. After electrophoresis, proteins were transferred to PVDF membranes (Beyotime, Shanghai) and incubated sequentially with antibodies against p53, p21, MDM2, B-Raf, pB-Raf, MEK, p-MEK, ERK, and p-ERK (ABclonal), followed by an HRP-conjugated secondary antibody (ABclonal). The membranes were visualized using enhanced chemiluminescence (ECL, Beyotime), and images were acquired using the ChemiDoc XRS+ Imaging System (Bio-Rad). Protein band intensities were quantified using ImageJ software.

[0059] (6) SA-β-galactosidase staining Cells were stained using a cell senescence detection kit (Beyotime) according to the manufacturer's instructions. After washing thoroughly with PBS, cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature and rinsed three times with PBS. X-Gal staining solution (1 mL per well of a 12-well plate) was added and incubated at 37°C for 60 minutes. After incubation, excess dye was washed with PBS to minimize nonspecific background. Three randomly selected fields of view were photographed in each group, and the average proportion of β-gal-positive areas was calculated using ImageJ.

[0060] (7) Enzyme-linked immunosorbent assay (ELISA) IL-1β, IL-6, IL-8, and TNF-α concentrations in cell culture supernatants were measured using ELISA kits (R&D, Minneapolis, USA) according to the manufacturer's instructions. Absorbance was read at 450 nm using a microplate reader (Thermo Fisher, Carlsbad, USA).

[0061] (8) Data statistics and analysis Unless otherwise noted, all experiments were performed in triplicate, and data are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using SPSS 19 software. Comparisons between two groups were performed using the unpaired Student's t-test, and multiple groups were compared using one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. *P < 0.05 indicates statistically significant differences, and **P < 0.01 indicates extremely significant differences.

[0062] The experimental results of (3) to (7) are as follows Figure 6 As shown in Figure 2, the interference efficiency test results showed that siRNA-1 had the highest silencing efficiency and was therefore used in subsequent experiments (P < 0.01, Figure 6qPCR results showed that RASL11B silencing significantly downregulated the mRNA expression of aging-related genes p16, p21, and p53, and significantly upregulated the expression of MDM2 (P < 0.01, Figure 6 In contrast, overexpression of RASL11B promoted the expression of p16, p21, and p53, and inhibited the expression of MDM2 (P < 0.01, Figure 6 The trend of protein level changes was also verified by Western blot, which was consistent with the mRNA results (P < 0.01, Figure 6 In addition, SA-β-gal staining results showed that RASL11B silencing significantly reduced the proportion of positively stained cells, while overexpression led to a significant increase in this proportion (P < 0.05, Figure 6 In terms of inflammatory factors, RASL11B silencing significantly inhibited the gene expression of inflammatory cytokines (such as IL-1β, IL-6, IL-8, and TNF-α) (P < 0.01, Figure 6 H) and its secretion level (P < 0.01, Figure 6 The overexpression of RASL11B led to a significant increase in the expression and secretion levels of the above inflammatory factors (P < 0.01, Figure 6 J and K). These results suggest that RASL11B acts as a pro-aging factor in chicken uterine epithelial cells. Furthermore, by measuring RASL11B expression in uterine epithelial cells, the degree of aging in chicken tissue cells can be preliminarily assessed, for example by qPCR. Therefore, RASL11B could be used as a molecular marker to develop a kit for assessing poultry tissue aging.

[0063] Although the embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents. The embodiments described above merely illustrate several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they cannot be construed as limiting the scope of the patent of the present invention. It should be pointed out that, without departing from the concept of the present invention, a number of variations and improvements may be made by those skilled in the art, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention shall be based on the appended claims.

Claims

1. Application of a molecular marker in the preparation of a poultry tissue aging assessment product, characterized in that: The molecular marker is miR-210a-5p and / or the target gene RASL11B of miR-210a-5p.

2. The use according to claim 1, characterized in that The product also includes a reagent for detecting the expression level of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues.

3. The use according to claim 2, characterized in that The qPCR method is used to detect the expression level of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues; wherein the primers used to detect miR-210a-5p have the sequence shown as SEQ ID NO.3; and / or, the primers used to detect the target gene RASL11B of miR-210a-5p have the sequences shown as SEQ ID NO.26 and SEQ ID NO.

27.

4. Primers for detecting the expression of miR-210a-5p and / or the target gene RASL11B of miR-210a-5p in poultry tissues, characterized in that: The primers used to detect miR-210a-5p have the sequence shown as SEQ ID NO. 3; and / or, the primers used to detect the target gene RASL11B of miR-210a-5p have the sequences shown as SEQ ID NO. 26 and SEQ ID NO.

27.

5. Use of an agent that enhances or promotes miR-210a-5p expression or reduces miR-210a-5p adsorption in the preparation of anti-aging products for poultry tissues, wherein the agent is miR-210a-5p mimics, and the miR-210a-5p mimics has the sequence shown in SEQ ID NO.

4.

6. Use of an agent that reduces or inhibits RASL11B gene expression or promotes RASL11B adsorption in the preparation of poultry tissue anti-aging products, wherein the agent is si-RASL11B-1, si-RASL11B-2 or si-RASL11B-3; wherein, si-RASL11B-1 has the sequence shown as SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has the sequence shown as SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has the sequence shown as SEQ ID NO.32 and SEQ ID NO.

33.

7. The use according to claim 6, characterized in that The reagent is si-RASL11B-1.

8. A poultry tissue anti-aging product, characterized in that: It includes at least one of the following components: miR-210a-5p mimics, si-RASL11B-1, si-RASL11B-2, and si-RASL11B-3; wherein, miR-210a-5p mimics has the sequence shown as SEQ ID NO.4, si-RASL11B-1 has the sequence shown as SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has the sequence shown as SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has the sequence shown as SEQ ID NO.32 and SEQ ID NO.

33.

9. A method for delaying the aging of poultry tissues for non-therapeutic and non-diagnostic purposes, characterized in that: include: At least one of the following components is transfected into chicken uterine epithelial cells: miR-210a-5p mimics, si-RASL11B-1, si-RASL11B-2, and si-RASL11B-3; wherein, miR-210a-5p mimics has the sequence shown as SEQ ID NO.4, si-RASL11B-1 has the sequences shown as SEQ ID NO.28 and SEQ ID NO.29, si-RASL11B-2 has the sequences shown as SEQ ID NO.30 and SEQ ID NO.31, and si-RASL11B-3 has the sequences shown as SEQ ID NO.32 and SEQ ID NO.33.

Images