Pegylated cis-platinum compound as well as preparation method and application thereof
By preparing a combination of PEGylated cisplatin compounds and liposome nanoparticles, the problem of low loading efficiency of cisplatin in liposome nanoparticles is solved, tumor targeting and therapeutic effects are improved, toxicity is reduced, and a safer drug delivery solution is provided.
Patent Information
- Application Number
- CN202510890146.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-10-10
Smart Images

Figure CN120757770A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of drug carriers, and in particular to a pegylated cisplatin compound and a preparation method and application thereof. Background Art
[0002] Cisplatin, as a classic platinum anti-tumor drug, is widely used in the clinical treatment of various malignant tumors. However, it still has significant toxic side effects and drug resistance problems in its application, which limits the further improvement of its efficacy. In order to improve the pharmacokinetic properties of cisplatin and reduce its toxicity, researchers have tried to optimize its performance through chemical modification or new delivery systems. Among them, polyethylene glycol (PEG) modification has become one of the effective strategies to improve drug solubility, stability and targeted delivery due to its excellent biocompatibility and long circulation properties.
[0003] Liposomal nanoparticles, as highly effective drug delivery vehicles, can passively target tumor tissues by enhancing permeation and retention while minimizing toxicity to normal tissues. However, due to its chemical properties, conventional cisplatin is difficult to efficiently load into liposome systems, resulting in insufficient delivery efficiency. Therefore, developing a PEGylated cisplatin derivative suitable for liposome synthesis is of great significance for improving the tumor targeting and therapeutic efficacy of cisplatin. Summary of the Invention
[0004] In view of this, the present application provides a PEGylated cisplatin compound, a preparation method and application thereof. Through specific chemical modification, the compound not only enhances the compatibility of cisplatin with liposomes, but also significantly improves the loading efficiency and stability of the drug. In addition, the present application also relates to the delivery application of the compound in liposome nanoparticles, which provides a safer and more efficient solution for the clinical treatment of cisplatin, has important clinical application prospects, and can effectively overcome the defects of the above-mentioned existing technologies.
[0005] In a first aspect, the present application provides a PEGylated cisplatin compound having a structure shown in Formula I:
[0006]
[0007] Wherein, n is an integer between 1 and 100.
[0008] The second aspect of the present application further provides a method for preparing the above-mentioned PEGylated cisplatin compound, comprising the following steps:
[0009] S1. Under nitrogen protection, mPEG-OH-2K was dissolved in dichloromethane, TEMPO was added, and the temperature was lowered to 0-5°C after stirring to dissolve. NaClO solution was slowly added dropwise, and the addition rate was controlled to maintain the temperature <10°C. The reaction was allowed to proceed for 3 h. A saturated NaCl solution was added to terminate the reaction. The organic phase was separated and collected, and the organic phase was washed with purified water until neutral. The dichloromethane was removed by distillation under reduced pressure to obtain crude mPEG-COOH-2K.
[0010] S2. Dissolve the crude mPEG-COOH-2K in ultrapure water and load onto a strong anion exchange column. Elute impurities with a NaCl aqueous solution and then elute the target product with an HCl aqueous solution. Collect the eluate, neutralize it with a NaOH solution to pH 7.0, and freeze-dry to obtain white solid mPEG-COOH-2K.
[0011] S3. Dissolve mPEG-COOH-2K in anhydrous DMF, add N-hydroxysuccinimide and 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, and activate at 25°C for 2 h; add dichlorodiamino cisplatin diol, and react at 35°C for 24 h in the dark; filter the reaction solution through a 0.22 μm filter membrane to obtain a crude mPEG-CDDP-4K solution; purify and dry to obtain a PEGylated cisplatin compound.
[0012] The third aspect of the present application also provides a liposome nanoparticle comprising the above-mentioned pegylated cisplatin compound.
[0013] Preferably, the liposome nanoparticles are composed of the following components by mass percentage: SM-102 20-80%, mPEG-DMG-2K 1-20%, CHO-HP 5-40%, DSPC 1-20%, and mPEG-CDDP-4K 0.05-0.5%, wherein mPEG-CDDP-4K is the pegylated cisplatin compound according to claim 1.
[0014] A fourth aspect of the present application further provides a method for preparing the above-mentioned liposome nanoparticles, comprising the following steps:
[0015] After mixing the components, an equal volume of anhydrous ethanol was added, mixed evenly, and incubated in a water bath at 37° C. for 1 to 5 hours under light-proof conditions to obtain liposome nanoparticles.
[0016] Specifically, the preparation method of liposome nanoparticles comprises the following steps:
[0017] The mass percentage of SM-102 is 64% (soluble in anhydrous ethanol), the mass percentage of mPEG-DMG-2K is 4.5% (soluble in anhydrous ethanol), the mass percentage of CHO-HP is 18% (soluble in anhydrous ethanol), the mass percentage of DSPC is 8% (soluble in anhydrous ethanol), and the mass percentage of mPEG-CDDP-4K is 0.5% (soluble in anhydrous ethanol). After mixing the components, an equal volume of anhydrous ethanol is added, mixed evenly, and incubated in a light-proof 37°C water bath for 1 hour.
[0018] The fifth aspect of the present application also provides a pharmaceutical composition comprising the above-mentioned liposome nanoparticles and at least one active pharmaceutical ingredient.
[0019] Preferably, the pharmaceutical active ingredient is selected from at least one of mRNA, DNA, protein, polysaccharide, and polypeptide.
[0020] Preferably, the dosage ratio of the liposome nanoparticles to the active pharmaceutical ingredient is 1:(1-10).
[0021] Preferably, the dosage ratio of the liposome nanoparticles to the active pharmaceutical ingredient is 1:3.
[0022] A sixth aspect of the present application also provides the use of the above-mentioned pharmaceutical composition in the preparation of a pharmaceutical preparation for tumor treatment or nucleic acid drug delivery.
[0023] The present application provides a novel PEGylated cisplatin compound and a preparation method thereof, a pharmaceutical composition comprising the PEGylated cisplatin compound and containing the compound, and a preparation thereof, in particular, a nucleic acid pharmaceutical composition containing the PEGylated cisplatin compound and a preparation thereof. The nucleic acid pharmaceutical composition preparation can deliver nucleic acid drugs into cells, increase the transport rate of nucleic acid drugs, reduce toxicity, and thus improve the therapeutic effect of nucleic acid drugs.
[0024] Compared with the prior art, this application has the following beneficial effects:
[0025] (1) Efficient drug loading: The design of PEG-cisplatin covalent conjugates solves the problem that traditional cisplatin is difficult to load efficiently into liposomes.
[0026] (2) Targeted delivery: The compound of the present application has both the long circulation characteristics of PEG and the anti-tumor activity of cisplatin. When combined with a targeted delivery system, it can achieve a targeted killing effect on tumors.
[0027] (3) Significantly reduced toxicity: PEGylation blocks direct contact between cisplatin and non-target tissues, reducing renal toxicity and reducing side effects such as bone marrow suppression. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the technical solutions in the application or the prior art, the following will briefly introduce the drawings needed to be used in the description of the application or the prior art. Obviously, the drawings described below are some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0029] Figure 1 High performance liquid chromatogram of mPEG-CDDP-4K;
[0030] Figure 2 Matrix assisted laser desorption time of flight mass spectrometry result of mPEG-CDDP-4K;
[0031] Figure 3 Nuclear magnetic resonance spectrum of mPEG-CDDP-4K;
[0032] Figure 4 Gel permeation chromatogram of mPEG-CDDP-4K;
[0033] Figure 5 Cell viability chart of LNP encapsulated with mPEG-CDDP-4K;
[0034] Figure 6 Luciferase expression chart of LNP encapsulated with mPEG-CDDP-4K. DETAILED DESCRIPTION
[0035] In order to make the purpose, technical solutions and advantages of the present application more clear, the technical solutions in the present application will be described clearly and completely in the following in combination with the drawings in the present application. Obviously, the described embodiments are some embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative effort belong to the protection scope of the present application.
[0036] The experimental methods used in the embodiments of the present application are all conventional methods if no special instructions are given.
[0037] In the following embodiments, all the raw materials can be obtained by commercial purchase or conventional methods if no special instructions are given.
[0038] The full name of SM-102 is: 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid heptadecan-9-yl ester, i.e. heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecyloxy)hexyl)amino)octanoate.
[0039] The full name of mPEG-DMG-2K: polyethylene glycol 2000.
[0040] The full name of CHO-HP: cholesterol.
[0041] The full name of DSPC: 1,2-Distearoyl-sn-glycero-3-phosphocholine, which is distearoylphosphatidylcholine.
[0042] Example 1: Preparation and Characterization of mPEG-CDDP-4K
[0043] Step 1: Synthesis of mPEG-COOH-2K
[0044] Under nitrogen protection, mPEG-OH-2K (2.0 g, 0.1 mol) was dissolved in dichloromethane (15 mL); TEMPO (0.0156 g, 10 mmol) was added, stirred and dissolved, and then the temperature was lowered to 0-5°C; NaClO solution (containing 12% available chlorine, 0.833 mL, 0.11 mol) was slowly added dropwise, and the dropwise addition rate was controlled to maintain the temperature <10°C, and the reaction was allowed to proceed for 3 h; a saturated NaCl solution (2 mL) was added to terminate the reaction, and the organic phase was collected by separation; the organic phase was washed with purified water (3×5 mL) until neutral, and the dichloromethane was removed by vacuum distillation to obtain crude mPEG-COOH-2K.
[0045] Step 2: Ion column purification
[0046] The crude mPEG-COOH-2K product was dissolved in ultrapure water (10 mL) and loaded onto a strong anion exchange column (Q Sepharose FF). Impurities were washed with a 0.1 M NaCl aqueous solution, followed by elution with a 0.5 M HCl aqueous solution. The eluate was collected, neutralized with a NaOH solution to pH 7.0, and freeze-dried to obtain mPEG-COOH-2K as a white solid.
[0047] Step 3: Cisplatin coupling reaction
[0048] mPEG-COOH-2K (1 g, 0.05 mol) was dissolved in anhydrous DMF (8 mL), and N-hydroxysuccinimide (NHS, 0.069 g, 0.06 mol) and 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl, 0.115 g, 0.06 mol) were added. The mixture was activated at 25°C for 2 h. Dichlorodiaminocisplatin diol (cisplatin precursor, 0.198 g, 0.055 mol) was added, and the mixture was reacted at 35°C for 24 h in the dark. The reaction solution was filtered through a 0.22 μm filter membrane to obtain a crude mPEG-CDDP-4K solution.
[0049] Step 4: Final product purification and drying
[0050] Scheme 1 (column chromatography purification): The crude product solution was loaded onto a Sephadex LH-20 column and eluted with methanol:water (7:3, v / v). The main peak fractions were collected; the product was concentrated under reduced pressure and freeze-dried to obtain a white flocculent solid.
[0051] Option 2 (ultrafiltration purification): The crude product solution was diluted with ultrapure water (20 mL) and dialyzed through an ultrafiltration membrane with a molecular weight cutoff of 3 kDa for 48 h to remove small molecular impurities; the concentrate was freeze-dried to obtain the product.
[0052] The synthesized compounds were characterized. First, the molecular structure substitution rate was calculated using high performance liquid chromatography coupled with evaporative light detection. Figure 1 The results showed that the substitution rate was 98.3%. The absolute molecular weight of the molecular structure was further detected by matrix-assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF). The theoretical molecular weight was 4077 Da, and the detected molecular weight was 4076.870 Da, which was consistent with the expectation ( Figure 2 The structure of the compound was characterized by NMR, and a cisplatin-specific signal appeared in the compound, indicating that cisplatin was successfully linked to PEG ( Figure 3 Finally, gel permeation chromatography was used to detect the target molecular weight fraction and polymer dispersibility index in the sample. The results showed that the target molecular weight fraction was 98.551%, the scientific count in COA was 98.6%, the PDI was 1.03042, and the scientific count in COA was 1.03, which was consistent with expectations ( Figure 4 ).
[0053] Example 2: Preparation of liposome nanoparticles
[0054] Prepare lipid-ethanol solution. The specific composition contents are shown in Table 1 below. After mixing the components, add an equal volume of anhydrous ethanol, mix well, and incubate in a light-proof 37°C water bath for 1 h.
[0055] Table 1 Liposome nanoparticle formulations with different ratios of mPEG-CDDP-4K
[0056] SM-102 mPEG-DMG-2K mPEG-CDDP-4K CHO-HP DSPC 64% 5% 0% 18% 8% 64% 4.95% 0.05% 18% 8% 64% 4.75% 0.25% 18% 8% 64% 4.5% 0.5% 18% 8% 64% 4% 1% 18% 8% 64% 3.5% 1.5% 18% 8% 64% 2.5% 2.5% 18% 8%
[0057] Example 3: Preparation of mRNA
[0058] This example uses in vitro transcription to synthesize luciferase mRNA, but this method is not limited to this. The gene encoding the epitope protein sequence is inserted into the pUC57 vector, but this vector is not limited to this vector. The gene is then transformed into competent E. coli for expression, amplified, and harvested when the bacteria reach the stationary phase. Subsequently, mRNA is obtained through plasmid extraction, enzyme linearization, in vitro transcription, and chromatographic purification.
[0059] The DNA sequence of the 5' untranslated region (5'UTR) is shown in SEQ ID NO.1:
[0060] GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCGCTAGCCTCG AG.
[0061] The DNA sequence of the 3' untranslated region (3'UTR) is shown in SEQ ID NO.2:
[0062] GATATCTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCC CCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTG.
[0063] The sequence of polyadenylic acid (polyA) is shown in SEQ ID NO. 3, which contains 104 bases A:
[0064] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
[0065] The DNA sequence of the T7 promoter is shown in SEQ ID NO.4:
[0066] TAATACGACTCACTATAGG.
[0067] The amino acid sequence of Luciferase is shown in SEQ ID NO.5:
[0068] MEDAKNIKKGPAPFYPLEDGTAGEQLHKAMKRYALVPGTIAFTDAHIEVDITYAEYFEMSVRLAEAMKRYGLNTNHRIVVCSENSLQFFMPVLGALFIGVAVAPANDIYNERELLNSMGISQPTVVFVSKKGLQKILNVQKKLPIIQKIIIMDSKTDYQGFQSMYTFVTSHLPPGFNEYDFVPESFDRDKTIALIMNSSGSTGLPKGVALPHRTACVRFSHARDPIFGNQIIPDTAILSVVPFHHGFGMFTTLGYLICGFRVVLMYRFEEELFLRSLQDYKIQSALLVPTLFSFFAKSTLIDKYDLSNLHEIASGGAPLSKEVGEAVAKRFHLPGIRQGYGLTETTSAILITPEGDDKPGAVGKVVPFFEAKVVDLDTGKTLGVNQRGELCVRGPMIMSGYVNNPEATNALIDKDGWLHSGDIAYWDEDEHFFIVDRLKSLIKYKGYQVAPAELESILLQHPNIFDAGVAGLPDDDAGELPAAVVVLEHGKTMTEKEIVDYVASQVTTAKKLRGGVVFVDEVPKGLTGKLDARKIREILIKAKKGGKIAV。
[0069] Luciferase mRNA序列如SEQ ID NO.6所示:
[0070]
[0071] Example 4: Preparation of drug complex
[0072] This embodiment uses a droplet microfluidics system to prepare the immune complex, but is not limited to this method. The purified mRNA and liposome nanoparticles are mixed at a ratio of 3:1 using the droplet microfluidics system.
[0073] Example 5: Characterization of Liposome Nanoparticles and mRNA Complexes
[0074] The encapsulation efficiency was measured using a Quant-iT™ Ribo Green assay kit. Results showed that when the mPEG-CDDP-4K concentration was between 0.05% and 0.5%, the encapsulation efficiency exceeded 80%. Particle size analysis, performed using a particle size analyzer, revealed that the drug complexes were primarily distributed around 120 nm when the mPEG-CDDP-4K content was between 0.05% and 0.5% (Table 2). At 1% and above, the LNP particle size increased significantly, while the encapsulation efficiency decreased significantly. Based on these results, the mPEG-CDDP-4K content range of 0.05% to 0.5% was selected.
[0075] Table 2 Statistics of particle size and encapsulation rate after LNP encapsulation with different contents of mPEG-CDDP-4K
[0076]
[0077] Example 6: Expression and toxicity verification of liposome nanoparticles and mRNA complexes in cells using different approaches
[0078] 293T cells were passaged and cultured. One day in advance, 100 μl of cells were added to a 96-well plate. Luciferase-LNPs containing 0%, 0.05%, and 0.5% mPEG-CDDP-4K were added to the 96-well plate at 10 μl / well, with 8 wells added for each concentration. After 48 hours of culture, 10 μl of cell activity detection reagent (WST-1, Beyuntian) was added to 4 wells. The reaction was performed after 2 hours of reading. According to the results, compared with the blank group (i.e., empty cells, which refers to cells with nothing added), the cell activity did not change significantly after the addition of 0% mPEG-CDDP-4K Luciferase-LNP to the cells. The cell activity decreased after the addition of 0.05% mPEG-CDDP-4K Luciferase-LNP to the cells, and the cell activity decreased significantly after the addition of 0.5% mPEG-CDDP-4K Luciferase-LNP to the cells, indicating that the LNP has a cell-killing effect ( Figure 5 ).
[0079] Luciferase substrate was added to the remaining 4 wells and the reaction was continued for 10 minutes before reading on a microplate reader. The results showed that Luciferase expression was positively correlated with cell activity, and the expression level decreased with increasing mPEG-CDDP-4K content, indicating that Luciferase-LNP not only kills cells but also partially expresses protein after addition to cells. Figure 6 ).
[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.
Claims
1. A pegylated cisplatin compound, characterized in that: The PEGylated cisplatin compound has a structure shown in Formula I: Wherein, n is an integer between 1 and 100.
2. A method for preparing the PEGylated cisplatin compound according to claim 1, characterized in that: The following steps are involved: S1. Under nitrogen protection, mPEG-OH-2K was dissolved in dichloromethane, TEMPO was added, and the temperature was lowered to 0-5°C after stirring to dissolve. NaClO solution was slowly added dropwise, and the addition rate was controlled to maintain the temperature <10°C. The reaction was allowed to proceed for 3 h. A saturated NaCl solution was added to terminate the reaction. The organic phase was separated and collected, and the organic phase was washed with purified water until neutral. The dichloromethane was removed by distillation under reduced pressure to obtain crude mPEG-COOH-2K. S2. Dissolve the crude mPEG-COOH-2K in ultrapure water and load onto a strong anion exchange column. Elute impurities with a NaCl aqueous solution and then elute the target product with an HCl aqueous solution. Collect the eluate, neutralize it with a NaOH solution to pH 7.0, and freeze-dry to obtain white solid mPEG-COOH-2K. S3. Dissolve mPEG-COOH-2K in anhydrous DMF, add N-hydroxysuccinimide and 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, and activate at 25°C for 2 h; add dichlorodiamino cisplatin diol, and react at 35°C for 24 h in the dark; filter the reaction solution through a 0.22 μm filter membrane to obtain a crude mPEG-CDDP-4K solution; purify and dry to obtain a PEGylated cisplatin compound.
3. A liposome nanoparticle, characterized in that: The invention comprises the pegylated cisplatin compound according to claim 1.
4. The liposome nanoparticle according to claim 3, characterized in that The liposome nanoparticles are composed of the following components by mass percentage: SM-102 20-80%, mPEG-DMG-2K 1-20%, CHO-HP 5-40%, DSPC 1-20%, and mPEG-CDDP-4K 0.05-0.5%, wherein mPEG-CDDP-4K is the pegylated cisplatin compound according to claim 1.
5. A method for preparing liposome nanoparticles according to claim 3 or 4, characterized in that: The following steps are involved: After mixing the components, an equal volume of anhydrous ethanol was added, mixed evenly, and incubated in a water bath at 37° C. for 1 to 5 hours under light-proof conditions to obtain liposome nanoparticles.
6. A pharmaceutical composition, characterized in that The method comprises the liposome nanoparticles according to claim 3 or 4 and at least one active pharmaceutical ingredient.
7. The pharmaceutical composition according to claim 6, characterized in that The active pharmaceutical ingredient is selected from at least one of mRNA, DNA, protein, polysaccharide, and polypeptide.
8. The pharmaceutical composition according to claim 6, characterized in that The dosage ratio of the liposome nanoparticles to the active pharmaceutical ingredient is 1:(1-10).
9. The pharmaceutical composition according to claim 8, characterized in that The dosage ratio of the liposome nanoparticles to the active pharmaceutical ingredient is 1:
3.
10. Use of the pharmaceutical composition according to claim 6 in preparing a pharmaceutical preparation for tumor treatment or nucleic acid drug delivery.