Phytobacterium plantarum FVPGZP2101 and application thereof

Abstract

The invention relates to the field of microorganisms, and provides a plant lactobacillus FVPGZP2101 and application thereof, the plant lactobacillus FVPGZP2101 is preserved in China General Microbiological Culture Collection Center (CGMCC) on December 2, 2024, and the preservation number is CGMCC No.32871. The invention also provides a preparation method of the plant lactobacillus FVPGZP2101. The new strain of the plant lactobacillus obtained by screening has the advantages of strong growth ability, high acid production efficiency, strong acid resistance, capability of degrading nitrite, tryptamine, tyramine, spermidine and spermine, no generation of biogenic amine, no degradation of pectin, antibacterial activity on pathogenic bacteria, oxidation resistance of extracellular metabolites, and no pollution to the environment. According to the present invention, the new strain has advantages of high yield, key volatile substance production and non-volatile substance production, and the fermented food prepared by using the new strain has characteristics of low salt content, rich lactic acid bacteria content, nutrition, health and unique flavor; a food fermentation process developed by utilizing the new strain disclosed by the invention is high in fermentation efficiency, short in production period and high in application value.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, in particular to Lactobacillus plantarum FVPGZP2101 and applications thereof. Background Art

[0002] Salt is an essential ingredient in the processing of fermented vegetables. It can reduce the water activity of vegetables, inhibit the growth of spoilage bacteria, extend the shelf life of vegetables, and improve the flavor of vegetables. Traditional fermented vegetables usually contain 10% to 20% salt, and fermentation relies on microorganisms attached to the surface of the food ingredients.

[0003] With the global push for a low-salt diet, reduced-salt fermented vegetables are gaining increasing attention. These typically contain 5% to 10% salt, but during the fermentation process, most lactic acid bacteria cannot avoid a decrease in viable counts due to salt stress. Consequently, natural fermentation conditions result in slow microbial growth and a long production cycle, making it difficult to scale up production of reduced-salt fermented foods.

[0004] Therefore, it is still necessary to screen lactic acid bacteria with good salt and acid resistance and good fermentation performance to meet the development of salt-reduced fermented foods and their fermentation processes. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides Lactobacillus plantarum FVPGZP2101, fermentation products, microbial preparations, food additives and their applications, and also provides a method for preparing fermented foods. The new strain of Lactobacillus plantarum obtained by screening in the present invention has the advantages of fast growth rate, strong acid production ability, strong acid and salt resistance, etc. The fermented food prepared using this new strain has low salt content, rich lactic acid bacteria content, nutritious and healthy, and unique flavor; the food fermentation process developed using the new strain, fermentation product, microbial preparation or food additive of the present invention has high fermentation efficiency, short production cycle, and high application value.

[0006] To this end, in a first aspect of the present invention, the present invention provides a plant lactobacillus (Lactiplantibacillus plantarum) FVPGZP2101. According to an embodiment of the present invention, the plant lactobacillus FVPGZP2101 was deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms on December 2, 2024, with a deposit number of CGMCC No.32871.

[0007] Collection information:

[0008] Strain name: FVPGZP2101

[0009] Classification: Lactiplantibacillus plantarum

[0010] Deposit date: December 2, 2024

[0011] Depository: General Microbiology Center of China Culture Collection Administration

[0012] Deposit number: CGMCC No.32871

[0013] The new strain of Lactobacillus plantarum FVPGZP2101 screened by the present invention has the advantages of strong growth ability, high acid production efficiency, strong acid resistance, ability to degrade nitrite, tryptamine, tyramine, spermidine and spermine, no biogenic amines, no pectin degradation, bacteriostasis to common Gram-negative and Gram-positive pathogens, antioxidant properties of extracellular metabolites, production of key volatile substances and non-volatile substances, and the like. Fermented food prepared by using the new strain has low salt content, rich lactic acid bacteria content, is nutritious and healthy, and has unique flavor. The food fermentation process developed by using the new strain has high fermentation efficiency, short production cycle, and high application value.

[0014] In a second aspect of the present invention, a fermentation product is provided. According to an embodiment of the present invention, the fermentation product comprises the aforementioned Lactobacillus plantarum FVPGZP2101 and / or its metabolites.

[0015] Those skilled in the art will appreciate that the characteristics and advantages described above for the microorganisms are also applicable to the fermentation product and will not be described in detail here.

[0016] In a third aspect, the present invention provides a microbial preparation. According to an embodiment of the present invention, the microbial preparation includes at least one of the aforementioned Lactobacillus plantarum FVPGZP2101 and a fermentation product. The microbial preparation of the present invention can be used to prepare fermented foods. Fermented foods have a low salt content, are nutritious and healthy, and have a unique flavor. The acid produced after activation can also be used to adjust the sourness of foods, regulate the lactic acid bacteria content in foods, and inhibit common pathogens.

[0017] In a fourth aspect, the present invention provides a food additive. According to an embodiment of the present invention, the food additive comprises: at least one of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, and the aforementioned microbial preparation. The food additive of the present invention can be used to adjust the salt content, acidity, nutritional and flavor characteristics of food, can also be used to adjust the lactic acid bacteria content in food, and can also be used to inhibit common pathogens.

[0018] In a fifth aspect, the present invention provides a method for preparing a fermented food. According to an embodiment of the present invention, the method comprises fermenting a food raw material with at least one of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, and the aforementioned food additive to obtain the fermented food. The method of the present invention has high fermentation efficiency and a short production cycle. The fermented food produced using the method of the present invention has a low salt content, is rich in lactic acid bacteria, is nutritious and healthy, has a unique flavor, and suppresses pathogenic bacteria, making it less susceptible to spoilage.

[0019] In its sixth aspect, the present invention provides a fermented food. According to embodiments of the present invention, the food comprises: the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, or the aforementioned food additive; or is obtained using the aforementioned fermented food preparation method. The food according to embodiments of the present invention has a low salt content, is rich in lactic acid bacteria, is nutritious and healthy, has a unique flavor, and suppresses pathogenic bacteria, making it non-perishable.

[0020] In a seventh aspect, the present invention provides the use of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, or the aforementioned food additive in the preparation of fermented foods. According to embodiments of the present invention, the use of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, or the aforementioned food additive in the preparation of fermented foods is used to reduce the salt content in foods, balance the bacterial flora in foods, improve nutritional and flavor quality, and / or inhibit common pathogens.

[0021] Those skilled in the art will appreciate that the features and advantages described above for the preparation method of Lactobacillus plantarum FVPGZP2101, fermentation products, microbial preparations, food additives or fermented foods are also applicable to this use and will not be repeated here.

[0022] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0024] Figure 1 This is a diagram showing the morphological identification results of Lactobacillus plantarum FVPGZP2101 in Example 2 of the present invention;

[0025] Figure 2 This is a growth curve diagram of Lactobacillus plantarum FVPGZP2101 in Example 3 of the present invention;

[0026] Figure 3This is a graph showing the survival rate test results of Lactobacillus plantarum FVPGZP2101 before and after cultivation in culture media with different pH values ​​in Example 3 of the present invention;

[0027] Figure 4 This is a graph showing the survival rate test results of Lactobacillus plantarum FVPGZP2101 before and after cultivation in culture media with different salt contents in Example 3 of the present invention;

[0028] Figure 5 4 is a graph showing the test results of the inhibitory ability of Lactobacillus plantarum FVPGZP2101 against Escherichia coli ATCC 8099 and Staphylococcus aureus ATCC 6538 in Example 4 of the present invention;

[0029] Figure 6 HPLC chromatogram of degradation and generation of biogenic amines by Lactobacillus plantarum FVPGZP2101 in Example 4 of the present invention;

[0030] Figure 7 This is a graph showing the results of detecting the number of viable bacteria of Lactobacillus plantarum FVPGZP2101 during the fermentation of fermented vegetables in Example 5 of the present invention;

[0031] Figure 8 This is a graph showing the detection results of 15 volatile substances produced by Lactobacillus plantarum FVPGZP2101 during the fermentation of fermented vegetables in Example 5 of the present invention, wherein the abscissa "Time / d" represents time / day, and the ordinate "Content" represents content;

[0032] Figure 9 This is a graph showing the detection results of five non-volatile substances produced by Lactobacillus plantarum FVPGZP2101 during the fermentation of fermented vegetables in Example 5 of the present invention, wherein the abscissa "Time / d" represents time / day, and the ordinate "Content" represents content. DETAILED DESCRIPTION

[0033] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0034] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0035] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0036] As used herein, the term "optionally" generally means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0037] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0038] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.

[0039] In this article, the term "MRS medium" refers to a lactic acid bacteria culture medium, which can be divided into two categories: MRS solid culture medium and MRS liquid culture medium according to the content of the coagulant (usually agarose).

[0040] In this article, the term "Lactobacillus plantarum" refers to a lactic acid bacterium belonging to the phylum Firmicutes, class Bacilli, order Lactobacillales, family Lactobacillaceae, genus Lactiplantibacillus, which is Gram-positive, has round, smooth, milky white or milky yellow colonies, and can ferment sugars to produce lactic acid.

[0041] As used herein, the terms "Lactiplantibacillus plantarum FVPGZP2101," "Lactobacillus plantarum FVPGZP2101," "Lactobacillus plantarum," "FVPGZP2101 strain," and "FVPGZP2101" are synonymous.

[0042] Herein, "common pathogenic bacteria" include at least one of the following: Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Salmonella, Shigella, Bacillus cereus.

[0043] The present application provides a lactiplantibacillus plantarum, a fermentation product, a microbial preparation, a food additive and application thereof, and a preparation method of fermented food.

[0044] Strain

[0045] The present application provides a lactiplantibacillus plantarum FVPGZP2101, which was preserved in the China General Microbiological Culture Collection Center on December 2, 2024, and the preservation number is CGMCC No. 32871.

[0046] The new strain of lactiplantibacillus plantarum FVPGZP2101 screened by the present application has the advantages of fast growth speed, strong acid production capacity, strong acid and salt tolerance, etc.; the fermented food prepared by using the new strain has low salt content, rich lactic acid bacteria content, and is healthy in nutrition, unique in flavor, and can inhibit common pathogenic bacteria and is not easy to spoil; the food fermentation process developed by using the new strain has high fermentation efficiency, short production cycle and high application value.

[0047] According to the embodiments of the present application, the aforementioned lactiplantibacillus plantarum FVPGZP2101 can further include at least one of the following additional technical features

[0048] According to the embodiments of the present application, the aforementioned lactiplantibacillus plantarum FVPGZP2101 has a 16S rDNA sequence as shown in SEQ ID NO: 1.

[0049] Fermentation product

[0050] The present application provides a fermentation product. According to the embodiments of the present application, the fermentation product includes the aforementioned lactiplantibacillus plantarum FVPGZP2101 and / or its metabolites.

[0051] It should be noted that the "fermentation product" of the present application refers to a solution obtained after culturing the lactiplantibacillus plantarum FVPGZP2101 for a period of time, which mainly contains the lactiplantibacillus plantarum FVPGZP2101 and its metabolites; or further treated by centrifugation, filtration and the like, the supernatant mainly contains the metabolites of the lactiplantibacillus plantarum FVPGZP2101; or further treated by centrifugation, resuspension and the like, the bacterial suspension mainly contains the lactiplantibacillus plantarum FVPGZP2101.

[0052] It can be understood by those skilled in the art that the characteristics and advantages described above for the microorganism also apply to the fermentation product, which will not be described here.

[0053] Microbial preparation

[0054] The present application provides a microbial preparation. According to an embodiment of the present application, the microbial preparation comprises at least one of the aforementioned Lactobacillus plantarum FVPGZP2101 and the aforementioned fermentation product. The microbial preparation of the present application can be used for preparing fermented food, and the acid production after activation can also be used for food sour taste adjustment, and can also be used for adjusting the content of lactic acid bacteria in food, and can also be used for inhibiting common pathogenic bacteria.

[0055] According to an embodiment of the present application, the aforementioned microbial preparation can further comprise at least one of the following additional technical features:

[0056] In some specific embodiments, the microbial preparation contains Lactobacillus plantarum FVPGZP2101 with a viable bacterial count of ≥10 8 CFU / g.

[0057] In some preferred embodiments, the microbial preparation contains Lactobacillus plantarum FVPGZP2101 with a viable bacterial count of 10 8 ~ 10 10 CFU / g. Illustratively, the microbial preparation contains Lactobacillus plantarum FVPGZP2101 with a viable bacterial count of 10 8 CFU / g, 5×10 8 CFU / g, 10 9 CFU / g, 5×10 9 CFU / g, 10 10 CFU / g.

[0058] It should be noted that the microbial preparation of the present application can be a microbial liquid inoculum, including but not limited to a fermentation product, etc.; or a microbial solid inoculum, including but not limited to a freeze-dried powder, etc.

[0059] In some specific embodiments, the microbial preparation is a microbial liquid inoculum, and the concentration of the microorganism is 1×10 8 ~ 1×10 10 CFU / mL.

[0060] Illustratively, when the microbial preparation of the aforementioned Lactobacillus plantarum FVPGZP2101 is a liquid preparation, the concentration of the microorganism can be: 1×10 8 CFU / mL, 5×10 8 CFU / mL, 1×10 9 CFU / mL, 5×10 9 CFU / mL, 1×10 10 CFU / mL, 5×10 10 CFU / mL.

[0061] It should be noted that, in the microbial preparation of the present invention, Lactobacillus plantarum FVPGZP2101 may exist in the form of living cells and / or non-living cells.

[0062] As used herein, "living cells" refer to cells that have the ability to metabolize, reproduce, or replicate.

[0063] For example, the living cells may be immobilized cells. Herein, "immobilized cells" refer to living cells that are fixed on a carrier and can carry out life activities such as growth, development, reproduction, inheritance and metabolism within a certain spatial range.

[0064] In this article, "non-viable cells" refer to cells that do not have the ability to metabolize, reproduce and replicate, including but not limited to dried bacteria. Exemplarily, the microbial preparation is a lyophilized powder.

[0065] In some specific embodiments, the Lactobacillus plantarum FVPGZP2101 exists in the form of living cells, dried bacteria, immobilized cells or any other forms.

[0066] In some specific embodiments, the dry bacteria are obtained by freeze-drying the Lactobacillus plantarum FVPGZP2101.

[0067] In some specific embodiments, the microbial preparation may further contain strains acceptable to food.

[0068] As used herein, "acceptable in food" refers to substances or compositions that can be consumed by humans, which may be adjusted according to food requirements in different countries.

[0069] Those skilled in the art will appreciate that the characteristics and advantages described above for microorganisms are also applicable to the microbial preparation and will not be elaborated here.

[0070] food additives

[0071] The present invention provides a food additive. According to an embodiment of the present invention, the food additive includes: at least one of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, and the aforementioned microbial preparation. The food additive of the present invention can be used to reduce the salt content of food, adjust the acidity, nutritional and flavor characteristics of food, adjust the lactic acid bacteria content in food, and inhibit common pathogens.

[0072] According to an embodiment of the present invention, the invention further comprises an auxiliary material or carrier acceptable in food.

[0073] In some embodiments, the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, or the aforementioned microbial preparation is added or inoculated into a food, and thus, a food with different acidity, nutritional and flavor characteristics, or lactic acid bacteria content is further obtained.

[0074] Exemplarily, the food includes, but is not limited to, probiotic tablets, fermented dairy products (such as probiotic yogurt), probiotic solid beverages, probiotic milk powder, probiotic cheese, probiotic soy products, probiotic candies, probiotic fermented fruits, probiotic fermented vegetables, and the like.

[0075] It can be understood by those skilled in the art that the characteristics and advantages described above for the microorganism also apply to the food additive, which will not be described here again.

[0076] Method

[0077] The present application provides a method for preparing a fermented food. According to an embodiment of the present application, the method comprises: fermenting at least one of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, or the aforementioned food additive with food raw materials to obtain the fermented food. The method of the present application has high fermentation efficiency and short production cycle. The fermented food prepared by the method of the present application has low salt content, rich lactic acid bacteria content, unique flavor, and is not easy to spoil.

[0078] According to an embodiment of the present application, the method for preparing the fermented food described above can further comprise at least one of the following additional technical features:

[0079] In some embodiments, the food raw materials are mixed with sodium chloride before the fermentation treatment.

[0080] In some embodiments, the amount of sodium chloride added is 7-10% by mass based on the mass of the food raw materials. For example, in an embodiment of the present application, the mass of the food raw materials (peppers and water) is 100%, and the amount of sodium chloride added is 7-10% of the mass of the food raw materials. The inventors have determined through a large number of experiments that the above-mentioned preferred amount of sodium chloride is lower than the amount of sodium chloride in the prior art, but the fermented food obtained still does not easily grow spoilage bacteria, has a longer shelf life, and has a unique flavor.

[0081] According to an embodiment of the present application, the amount of sodium chloride added is 7-10% by mass based on the mass of the food raw materials. Exemplarily, the amount of sodium chloride added can be 7% by mass, 7.5% by mass, 8% by mass, 8.5% by mass, 9% by mass, 9.5% by mass, or 10% by mass.

[0082] According to an embodiment of the present invention, the food raw material does not include food additives.

[0083] According to an embodiment of the present invention, the food raw materials include vegetables, fruits, dairy products, soy products and / or candies.

[0084] According to an embodiment of the present invention, the food raw material further includes water.

[0085] According to some specific embodiments of the present invention, the food raw materials include vegetables, fruits, dairy products, soy products and / or candies, and water.

[0086] According to an embodiment of the present invention, the pH of the fermentation treatment is 2.5 to 6.5. For example, the pH of the fermentation treatment can be 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0.

[0087] According to an embodiment of the present invention, the pH of the fermentation treatment is 3 to 4. The inventors have determined the preferred pH of the fermentation treatment through a large number of experiments.

[0088] food

[0089] The present invention provides a fermented food. According to an embodiment of the present invention, the fermented food comprises: the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation, or the aforementioned food additive; or is obtained using the aforementioned method. The fermented food according to the embodiments of the present invention has a low salt content, is rich in lactic acid bacteria, is nutritious and healthy, has a unique flavor, suppresses common pathogens, and is non-perishable.

[0090] In some embodiments, the food comprises vegetables, fruits, dairy products, soy products and / or candies.

[0091] use

[0092] The present invention proposes the use of the aforementioned Lactobacillus plantarum FVPGZP2101, the aforementioned fermentation product, the aforementioned microbial preparation or the aforementioned food additive in the preparation of fermented food.

[0093] Those skilled in the art will understand that the features and advantages described above for the preparation methods of microorganisms, fermentation products, microbial preparations, food additives or fermented foods are also applicable to this use and will not be repeated here.

[0094] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0095] Example 1: Acquisition of Lactiplantibacillus plantarum FVPGZP2101

[0096] The Lactobacillus plantarum FVPGZP2101 of the invention is separated and obtained from traditional naturally fermented pickled peppers in Zunyi, Guizhou.

[0097] The process of strain collection and isolation is as follows: naturally fermented pickled peppers are added to sterilized physiological saline, mixed and diluted, and spread on MRS agar medium (purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd.) plates, and cultured at 37°C for 24 to 48 hours. Single colonies of different sizes and morphologies are picked and streaked on fresh MRS solid culture medium plates, and cultured at 37°C for 24 to 48 hours. The streaking purification culture is repeated many times until the colonies in the plate have consistent morphology and are identified after no other bacteria are found under a microscopic examination.

[0098] Strain preservation: Mix the bacterial solution with sterile 50% glycerol at a ratio of 1:1 (v / v) in a cryopreservation tube and store at -80°C.

[0099] Example 2: Identification of Lactiplantibacillus plantarum FVPGZP2101

[0100] The culture separated and purified in Example 1 was subjected to streaking and smear microscopy to further confirm that it was a pure culture, and then subjected to bacterial morphological and physiological and biochemical identification, and PCR amplification and sequencing analysis of the 16S rDNA gene.

[0101] 2.1 Morphological and physiological and biochemical identification

[0102] With reference to the Manual of Identification of Common Bacteria Systems, FVPGZP2101 was identified by morphological characteristics, physiological and biochemical properties.

[0103] The identification results showed that the colony morphology on MRS agar medium was round, convex, with neat edges, and white or milky white ( Figure 1 Gram-positive, catalase-negative. Final pH in MRS liquid medium is 3.78.

[0104] 2. PCR amplification and sequencing analysis of the 16S rDNA gene

[0105] Bacterial DNA extraction: Total bacterial DNA was extracted using the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. For specific procedures, please refer to the kit instructions.

[0106] 16S rDNA gene amplification: PCR amplification of 16S rDNA was performed using the universal bacterial primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO: 2) and 1492R (5'-TACGGCTACCTTGTTACGACTT-3', SEQ ID NO: 3). The PCR amplification system (30 μL system) was as follows: 15 μL of 2× EasyTaq PCR SuperMix (-dye), 2 μL of template DNA (20 ng / μL), 1 μL each of 10 μmol / L PCR upstream and downstream primers, and the volume was adjusted to 30 μL with ddH2O. PCR reaction conditions were as follows: 94°C denaturation for 5 min; 25 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 90 s; incubation at 72°C for 7 min, and storage at 4°C.

[0107] PCR amplification product sequencing process: Amplification products were separated by agarose gel electrophoresis, target bands were recovered, and products were purified using magnetic beads. The sequencing reaction system (5 μL system) was as follows: 1 μL of purified PCR product, 1 μL of BigDye reaction mixture, 1 μL of 3.2 pmol / μL sequencing primer, and deionized water were added to 5 μL. PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; 30 cycles of denaturation at 95°C for 20 s, annealing at 50°C for 30 s, and extension at 60°C for 3 min; and storage at 12°C. After the PCR reaction, magnetic beads were used to precipitate the product, and the precipitate was analyzed by electrophoresis on a 3730XL sequencer.

[0108] Sequence alignment analysis: The 16S rDNA sequencing results were compared with the online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) of NCBI (https: / / www.ncbi.nlm.nih.gov / ) to find the known strain with the highest homology to the sequenced sequence.

[0109] The results showed that the isolated strain FVPGZP2101 was in the same branch as other strains of Lactobacillus plantarum and had a 16S rDNA sequence homology of 99% with that of Lactobacillus plantarum strain MLG5-17 (MT473399.1).

[0110] The final identification determines that the isolated strain is a plant lactobacillus, named Lactiplantibacillus plantarum FVPGZP2101, which has been preserved in the China General Microbiological Culture Collection Center on December 2, 2024, with the preservation number of CGMCC No. 32871. The 16S rDNA sequencing result of Lactiplantibacillus plantarum FVPGZP2101 is as follows: tgctatactg cagtcgaacg aactctggta ttgattggtg cttgcatcat gatttacatt tgagtgagtg gagtaacacg tgggaaacct gcccagaagcgggggataac acctggaaac agatgctaat accgcataac aacttggacc gcatggtccg agtttgaaag atggcttcgg ctatcactttt ggatggtccc gcggcgtat tagctagatg gtggggtaac ggctcaccat ggcaatgata cgtagccgac ctgagagggt aatcggccac attgggactg agacacggcc caaactccta cgggaggcagcagtagggaa tcttccacaatggacgaaag tctgatggag caacgccgcg tgagtgaagaagggtttcggctcgtaaaac tctgttgtta aagaagaacatatctgagag taactgttca ggtattgacg gtatttaaccagaaagccac ggctaactacgtgccagcag ccgcggtaat acgtaggtgg caagcgttgt ccggatttatt gggcgtaaa gcgagcgcag gcggtttttt aagtctgatg tgaaagccttcggctcaaccgaagaagtgc atcggaaact gggaaacttg agtgcagaag aggacagtgg aactccatgt gtagcggtgaaatgcgtagatatatggaag aacaccagtg gcgaaggcgg ctgtctggtc tgtaactgac gctgaggctcgaaagtatgg gtagcaaaca ggattagata ccctggtagtccataccgtaaacgatgaat gctaagtgttggagggttc cgcccttcag tgctgcagct aacgcattaa gcattccgcc tggggagtacggccgcaaggctgaaactca aaggaattga cgggggcccg cacaagcggt ggagcatgtg gttaattcgaagctacgcgcg aggtcg aggtcg acatactatgcaaatctaag agattagacg ttcccttcggggacatggat acaggtggtg catggttgtc gtcagctcgt gtcgtgagat gttgggttaagtcccgcaacgagcgcaacc cttattatca gttgccagca ttaagttggg cactctggtg agactgcccgaggggacaggagg gggatgacgtcaaatcatca tgccccttat gacctgggct acacacgtgctacaatggat ggtacaacga gttgcgaact cgcgagagta agctaatctc ttaaagccattctcagttcggattgtaggc tgcaactcgc ctacattgaag tcggaatcgc tagtaatcgc ggatcagcat gccgcggtgaatacgttccc gggccttgtacacaccgccc gtcacaccat gagagtttgt aacacccaaa gtcggtggggtaacctttag gaaccagccg cttaagg(SEQ ID NO:1)。

[0111] Figure 3: Lactiplantibacillus plantarum (Lactiplantibacillus plantarum) FVPGZP2101

[0112] In this embodiment, the experimental strain was prepared as follows: Lactobacillus plantarum FVPGZP2101 was streaked on an MRS agar medium (purchased from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd.) plate for 24 to 48 hours, and a single colony was picked and grown in MRS liquid medium (purchased from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd.) for 10 to 12 hours to activate the strain.

[0113] 3.1 Strain growth characteristics and acid production capacity

[0114] The activated strain was inoculated into MRS liquid culture medium at a 1% (v / v) inoculation volume, and cultured at 37°C. The absorbance value (OD) at 600 nm of the bacterial solution was measured every 1 h during the period of 0-12 h. 600 ), the bacterial solution OD was measured every 4 h during 12-36 h. 600 , with culture time as the horizontal axis and OD 600 Draw the growth curve with y as the vertical axis.

[0115] The results are as follows Figure 2 As shown, during the first two hours of culture, Lactobacillus plantarum FVPGZP2101 is in the adaptation phase, experiencing slow growth and metabolism. After two hours, it enters the logarithmic growth phase, with exponential bacterial growth. After 16 hours, it enters the stationary phase, with the bacterial population stabilizing. The pH of the bacterial solution during the stationary phase was generally maintained below 4.0, reaching a low of 3.78.

[0116] 3.2 Acid resistance of strains

[0117] MRS liquid culture medium with different pH values ​​(3.0, 3.5, 4.0) was prepared using 0.1M HCL for the acid resistance test of the strain. The activated strain was inoculated into MRS liquid culture medium with pH = 3.0, 3.5, 4.0, and a negative control MRS liquid culture medium (MRS liquid culture medium without pH adjustment, pH 6.20) so that the initial OD 600 =0.10±0.05, cultured at 37°C for 72h, and the absorbance values ​​(OD 600 ), and the survival rate of the strain at different pH values ​​was calculated according to the following formula:

[0118] Survival rate = (OD 600 B-OD 600 b) / (OD 600 A-OD 600 a)

[0119] OD 600 B: Absorbance value of the strain after 72h incubation in MRS liquid medium with different pH value 600 ;

[0120] OD 600 b: Absorbance value of the strain after 0h incubation in MRS liquid medium with different pH value 600 ;

[0121] OD 600 A: Absorbance value of the strain after 72h incubation in negative control MRS liquid medium 600 ;

[0122] OD 600 a: Absorbance value of the strain after 0h incubation in negative control MRS liquid medium 600 ;

[0123] The results are shown in Table 3.3, Lactobacillus plantarum FVPGZP2101 has high tolerance to salt. When the salt content of MRS liquid medium is 6%, 8% and 10%, the growth of the strain is good. Figure 3

[0124] 3.3 Salt tolerance of the strain

[0125] MRS liquid medium with different salt content (6%, 8%, 10%) was prepared for testing the salt tolerance of the strain. The activated strain was inoculated into MRS liquid medium with different salt content and negative control MRS liquid medium (salt content = 0%), so that the initial OD 600 = 0.10 ± 0.05 of the MRS liquid medium, and incubated at 37°C for 72h. The absorbance values (OD 600 ) of the lactic acid bacteria before and after incubation in MRS liquid medium with different salt content were measured, and the survival rate of the strain under different salt content was calculated according to the following formula:

[0126] Survival rate = (OD 600 D-OD 600 d) / (OD 600 A-OD 600 a)

[0127] OD 600 D: Absorbance value of the strain after 72h incubation in MRS liquid medium with different salt content 600 ;

[0128] OD 600 d: Absorbance value of the strain after 0h incubation in MRS liquid medium with different salt content 600 ; ​

[0129] OD 600 A: Absorbance value OD after the strain was inoculated into negative control MRS liquid medium and cultured for 72 hours 600 ;

[0130] OD 600 a: Absorbance value OD after the strain was inoculated into negative control MRS liquid medium and cultured for 0h 600 ;

[0131] The results are as follows Figure 4 As shown: Lactobacillus plantarum FVPGZP2101 can grow in MRS medium with 10% salt content.

[0132] Example 4: Antibacterial properties, pectinase production, nitrite degradation, biogenic amine production and degradation, and metabolite antioxidant activity of Lactiplantibacillus plantarum FVPGZP2101

[0133] In this example, the experimental strain was prepared as follows: Lactobacillus plantarum FVPGZP2101 was streaked on an MRS agar plate for 24-48 hours, and a single colony was picked and grown in MRS liquid medium for 10-12 hours for activation to obtain an activated strain.

[0134] 4.1 Antibacterial properties

[0135] Gram-negative bacteria (Escherichia coli ATCC 8099) and Gram-positive bacteria (Staphylococcus aureus ATCC 6538) were selected as indicator bacteria for the antibacterial ability test. Escherichia coli ATCC 8099 and Staphylococcus aureus ATCC 6538 were frozen at -80°C without thawing. A sterile inoculating loop was quickly inserted into the frozen glycerol stock to obtain bacteria and streaked 2 to 3 times on LB agar medium. The culture was then incubated at 37°C for 24 hours. A single colony on the culture medium was picked and transferred to NB broth (purchased from Beijing Solebold Technology Co., Ltd.) and incubated at 37°C until the OD 600 When the concentration is 0.5, use a sterile cotton swab to dip into the diluted bacterial solution and spread it to obtain an indicator bacteria plate.

[0136] 4 mL of the activated Lactobacillus plantarum bacterial solution was transferred to a sterile 5 mL centrifuge tube and centrifuged at 10,000 × g for 10 min. The supernatant was filtered through a 0.22 μm sterile filter membrane to obtain a lactic acid bacteria fermentation broth. The uninoculated MRS broth was used as a blank test group.

[0137] Put 3 Oxford cups on the E. coli ATCC 8099, S. aureus ATCC 6538 indicator bacteria plate, 2 of which add 200 μL of P. acidilactici fermentation liquor, and 1 of which adds 200 μL of blank experiment group MRS broth; the plate is placed in a 37°C condition for 24h of culture; after the end of the culture, a photo is taken and the diameter of the inhibition zone is measured.

[0138] The results, as shown in Table 1, show that the diameter of the inhibition zone of E. coli ATCC 8099 is 18.38±1.30mm, and the diameter of the inhibition zone of S. aureus ATCC 6538 is 15.32±1.31mm. Figure 5

[0139] 4.2 Metabolite antioxidant property

[0140] Cell disruption supernatant preparation: take 1 mL of the activated P. acidilactici bacterial solution and place it in a 5 mL centrifuge tube, centrifuge at 10000xg for 10 min, and discard the supernatant; add 2 mL of sterile PBS buffer, vortex to mix, and transfer to a 50 mL centrifuge tube; repeat the above centrifugation separation step 2 times, and finally add 4 mL of sterile PBS buffer, a total of 10 mL, vortex to mix, and place in an ice box; use an ultrasonic cell disrupter to disrupt the cells, with the following disruption conditions: amplitude rod No. 6, power 300W, ultrasonic 3s, interval 7s, and duration 20min; after cell disruption is complete, centrifuge at 10000xg for 10 min, and the supernatant is the cell disruption supernatant.

[0141] Cell-free supernatant preparation: take 4 mL of the activated P. acidilactici bacterial solution in a sterile 5 mL centrifuge tube, centrifuge at 10000xg for 10 min, and pass through a 0.22 μm sterile filter membrane; the obtained supernatant is the cell-free supernatant.

[0142] Use DPPH kit (purchased from Nanjing Jiancheng Biological Engineering Institute) and FRAP kit (purchased from Shanghai Biyun Tian Biological Technology Co., Ltd.) to determine the antioxidant property of the cell disruption supernatant and the cell-free supernatant, which represent the antioxidant property of intracellular and extracellular metabolites, respectively, and the specific operation is carried out according to the above kit instructions.

[0143] The results show that the intracellular metabolites of the strain do not have antioxidant property, the FRAP total antioxidant capacity of the extracellular metabolites is 0.56±0.02mmol Trolox / L, and the DPPH free radical scavenging capacity is 0.06±0.00mmol Trolox / L.

[0144] 4.3 Pectinase production capacity

[0145] Activate the P. acidilactici to obtain a bacterial solution, and prepare cell disruption supernatant and cell-free supernatant. ​

[0146] The pectinase content in the cell disruption supernatant and cell-free supernatant was determined using a pectinase kit (Leagene Biotech Co., Ltd., Shanghai, China), and the samples of the cell disruption supernatant and cell-free supernatant after boiling in a water bath for 30 min were used as blank samples.

[0147] The results showed that the plantaricin FVPGZP2101 could not degrade pectin.

[0148] 4.4 Nitrite degradation ability

[0149] After activation, the plantaricin FVPGZP2101 was inoculated into NaNO2-MRS broth with concentrations of 0 g / L, 0.05 g / L, 0.10 g / L, and 0.15 g / L at an inoculation amount of 2% (v / v), and the MRS broth without inoculation was used as a negative control test group. The culture was incubated at 37°C for 24 h.

[0150] During the incubation, the pH of the bacterial solution was determined at 6, 12, and 24 h. Four mL of the bacterial solution after incubation in each group was taken into a 5 mL sterile centrifuge tube, centrifuged at 10,000 x g for 10 min, filtered through a 0.22 μm sterile filter membrane, and the obtained filtrate was used to determine the nitrite content using a nitrite kit (purchased from Beijing Solaybao Technology Co., Ltd.).

[0151] The results are shown in Table 1. The plantaricin FVPGZP2101 was incubated in 0.00, 0.05, 0.10, and 0.15 g / L nitrite concentrations, and the nitrite degradation rate and the pH of the fermentation broth were determined at 6, 12, and 24 h after fermentation. The nitrite degradation rate was about 60% after 6 h of fermentation, and the pH of the fermentation broth without nitrite was lower. The nitrite degradation rate reached 100% after 12 h of fermentation, and the pH of the fermentation broth without nitrite and with a 0.05 g / L nitrite concentration was lower. The nitrite degradation rate reached 100% after 24 h of fermentation, and the pH of the fermentation broth was reduced to 3.66-3.69, with no significant difference. In summary, 0.05-0.15 g / L nitrite can be completely degraded by the plantaricin FVPGZP2101 after 12 h. Nitrite has a certain inhibitory effect on the acid production rate of the plantaricin FVPGZP2101 during fermentation, which further indicates that nitrite has a certain effect on the growth of the strain. However, the low concentration of nitrite in this study has little effect on the growth and metabolism of the plantaricin FVPGZP2101, and there is no significant difference in the pH of the fermentation broth of the strain without nitrite and with nitrite after 24 h of fermentation.

[0152] Table 1 Nitrite degradation rate and pH of the fermentation broth of the plantaricin FVPGZP2101

[0153]

[0154] 4.5 Ability to produce and degrade biogenic amines

[0155] (1) Ability to produce biogenic amines

[0156] MRS broth (adjusted to pH 5.5 using 1 mol / L HCl) containing 0.1% (w / v) of each of the amino acids L-tyrosine disodium salt, L-ornithine hydrochloride, L-lysine, L-phenylalanine, L-histidine, L-arginine, and L-tryptophan) and 0.005% (w / v) of the cofactor pyridoxal-5-phosphate was prepared. The culture was autoclaved at 121°C for 10 min to prevent amino acid denaturation, yielding MRS-AA broth. The activated strain was added to MRS-AA broth at a 2% (v / v) inoculum level, and the strain was subcultured and activated five times.

[0157] After activation, the strain was inoculated into MRS-AA broth at a 2% (v / v) inoculum. Uninoculated MRS-AA broth served as a negative control and was incubated at 37°C for 4 days. 4 mL of the bacterial suspension was transferred to a 5 mL sterile centrifuge tube and centrifuged at 10,000 × g for 10 minutes. The filtrate was filtered through a 0.22 μm sterile filter membrane to obtain the filtrate. 1 mL of the filtrate was transferred to a 5 mL sterile centrifuge tube and mixed with 1 mL of 5% trichloroacetic acid to prepare the biogenic amine extract.

[0158] 1 mL of the extract was placed in a 15 mL centrifuge tube. 200 μL of 2 mol / L NaOH solution was added to make the test solution alkaline. 300 μL of saturated sodium bicarbonate solution was then added for buffering. 1 mL of 10 mg / mL dansyl chloride solution (in acetone) was added and vortexed for 1 minute. The solution was then incubated in a water bath at 65°C in the dark for 15 minutes. 100 μL of concentrated ammonia was added to the solution and the solution was incubated in the dark for 30 minutes to interrupt the reaction and remove excess dansyl chloride. Acetone was then blown through with nitrogen until the test solution volume reached approximately 1 mL. Acetonitrile was then added to bring the test solution to 2 mL. The solution was then filtered through a 0.22 μm PTFE filter. The biogenic amine content in the sample was determined using UPLC.

[0159] (2) Ability to degrade biogenic amines

[0160] A mixed standard solution of biogenic amines was prepared using 0.1 mol / L HCl and added to MRS broth to obtain an MRS broth containing a final concentration of 237.20 mg / kg tryptamine, 67.60 mg / kg putrescine, 77.83 mg / kg cadaverine, 182.31 mg / kg histamine, 54.43 mg / kg octopamine, 108.30 mg / kg tyramine, 100.96 mg / kg spermidine, and 68.80 mg / kg spermine. The broth was then autoclaved at 121°C for 15 min to obtain MRS-BA broth.

[0161] After activation, the strain was added to MRS-BA broth at a 2% (v / v) inoculum. Uninoculated MRS-BA broth served as a negative control and was incubated at 37°C for 4 days. 4 mL of the bacterial suspension was placed in a 5 mL sterile centrifuge tube and centrifuged at 10,000 × g for 10 minutes. The filtrate was filtered through a 0.22 μm sterile filter membrane to obtain a filtrate. 1 mL of the filtrate was transferred to a 5 mL sterile centrifuge tube and mixed with 3 mL of 5% trichloroacetic acid to prepare a biogenic amine extract.

[0162] Refer to the method in the test for the ability to produce biogenic amines to derive and determine the content of biogenic amines.

[0163] The results are as follows Figure 6 As shown, Lactobacillus plantarum FVPGZP2101 can degrade tryptamine, tyramine, spermidine, and spermine at rates of 16.55±6.85%, 6.92±0.76%, 9.85±0.15%, and 49.70±0.27%, respectively. However, the strain is unable to degrade putrescine, cadaverine, histamine, and octopamine. Furthermore, Lactobacillus plantarum FVPGZP2101 does not produce biogenic amines.

[0164] Example 5: Application of Lactiplantibacillus plantarum FVPGZP2101

[0165] In this example, fermented vegetables were prepared using Lactobacillus plantarum FVPGZP2101.

[0166] The specific method is as follows:

[0167] 5.1 Preparation of Lactobacillus plantarum FVPGZP2101 Starter Culture

[0168] Lactobacillus plantarum FVPGZP2101 was streaked on an MRS agar plate for 24 to 48 hours, and a single colony was picked and grown in an MRS liquid medium for 10 to 12 hours for activation. The activated Lactobacillus plantarum FVPGZP2101 was inoculated into an MRS liquid medium at a 1% (v / v) inoculum volume for 10 to 12 hours. The bacterial solution was centrifuged, washed with sterile saline until no culture medium remained, and resuspended in sterile saline to a bacterial density of 1×10 10 ~1×10 11 CFU / mL.

[0169] 5.2 Preparation of Chili Pickled Peppers

[0170] Combined with GB 2760-2024 National Food Safety Standard for the Use of Food Additives, the composition and proportion of the chili pepper inoculation and fermentation materials were formulated as shown in Table 2. The preparation steps are as follows: 1.5 kg of fresh chili peppers from Tongren City, Guizhou Province were selected, washed, and drained, and placed in a fermentation jar to prepare the fermentation liquid. The amount of salt added accounted for 7% to 10% of the total mass of the system. 8 CFU / mL of the final concentration of inoculated Lactobacillus plantarum FVPGZP2101, the room temperature in the dark sealed fermentation for 45 days, that is, the fermented vegetables prepared by using Lactobacillus plantarum FVPGZP2101 as the starter, and the uninoculated fermented vegetables served as the control group.

[0171] Table 2

[0172]

[0173] Note: The proportion of food additives is the mass ratio (w / w) of the fermentation system (chili and water).

[0174] Detect the number of viable Lactobacillus plantarum bacteria, the results are as follows Figure 7 As shown in the figure, during the whole fermentation process, the number of viable lactic acid bacteria in the vegetables (pickled peppers) and fermentation liquid remained at about 10 5 CFU / g.

[0175] Vegetables suitable for making fermented vegetables using Lactobacillus plantarum FVPGZP2101 include but are not limited to: peppers, cabbage, cucumbers, radishes, etc.

[0176] 5.3 Analysis of key metabolites in pickled chili peppers inoculated with Lactobacillus plantarum FVPGZP2101

[0177] In this embodiment, the volatile substances and non-volatile substances produced by the metabolism of Lactobacillus plantarum FVPGZP2101 were also detected. The specific method is as follows:

[0178] Volatile compounds in fermented chili peppers were qualitatively and quantitatively analyzed using headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) (7890A GC-5977AMS, Agilent, Santa Clara, CA, United States). 0.5 g of ground fermented chili pepper sample (accurately weighed to the nearest 0.0001 g) was accurately weighed into a 20 mL headspace vial, and 20 μL of 2-methyl-3-heptanone (diluted 10,000-fold in methanol) was added as an internal standard. Volatile compounds were enriched by HS-SPME: the headspace vial was equilibrated at 60°C for 20 min with shaking at 250 rpm. At the same temperature, an extraction tip (DVB / CAR / PDMS, 50 / 30 μm, 2 cm) (Supelco, Bellefonte, PA, USA) was inserted above the headspace vial (1-1.5 cm from the sample) and the extraction was continued at this constant temperature for 40 min. After extraction, the extraction head was inserted into the gas chromatography inlet for 5 minutes at a desorption temperature of 250°C. GC-MS analysis was performed using a non-polar DB-5MS (30 m × 0.25 mm × 0.25 μm, Agilent, Santa Clara, CA, USA) quartz capillary column. The carrier gas was high-purity helium (99.999%) at a flow rate of 1 mL / min. The inlet temperature was 250°C in splitless mode. The GC oven temperature program was as follows: an initial temperature of 40°C, held for 3 minutes, then increased at 5°C / min to 150°C, then increased at 10°C / min to 250°C, and held for 10 minutes. Other conditions were the default machine parameters: the mass spectrometer used an electron impact ion source (EI), an ion source temperature of 230°C, a quadrupole temperature of 150°C, an electron impact voltage of 70 eV, full scan mode (Scan), a scan mass range of 30-500 m / z, and a scan interval of 1 s. Qualitative and Semi-quantitative Analysis of Volatile Flavor Compounds: Volatile flavor compounds were identified by qualitative analysis using a standard mass spectral library (NIST14). Some compounds were semi-quantitatively analyzed using internal standards, and some compounds were absolutely quantitatively analyzed using external standards.

[0179] Qualitative analysis of nonvolatile compounds in fermented chili peppers was performed using high-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (HPLC-qTOF-MS) (1290HPLC-G6560B MS, Agilent, Santa Clara, CA, USA). Three grams of ground fermented chili pepper sample (accurate to 0.0001 g) was mixed with 15 mL of a methanol-water solution (7:3, v / v), vortexed, and placed in an ice bath for 12 hours. After centrifugation at 12,000 × g and 4°C for 10 minutes, the supernatant was filtered through a 0.22 μm nylon membrane. Quality control (QC) samples were prepared by combining equal volumes of all sample solutions. Three biological replicates and three extraction replicates were used for each time point to collect precursor ion information for nonvolatile compounds. Each QC sample was fragmented at 10 / 20 / 40 eV to obtain product ion information for nonvolatile compounds. HPLC-qTOF-MS analysis was performed using ESI in positive and negative ion modes. HPLC conditions: BEH C18 column (2.1 × 150 mm, 1.8 μm, Waters Xevo TQ-S, Waters, Massachusetts, USA), mobile phase A: 0.1% formic acid in water (v / v), mobile phase B: 0.1% formic acid in acetonitrile (v / v), injection volume: 2 μL, flow rate: 0.3 mL / min. Gradient elution conditions were: 98% A (0-2 min); 98%-82% A (2-2.50 min); 82%-70% A (2.50-6 min); 70%-46% A (6-9.50 min); 46%-18% A (9.50-14.00 min); 18%-1% A (14.00-15.00 min); 1%-8% A (15-15.10 min); and 98% A (15.10-18.00 min). MS / MS conditions included parent and daughter ion scans with a mass range of 50-1200 Da and 30-1200 Da, respectively. Accumulation times for parent and daughter ion scans were 0.5 s and 0.25 s, respectively. MS / MS fragmentation energies were 10, 20, and 40 eV, respectively. ESI conditions included a capillary voltage of 3500 V and a fragmentor voltage of 380 V. Gas parameters: gas temperature 325°C, nebulizer 35 psi, gas flow rate 7 L / min, sheath gas flow rate 11 L / min at 350°C. HPLC-qTOF-MS analysis of nonvolatile compounds: MS-DIAL version 4.36 software was used for extraction, alignment, and calibration. Parameter settings included MS1 and MS2 tolerances of 0.01 Da and 0.05 Da, respectively, a retention time tolerance of 0.05 min, and an MS1 ​​tolerance of 0.015 Da for peak alignment. Peaks with at least one detection rate greater than 30% were included.The exported MS1 peak list was processed using Microsoft Office Excel 2019 to exclude characteristic peaks with RSD>30% in the quality control group.

[0180] L-lactic acid, 3-phenyllactic acid, DL-(4-hydroxyphenyllactic acid), and catechol in fermented chili peppers were determined by absolute quantification using ultra-performance liquid chromatography-triple quadrupole mass spectrometry (UPLC-QqQ-MS / MS) (Waters Xevo TQ-S, Waters, Massachusetts, USA). Chromatographic conditions were determined according to the literature. The fermented chili pepper sample was ground to a powder using liquid nitrogen using a cryogenic grinder. One gram (accurate to 0.0001 g) of the sample was weighed to the nearest 0.0001 g and placed in a 5-mL centrifuge tube. 3 mL of 70% methanol in water (v / v) was added, vortexed, and ultrasonicated at 40 Hz / 20°C for 10 min. The sample was centrifuged at 10,000 × g / 4°C for 10 min, and the supernatant was collected. After centrifugation, the pellet was ultrasonically extracted twice, following the same procedure as above, yielding three supernatants. The volume was then adjusted to 10 mL with 70% methanol in water (v / v), and the extract was filtered through a 0.22 μm nylon filter. UPLC-QqQ-MS / MS analysis was performed using an HSS T3 reverse-phase column (2.1 × 150 mm, 1.8 μm, Waters Xevo TQ-S, Waters, Massachusetts, USA). Mobile phase A consisted of 0.1% formic acid in water (v / v) and mobile phase B consisted of methanol. The injection volume was 1 μL, and the flow rate was 0.2 mL / min. The gradient elution conditions were: 98% A (0–0.50 min); 98.00%–65.00% A (0.50–4.00 min); 65.00%–50.00% A (4.00–8.00 min); 50.00%–98.00% A (8.00–12.00 min); and 98% A (12.00–16.00 min). The optimal ion pair, cone voltage, and collision energy parameters for the organic acids to be tested were determined using the UPLC-QqQ-MS / MS instrument intellistart program. The electrospray ionization source (ESI) was selected as the mass spectrometry ionization source, the ion mode was negative ion mode, the scan mode was multiple reaction monitoring (MRM) mode, the desolvation gas temperature was 550°C, the gas flow rate was 1000 L / h, and the capillary voltage was 3.0 kV.

[0181] UPLC-QqQ-MS / MS was used to determine the absolute quantification of acetylcholine in fermented peppers. The pickled pepper sample was ground into a powder using liquid nitrogen using a cryogenic grinder. A 3-g sample (accurate to 0.0001 g) was weighed into a 50-mL centrifuge tube. 15 mL of 70% methanol in water (v / v, pre-chilled at 4°C) was added, mixed, and then extracted in an ice bath for 12 hours. The sample was centrifuged at 12,000 × g at 4°C for 10 minutes, and the supernatant was collected. The extract was then filtered through a 0.22 μm nylon filter. UPLC-QqQ-MS / MS analysis was performed using a BEH C18 column (2.1×150 mm, 1.8 μm, Waters Xevo TQ-S, Waters, Massachusetts, USA), column temperature at 30°C, mobile phase A consisting of 0.1% formic acid in water (v / v), mobile phase B consisting of 0.1% formic acid in acetonitrile (v / v), injection volume of 1 μL, and flow rate of 0.3 mL / min. Gradient elution conditions were 95% A (0–10 min). Optimal ion pairing, cone voltage, and collision energy parameters for the organic acids were determined using the UPLC-QqQ-MS / MS instrument's IntelliStart program. The mass spectrometer ionization source was an electrospray ionization (ESI) source, the ionization mode was positive, the scan mode was MRM, the desolvation gas temperature was 550°C, the gas flow rate was 1000 L / h, and the capillary voltage was 3.5 kV.

[0182] The test results showed that after the fermentation of millet peppers with Lactobacillus plantarum FVPGZP2101, 15 volatile substances (such as Figure 8 ), 5 non-volatile substances (such as Figure 9 ) were significantly positively correlated with the strain, and the contents were significantly increased compared with the control group. The volatile substances were acetic acid, n-nonanoic acid, linalool, 2-tridecanone, ethyl isohexanoate, 4-vinylphenol, hexyl valerate, palmitoleic acid, ethyl trans-4-decenoate, n-decanoic acid, heptyl isovalerate, 2-dimethylpropyl 2-methylbutyrate, 3-methylbutyl 4-methylpentanoate, hexyl 8-methylnon-6-enoate, and 6-methyl-4-heptyl 3-methylbutyrate; the non-volatile substances were L-lactic acid, DL-4-hydroxyphenyllactic acid, 3-phenyllactic acid, catechol, and acetylcholine.

[0183] The above results show that Lactobacillus plantarum FVPGZP2101 can metabolize and produce volatile and non-volatile substances. As a fermentation bacterium, it can enhance the flavor and nutritional quality of food.

[0184] In the description of this specification, reference to the terms "one embodiment," "some embodiments," "an embodiment," or "a specific embodiment" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment. Moreover, the specific features, structures, materials, or characteristics described can be combined in any suitable manner in any one or more embodiments. In addition, those skilled in the art may combine and combine different embodiments and features of different embodiments described in this specification without any contradiction.

[0185] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A Lactobacillus plantarum FVPGZP2101, characterized in that The plant lactobacillus FVPGZP2101 was deposited in the General Microbiology Center of the China Culture Collection Administration on December 2, 2024, with the deposit number CGMCC No.32871.

2. A fermentation product, characterized in that include: The Lactobacillus plantarum FVPGZP2101 and / or its metabolites according to claim 1.

3. A microbial preparation, characterized in that include: At least one of the Lactobacillus plantarum FVPGZP2101 according to claim 1 and the fermentation product according to claim 2.

4. The microbial preparation according to claim 3, characterized in that The number of viable bacteria in the microbial preparation is ≥10 8 CFU / g of Lactobacillus plantarum FVPGZP2101; Optionally, when the microbial preparation is liquid, the concentration of Lactobacillus plantarum FVPGZP2101 in the microbial preparation is 1×10 8 ~1×10 10 CFU / mL.

5. A food additive, characterized in that include: At least one of the Lactobacillus plantarum FVPGZP2101 of claim 1, the fermentation product of claim 2, and the microbial preparation of claim 3 or 4.

6. A method for preparing a fermented food, characterized in that: include: The fermented food is obtained by fermenting at least one of the Lactobacillus plantarum FVPGZP2101 according to claim 1, the fermentation product according to claim 2, the microbial preparation according to claim 3 or 4, and the food additive according to claim 5 with food raw materials.

7. The method according to claim 6, characterized in that Before the fermentation process, the food raw material is mixed with sodium chloride; Optionally, based on the mass of the food raw material, the amount of sodium chloride added is 7 to 10 mass%; Optionally, the food material does not include food additives; Optionally, the food ingredients include vegetables, fruits, dairy products, soy products and / or candies; Optionally, the food material includes water; Optionally, the pH during the fermentation treatment is 2.5-6.5, preferably 3-4.

8. A fermented food, characterized in that: The method comprises: the Lactobacillus plantarum FVPGZP2101 according to claim 1, the fermentation product according to claim 2, the microbial preparation according to claim 3 or 4, or the food additive according to claim 5, or is obtained by the method according to claim 6 or 7.

9. Use of the Lactobacillus plantarum FVPGZP2101 according to claim 1, the fermentation product according to claim 2, the microbial preparation according to claim 3 or 4, or the food additive according to claim 5 in the preparation of fermented food.

10. The use according to claim 9, characterized in that The food includes vegetables, fruits, dairy products, soy products and / or candies.

Images