Method for improving rice yield, saline-alkaline resistance and disease resistance based on 35S enhancer knock-in technology

By introducing the 35S enhancer and bZIP domain into the rice genome and combining CRISPR-Cas9 technology to upregulate the expression of the OsMYB106 gene, the problems of rice salt-alkali tolerance and disease resistance were solved, an efficient breeding strategy was implemented, and rice yield and disease resistance were improved.

CN120758554AActive Publication Date: 2025-10-10NORTHEAST NORMAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511163572.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2025-10-10
Estimated Expiration
2045-08-20

AI Technical Summary

Technical Problem

Existing technologies lack effective gene regulation methods to improve rice's salt-alkali tolerance and disease resistance, and traditional transgenic technology has the risk of genome damage and expression instability.

Method used

By knocking the 35S enhancer into the rice genome, using the bZIP domain-encoding gene and the 35S enhancer DNA fragment to upregulate the expression of the OsMYB106 gene, combined with CRISPR-Cas9 technology, rice gene editing is achieved, thereby improving the salt and alkali tolerance and disease resistance of rice.

Benefits of technology

It significantly improved the stress resistance and disease resistance of rice in saline-alkali land, while increasing rice yield, reducing breeding workload and errors, and achieving precise gene regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758554A_ABST
    Figure CN120758554A_ABST
Patent Text Reader

Abstract

The invention provides a method for improving rice yield, saline-alkaline resistance and disease resistance based on a 35S enhancer knock-in technology, and belongs to the technical field of molecular breeding and plant genetic engineering. The invention provides a method for increasing rice OsMYB106 expression through a 35S enhancer knock-in technology so as to improve the rice yield and disease resistance of saline-alkali soil. According to the invention, a DNA fragment containing a 35S enhancer and a plant gene editing vector containing a bZIP structural domain coding gene are used for bombarding rice tissues by using a gene gun, and after the obtained transgenic rice is subjected to salt stress treatment, the stress resistance and yield of the rice under salt and alkali conditions can be greatly improved, the resistance of the rice in rice shutter disease and rice blast infection is improved, and the application prospect is wide. The breeding period of the salt-resistant disease-resistant high-yield rice variety is greatly shortened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding and plant genetic engineering, and particularly relates to a method for improving rice yield, salt-alkali tolerance and disease resistance based on 35S enhancer knock-in technology. Background Art

[0002] Developing and utilizing coastal tidal flats and inland saline-alkali land resources is one effective way to ensure arable land availability. Rice is a moderately salt-sensitive crop, growing in aquatic environments. Rice cultivation can leach soluble salt and alkali from the soil. Therefore, rice is the preferred crop for developing coastal tidal flats and saline-alkali land.

[0003] Manipulating gene expression is crucial for advancing plant traits and agricultural productivity, yet there is a lack of genes for regulating salt-alkali tolerance and disease resistance in rice. Furthermore, traditional gene upregulation methods rely heavily on transgenic technologies. While these technologies have had a significant impact on biotechnology, they also face challenges such as unpredictable genome disruption, variability in expression levels due to ectopic insertions, and intergenerational stability of transgenes. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a OsMYB106 A reagent for regulating gene expression levels, which effectively improves rice yield, salt-alkali tolerance and disease resistance by knocking the 35S enhancer into the rice genome.

[0005] The present invention provides a method for upregulating OsMYB106 Gene expression level reagents, including bZIP A plant gene editing vector containing a domain-encoding gene and a DNA fragment containing a 35S enhancer; described bZIP The domain encoding gene includes the following elements in series: upstream homology arm of the restriction site, the first connecting peptide sequence, bZIP Domain coding sequence and homology arms downstream of the restriction site; The DNA fragment containing the 35S enhancer includes a homologous arm upstream of the 35S enhancer insertion site, a 35S enhancer sequence, a homologous arm downstream of the 35S enhancer insertion site, and bZIP domain targeting sequence; The 35S enhancer insertion site is OsMYB106 Promoter region.

[0006] Preferably, the bZIP Domain-encoding genes bZIP The domain coding sequence is 2 to 3 copies; two adjacent bZIP The domain-encoding genes are connected using a second connecting peptide sequence; The second connecting peptide is 8 copies of the G4S connecting peptide; The first connecting peptide is 5 copies of a G4S connecting peptide.

[0007] Preferably, in the DNA fragment containing the 35S enhancer, bZIP The copy number of the domain targeting sequence is 6 to 7 copies; The 35S enhancer insertion site is OsMYB106 Gene promoter region -200 bp.

[0008] Preferably, the nucleotide sequence of the DNA fragment containing the 35S enhancer is shown in SEQ ID NO: 8; The said bZIP The backbone vector in the plant gene editing vector encoding the gene domain is pYLCRISPR / Cas9Pubi-H carrier.

[0009] The present invention provides a method for preparing the reagent, comprising: The preparation method of the DNA fragment containing the 35S enhancer is as follows: a forward primer containing the upstream homology arm of the 35S enhancer insertion site and a forward primer containing the upstream homology arm of the 35S enhancer insertion site. bZIP The 35S enhancer was amplified using reverse primers targeting the homology arms of the domain targeting sequence and the downstream homology arms of the 35S enhancer insertion site to obtain the 35S enhancer sequence with the homology arms; Chemical synthesis of 35S enhancer sequence homology arms bZIP domain targeting sequence; The 35S enhancer sequence with homology arms and the 35S enhancer sequence containing homology arms bZIP The domain targeting sequence was connected to obtain a DNA fragment containing the 35S enhancer; The said bZIP Preparation method of plant gene editing vector encoding gene domain, for the use of bZIP Forward primer and homology arm containing restriction site downstream bZIP Reverse primer amplification bZIP Domain coding sequence, and obtained homology arms with restriction site bZIP domain-encoding sequences; Chemically synthesized 5' homology arm with a restriction enzyme cleavage site at one end and a bZIP The first connecting peptide sequence of the homology arm at the 5' end of the domain encoding sequence; The homology arms with insertion sites bZIP The structural domain coding sequence and the first connecting peptide sequence are subjected to a recombination reaction with the linear backbone vector after being digested by the endonuclease corresponding to the enzyme cleavage point to obtain a bZIP Plant gene editing vectors containing domain-encoding genes.

[0010] Preferably, when bZIP When the domain coding sequence is 2 copies, the two bZIP The domain encoding sequences are connected by a second connecting peptide sequence; The preparation method of the second connecting peptide sequence is to chemically synthesize a bZIP The homology arm at the 5' end of the domain coding sequence and the other end with bZIP The second connecting peptide sequence of the homology arm at the 3' end of the domain encoding sequence; The second connecting peptide sequence is connected to the homology arm with the enzyme cleavage site bZIP The domain encoding sequence, the first connecting peptide sequence and the linear backbone vector are subjected to a recombination reaction together.

[0011] The present invention provides the use of the reagent or the reagent prepared by the preparation method in preparing transgenic rice varieties and / or rice genetic breeding. The transgenic rice variety and / or the rice variety obtained by rice genetic breeding has at least one of the characteristics of salt-alkali tolerance, disease resistance and high yield.

[0012] Preferably, the disease resistance includes bacterial blight and / or rice blast; The high yield includes at least one of the following: increasing the yield per unit area of ​​rice, increasing the number of grains per rice panicle, and increasing the length of the rice panicle.

[0013] The present invention provides a method for improving rice yield, salt-alkali tolerance and disease resistance based on 35S enhancer knock-in technology, comprising the following steps: The reagent is mixed with gold powder to make micro-bullets, which are then bombarded into rice callus tissue using a gene gun to obtain OsMYB106 Gene overexpression transgenic rice.

[0014] Preferably, the disease resistance includes bacterial blight and / or rice blast; The high yield includes at least one of the following: increasing the yield per unit area of ​​rice, increasing the number of grains per rice panicle, and increasing the length of the rice panicle; The DNA fragment containing the 35S enhancer, bZIP The mass ratio of the plant gene editing vector encoding the domain gene and gold powder is 10:(1-3):10:1000; The bombardment conditions are as follows: 2 The bombardment area is 3~6 MPa, the bombardment pressure is 3~6 MPa, and the bombardment voltage is 9~15V.

[0015] The present invention provides a method for upregulating OsMYB106 Gene expression level reagents, including bZIPA plant gene editing vector containing a structural domain encoding gene and a DNA fragment containing a 35S enhancer; bZIP The domain encoding gene includes the following elements in series: upstream homology arm of the restriction site, the first connecting peptide sequence, bZIP The DNA fragment containing the 35S enhancer includes the upstream homology arm of the 35S enhancer insertion site, the 35S enhancer sequence, the downstream homology arm of the 35S enhancer insertion site and the bZIP Domain targeting sequence; the 35S enhancer insertion site is OsMYB106 The reagent is to upregulate the promoter region of rice by 35S enhancer knock-in technology. OsMYB106 Expression, thereby improving rice salt-alkali tolerance, while also improving rice yield and / or disease resistance; the present invention integrates CRISPR-Cas9 technology with molecular biology to obtain the reagent, which can be used to create an efficient rice salt-tolerant, disease-resistant, and high-yield breeding strategy. Compared with traditional breeding methods, it greatly reduces the workload and breeding years, and accurately controls the breeding sites, reducing the blindness in traditional breeding and the phenotypic judgment errors among breeders. After the reagent is treated in the embodiment of the present invention, OsMYB106 Transgenic rice with upregulated gene expression was grown in a medium containing NaCl and Na2CO3 (Na + The transgenic rice was subjected to saline-alkali stress treatment using rice nutrient solution containing 150 mM 35S enhancer and pH = 10 to observe the survival rate and yield traits. The results showed that the insertion of 35S enhancer can successfully create salt-tolerant and disease-resistant high-yield rice varieties in saline-alkali soil. In the rice plant creation example, the salt-alkali stress resistance and yield were improved, and the resistance to rice bacterial blight and rice blast was also improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] 图1 for pYLCRISPR / Cas9-2×bZIP-Pubi-H vector map; 图2 for OsMYB106 Phenotypic results of salt-alkali stress tolerance of overexpression lines; 图3 for OsMYB106 Statistical results of the survival rate of the overexpression lines resistant to salt and alkali stress; 图4 for OsMYB106 Phenotype and yield statistics of overexpression lines in soda saline-alkali soil; 图5 for OsMYB106 Plant height phenotype and statistical results of overexpression lines in soda saline-alkali soil; 图6 for OsMYB106 The ear length phenotype and statistical results of the overexpression lines in soda saline-alkali soil; 图7 for OsMYB106 Phenotype and statistical results of grain number per ear in soda saline-alkali soil of overexpression lines; 图8 for OsMYB106 Phenotypic and statistical results of the overexpression lines' resistance to bacterial blight and blast in soda saline-alkali soil. DETAILED DESCRIPTION

[0017] The present invention provides a method for upregulating OsMYB106 Gene expression level reagents, including bZIP A plant gene editing vector containing a domain-encoding gene and a DNA fragment containing a 35S enhancer; described bZIP The domain encoding gene includes the following elements in series: upstream homology arm of the restriction site, the first connecting peptide sequence, bZIP Domain coding sequence and homology arms downstream of the restriction site; The DNA fragment containing the 35S enhancer includes a homologous arm upstream of the 35S enhancer insertion site, a 35S enhancer sequence, a homologous arm downstream of the 35S enhancer insertion site, and bZIP domain targeting sequence; The 35S enhancer insertion site is OsMYB106 Promoter region.

[0018] In the present invention, the design concept of the reagent is to knock the 35S enhancer into the rice genome, thereby effectively improving the expression of rice downstream genes ( OsMYB106 ) expression levels, enhances transcription, and achieves enhanced transcriptional activation of the downstream genes, thereby overcoming the limitations of transgenic dependence and improving the stress and disease resistance of rice in saline-alkali soils, while also increasing rice yield. The reagent can be used in rice salt-alkali tolerance, yield increase, and breeding.

[0019] In the present invention, the bZIP domain-encoding genes into plant gene editing vectors bZIP The purpose of the domain coding sequence is to fuse the bZIP domain protein with the Cas9 protein to express it, so that the Cas9 protein has the ability to bind to the target DNA fragment. bZIP Domain-encoding genes bZIP The domain coding sequence is preferably 2 to 3 copies; two adjacent bZIP The domain encoding gene is connected using the second connecting peptide sequence; the second connecting peptide is preferably 8 copies of the G4S connecting peptide. bZIP The tandem connection of the domain encoding genes is conducive to the formation of bZIP domain dimers, which improves the binding ability of the target DNA fragment. The first connecting peptide is preferably a 5-copy G4S connecting peptide. bZIP The insertion site is in the backbone vector of the plant gene editing vector Cas9 3' end of the gene MauB I as an enzyme cutting site to achieve bZIP The insertion of the domain encoding gene. bZIP Homology arm upstream of the insertion site or bZIP The length of the homology arm downstream of the insertion site is preferably 10 to 15 bp. pYLCRISPR / Cas9Pubi-H carrier.

[0020] In the present invention, the DNA fragment containing the 35S enhancer contains the bZIP Domain targeting sequences that can be bZIP The domain dimer specifically recognizes and binds to achieve the purpose of carrying the target inserted fragment. bZIP The copy number of the domain targeting sequence is preferably 6 to 7 copies, which is conducive to being bound and enriched by the bZIP protein. The nucleotide sequence of the DNA fragment containing the 35S enhancer is preferably as shown in SEQ ID NO: 8 (TGAGACTTTCAACAAAGGCTAATATCCGGAAACCTCCTCGGATTCCA The 35S enhancer insertion site is preferably OsMYB106 Gene promoter region -200 bp (TAAGGCATGGAAAATTAGGG, SEQ ID NO: 9).

[0021] The present invention provides a method for preparing the reagent, comprising: a method for preparing the DNA fragment containing the 35S enhancer and a method for preparing the DNA fragment containing the 35S enhancer. bZIP Method for preparing plant gene editing vectors encoding structural domain genes.

[0022] In the present invention, the preparation method of the DNA fragment containing the 35S enhancer is to prepare a forward primer containing the upstream homology arm of the 35S enhancer insertion site and a forward primer containing the upstream homology arm of the 35S enhancer insertion site. bZIPThe 35S enhancer was amplified using reverse primers targeting the homology arms of the domain targeting sequence and the downstream homology arms of the 35S enhancer insertion site to obtain the 35S enhancer sequence with the homology arms; Chemical synthesis of 35S enhancer sequence homology arms bZIP domain targeting sequence; The 35S enhancer sequence with homology arms and the 35S enhancer sequence containing homology arms bZIP The domain targeting sequences were connected to obtain a DNA fragment containing the 35S enhancer.

[0023] In the present invention, the homology arm containing the 35S enhancer sequence bZIP The nucleotide sequence of the domain targeting sequence is shown in SEQ ID NO: 10. The ligation primers include a forward primer with a nucleotide sequence shown in SEQ ID NO: 6 and a reverse primer with a nucleotide sequence shown in SEQ ID NO: 7.

[0024] In the present invention, the bZIP Preparation method of plant gene editing vector encoding gene domain, for the use of bZIP Forward primer and homology arm containing restriction site downstream bZIP Reverse primer amplification bZIP domain coding sequence, and obtain homology arms with insertion sites bZIP domain-encoding sequences; Chemically synthesized one-terminal band Cas9 The 5' end of the gene has a homology arm and the other end has bZIP The first connecting peptide sequence of the homology arm at the 5' end of the domain encoding sequence; The homology arms with insertion sites bZIP The linear backbone vector after the structural domain coding sequence and the first connecting peptide sequence are digested with the endonuclease corresponding to the type of enzyme cleavage site is subjected to a recombination reaction to obtain a linear backbone vector containing bZIP Plant gene editing vectors containing domain-encoding genes.

[0025] In the present invention, the bZIP The nucleotide sequence of the forward primer is shown in SEQ ID NO: 1; the homology arm downstream of the restriction site bZIP The nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2. The nucleotide sequence of the first connecting peptide is shown in SEQ ID NO: 4.

[0026] In the present invention, when bZIP When the domain coding sequence is 2 copies, the two bZIP The domain coding sequences are connected by a second connecting peptide sequence. The preparation method of the second connecting peptide sequence is to chemically synthesize a peptide with a bZIPthe 5' end of the domain coding sequence, the second linker peptide sequence of the 3' end of the domain coding sequence. bZIP the second linker peptide sequence of the 3' end of the domain coding sequence. bZIP the domain coding sequence, the first linker peptide sequence and the linear backbone vector are subjected to a recombination reaction.

[0027] The application provides application of the reagent or the reagent prepared by the preparation method in preparation of a transgenic rice variety and / or rice genetic breeding, and the transgenic rice variety and / or rice genetic breeding has at least one of the following characteristics: salt and alkali tolerance, disease resistance and high yield.

[0028] In the application, the rice variety is not particularly limited, and a rice variety known in the art can be used to carry out experiments, for example, Kitaake and Nipponbare.

[0029] In the application, the salt and alkali tolerance preferably means that the transgenic rice has improved survival rate under salt or alkali conditions compared with a wild type, which indicates that the transgenic rice has improved salt and alkali tolerance.

[0030] In the application, the disease resistance preferably includes bacterial leaf blight and / or rice blast. In an embodiment of the application, the transgenic rice obtained by treating the rice with the reagent has improved survival rate under salt and alkali conditions, OsMYB106 up-regulated expression of the genes, and the transgenic rice has improved resistance to bacterial leaf blight and / or rice blast and reduced leaf disease area.

[0031] In the application, the high yield preferably includes at least one of the following: improved yield per unit area of the rice, improved grain number per panicle of the rice and improved panicle length of the rice. In an embodiment of the application, the transgenic rice obtained by treating the rice with the reagent has improved survival rate under salt and alkali conditions, OsMYB106 up-regulated expression of the genes, and the transgenic rice has improved yield per unit area, improved panicle length and improved grain number per panicle, and the results show that the transgenic rice not only has improved yield per unit area (increased by 30%), but also has improved plant height (increased by about 30%), improved grain number per panicle (increased by 90%) and improved panicle length (increased by 20%), which indicates that the reagent can not only promote the growth of the rice under salt and alkali conditions, but also greatly improve the yield of the rice.

[0032] The application provides a method for improving yield, salt and alkali tolerance and disease resistance of rice based on 35S enhancer knock-in technology, which comprises the following steps: The reagent is mixed with gold powder to prepare microprojectiles, the microprojectiles are bombarded into rice callus by using a gene gun, and OsMYB106 a transgenic rice with overexpressed genes is obtained.

[0033] In the present invention, the moderate disease resistance preferably includes bacterial blight and / or rice blast; and the high yield preferably includes at least one of the following: increased rice yield per unit area, increased number of grains per panicle, and increased panicle length. The disease resistance and high yield are described in the same manner as in the above technical solution and are not further elaborated here.

[0034] In the present invention, the DNA fragment containing the 35S enhancer, bZIP The mass ratio of the plant gene editing vector encoding the domain gene to the gold powder is 10: (1-3): 10: 1000, or 5: 1: 500. The bombardment condition is preferably every 2 cm 2 The bombardment area is preferably 3~6 MPa, and can be 4~5 MPa; the bombardment voltage is preferably 9~15V, and can be 10~13V, and can be 12V.

[0035] In the present invention, the method is to integrate gene gun technology, CRISPR-Cas9 technology and molecular biology to create an efficient rice salt-tolerant, disease-resistant and high-yield breeding strategy. Compared with traditional breeding methods, it greatly reduces the workload and breeding years, and accurately controls the breeding sites, reducing the blindness in traditional breeding and the phenotypic judgment errors among breeders.

[0036] The following is a detailed description of a method for improving rice yield, salt-alkali tolerance and disease resistance based on 35S enhancer knock-in technology provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1 pYLCRISPR / Cas9-2×bZIP-Pubi-H The construction of the vector, see the spectrum 图1 .

[0038] use pYLCRISPR / Cas9Pubi-H The carrier is transformed into a chassis. First design C / EBPα Gene bZIP The cloning primers of the domain were selected. pYLCRISPR / Cas9Pubi-H In the carrier Cas9 3' end of the gene MauB I was used as a restriction site, and the 10 bp nucleotides 3' (downstream) of the restriction site were added as a restriction site to the 5' end of the reverse primer sequence, named C / EBP-bZIP-R. The 10 bp nucleotides 3' of 5×GGGGS were added as a homology arm to the 5' end of the forward primer, named C / EBP-bZIP-F. The specific nucleotide sequences are shown in SEQ ID NO: 1 (CGGCGGCAGCAACGAATATCGCGTGCG) and SEQ ID NO: 2 (CCGCCCGCCGCGCGCAGTTGCCCATCGCTT). Mouse skin tissue genomic DNA was used as a template for cloning. C / EBPα The bZIP domain of the gene was selected after agarose gel electrophoresis and the band of the correct size was recovered from the gel and retained for future use after sequencing was correct.

[0039] By chemical synthesis, 8×GGGGS (amino acid sequence as shown in SEQ ID NO: 11, specific nucleotide sequence as shown in SEQ ID NO: 3, GGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGC) were respectively bZIP The 3' end homology arm (ATCGACGTGA, SEQ ID NO: 15) and the 5' end homology arm (CGAGAGTAGC, SEQ ID NO: 16) of the domain sequence form the second connecting peptide sequence as the connecting sequence of the bZIP protein. The synthetic product is mixed with the above-mentioned gel recovery product and used as a template. C / EBP-bZIP-F and C / EBP-bZIP-R are used as primers for recombinant PCR. The band of the correct size is selected by agarose gel electrophoresis for gel recovery and retained for future use after sequencing is correct.

[0040] The chemical synthesis method was used to synthesize 5×GGGGS (amino acid sequence SEQ ID NO: 12, specific nucleotide sequence such as SEQ ID NO: 4 (GGCGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCAGCGG CGGCGGCGGCAGCGGCGGCGGCGGCAGC) are added to both ends of the DNA fragment Cas9 The 3' homology arm of the gene (TCAGCACGTA, SEQ ID NO: 17) and bZIP Coding sequence 5 ' The end homology arm (CGAGAGTAGC, SEQ ID NO: 18) forms the first connecting peptide sequence for connection bZIP Domain sequences and backbone vectors.

[0041] use MauB I endonuclease, enzyme digestion pYLCRISPR / Cas9Pubi-H After the linearized vector is recovered, it is mixed with the first connecting peptide sequence and the second connecting peptide sequence for seamless cloning recombination reaction (seamless cloning recombinase MH201, purchased from Shanghai Yazyme Biopharmaceutical Technology Co., Ltd.). After the recombination reaction is completed, the product of the recombination reaction is transformed into DH5α competent medium, single clones are picked and sequenced, the correct single clone bacterial solution is selected for expansion culture, and the plasmid is extracted to obtain pYLCRISPR / Cas9-2×bZIP-Pubi-H .

[0042] Example 2 Gene bombardment to knock in and upregulate the 35S enhancer OsMYB106 Establishment of a technical system to improve rice yield and disease resistance in saline-alkali soil 1. Preparation of Insert DNA P OsMYB106-35SE-6×target .

[0043] Synthesize insert DNA using chemical synthesis P OsMYB106-35SE-6×target Insertion DNA P OsMYB106-35SE-6×target The composition of the enhancer was as follows: -200 bp was selected as the enhancer insertion site in the promoter region of the OsMYB106 gene, and 10 bp before and after the insertion site were selected as homology arms (before the insertion site: GACGGCTAAC, SEQ ID NO: 19; after the insertion site: GGGCATCAAT, SEQ ID NO: 20), which were added to the 5' end of the forward primer (ATTGCGCAATATTGCGC, SEQ ID NO: 13) and the 5' end of the reverse primer (GTGGTGGCATGAAAAA, SEQ ID NO: 14) of the 35S enhancer, respectively. A 6× primer was added to the 5' end of the reverse primer. ATTGCGCAAT (SEQ ID NO: 5) sequence homology arm (ATTGCGCAAT , SEQ ID NO: 21). Using the synthesized DNA as a template, after PCR amplification, fragments of the correct size were selected by agarose gel electrophoresis, recovered, and sequenced before use.

[0044] Then use chemical synthesis method to synthesize 6× ATTGCGCAAT The nucleotide sequence of the 5′ end of the 5′ end of the 5′ end of the 35S enhancer was added to form the homology arm of the 35S enhancer-6× ATTGCGCAAT The DNA sequence (GCATGAAAAAATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAATATTGCGCAAT, SEQ ID NO: 10) was retained for future use.

[0045] Primers were designed at the 5' end of the 35S enhancer and at 6× ATTGCGCAAT Primers were designed at the 3' end of the sequence and named target-F and target-R. The specific nucleotide sequences are shown in SEQ ID NO: 6 (ATTGCGCAATATTGCGCA) and SEQ ID NO: 7 (ATCCTTCGTGGTGGCATGAAAAA).

[0046] The two DNA fragments were connected together using overlapping PCR method and kept for later use after gel recovery.

[0047] 2. Transformation of Rice Callus by Gene Gun The above synthesized insert DNA P OsMYB106-35SE-6×target、 Example 1 OsMYB106 gene promoter editing target prepared pYLCRISPR / Cas9-2×bZIP-Pubi-H The carrier and gold powder were mixed at a mass ratio of 10:1:1000 to prepare gene gun microbullets and stored at 4°C.

[0048] Select plump rice seeds, dehull them and sterilize them in a clean bench. After sterilization, inoculate them into callus induction medium and culture them at 32℃ for 7 days.

[0049] Using a gene gun, microprojectiles were bombarded (target area: 2 cm 2 , pressure: 3 MPa, voltage: 9 V) into the callus tissue. After bombardment, seal and store in the dark.

[0050] The positive callus tissue was transferred to differentiation medium to obtain transgenic rice seedlings. After identification, two homozygous transgenic rice plants were obtained. OsMYB106 The overexpressing rice plants are propagated and kept as seeds for future use.

[0051] Example 3 In situ insertion of 35S enhancer overexpression OsMYB106 Creation of genetically salt-tolerant and disease-resistant high-yield varieties 1. Preparation of Gene Gun Method OsMYB106 Gene overexpression transgenic rice After obtaining T2 homozygous transgenic lines using the method in Example 2, rice seedling leaves were taken and total protein was extracted. The wild-type plants were used as controls to identify the amount of OsMYB106 protein in each individual of the transgenic lines. Two plants with high and relatively consistent expression levels were selected and named OsMYB106-OE1 and OsMYB106-OE2 (The following content is referred to as OE1 and OE2 ), and keep the seeds for future use after large-scale propagation.

[0052] 2. Preparation OsMYB106 Genetically modified rice The editing target of the OsMYB106 gene was designed using the Rice CRISPR Target Design website (http: / / crispr.hzau.edu.cn). After synthesizing the target sequence, a CRISPR vector was constructed and introduced into rice plants via Agrobacterium infection of callus tissue. Transgenic seedlings were selected for PCR editing identification. Individuals with premature termination frameshift mutations were selected and retained, and two stable homozygous mutant lines were obtained through self-pollination and multiplication. osmyb106-1 and osmyb106-2 The following contents are referred to as KO1 and KO2 , and are reserved.

[0053] 3. OsMYB106 Phenotype detection of salt-alkali tolerance of transgenic rice with overexpression of OsSOS1 gene.

[0054] Wild type Kitaake and homozygous OsMYB106 transgenic plants with overexpression of OsSOS1 gene OsMYB106-OE1 and OsMYB106-OE2 were moved to nutrient solution containing NaCl and Na2CO3 (Na + content 150 mM, pH = 10) and observed for phenotype after 5 days of treatment, then moved to normal nutrient solution for recovery for 3 days, and survival rate was counted.

[0055] The results showed that, compared with wild type Kitaake, OE-1 and OE-2 the tolerance of plants to salt-alkali stress was enhanced Figure 2 , and the survival rate was significantly higher than that of wild type Kitaake and osmyb106 mutant KO-1 and KO-2 ( Figure 3 ).

[0056] 4. OsMYB106 Phenotype detection of transgenic rice with overexpression of OsSOS1 gene in Northeastern soda-saline land.

[0057] Seeds (about 200 per line) of wild type, KO-1 , KO-2 , OE-1 and OE-2 were evenly sown in seedling trays and grown in a seedling field. When grown to the transplanting stage, they were transplanted to the soda-saline soil test field of the Da'an Experimental Station of the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences in Jilin Province. After maturation, phenotype was observed and yield traits were counted.

[0058] The results showed that, compared with wild type and mutant, OE-1 and OE-2 yield was significantly increased, and unit area yield was increased by about 30% Figure 4 compared with wild type. In addition to total yield, OE-1 and OE-2 plant height was also increased by about 30% Figure 5 compared with wild type. OE-1 and OE-2 panicle length was increased by about 20% Figure 6 , and grains per panicle was increased by about 90% Figure 7 . In summary, OE-1 and OE-2 The increase in yield was mainly due to a significant increase in the number of grains per ear.

[0059] 5. OsMYB106 Phenotypic detection of resistance to bacterial blight and blast in gene-overexpressing transgenic rice grown in soda saline-alkali soil in Northeast China.

[0060] For bacterial blight, cultivate rice to the 4-leaf stage, take the third leaf of rice, cut the leaves, and then activate the bacterial blight pathogen. Xoo (Liang X, Yu X, Pan X, et al. A thiadiazole reduces the virulence of Xanthomonas oryzae pv. oryzae by inhibiting the histidine utilization pathwayand quorum sensing. Mol Plant Pathol. 2018;19(1):116-128.) The cells were dipped into the suspension and placed in a culture dish for incubation under white light for 10 days.

[0061] The results showed that compared with the wild type and mutant, OsMYB106 The lesion area of ​​the leaves of the overexpressing plants was the smallest and the lesion color was the lightest ( Figure 8 (upper middle map).

[0062] For rice blast, cultivate rice to the 4-leaf stage, take the third leaf of rice, cut about 2 cm from the middle of the leaf, make wounds at equal intervals on the back of the leaf with a disposable blade, and use a syringe to absorb the activated rice blast pathogen Guy11 Pan Y, PanR, Tan L, Zhang Z, Guo M. Pleiotropic roles of O-mannosyltr- ansferase MoPmt4 in development and pathogenicity of Magnaportheoryzae [published correction appears in Curr Genet. 2019 Feb;65(1):241. doi:10.1007 / s00294-018-0888-7.]. Curr Genet. 2019;65(1):223-239. ) The suspension was injected into the wound of the leaf and cultured under white light for 7 days.

[0063] The results showed that compared with the wild type and mutant, OsMYB106The overexpression plant leaf has the smallest lesion area, and the gray infection patch in the center of the lesion is the lightest in color Figure 8 Lower middle layer diagram).

[0064] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. An upregulation OsMYB106 A reagent for gene expression level, characterized in that Including bZIP A plant gene editing vector containing a domain-encoding gene and a DNA fragment containing a 35S enhancer; described bZIP The domain encoding gene includes the following elements in series: upstream homology arm of the restriction site, the first connecting peptide sequence, bZIP Domain coding sequence, homology arm downstream of restriction site; The DNA fragment containing the 35S enhancer includes a homologous arm upstream of the 35S enhancer insertion site, a 35S enhancer sequence, a homologous arm downstream of the 35S enhancer insertion site, and bZIP domain targeting sequence; The 35S enhancer insertion site is OsMYB106 Promoter region.

2. The reagent according to claim 1, characterized in that described bZIP The copy number of the domain coding sequence is 2 to 3 copies; two adjacent bZIP The domain-encoding genes are connected using a second connecting peptide sequence; The second connecting peptide is 8 copies of G4S connecting peptide; The first connecting peptide is 5 copies of the G4S connecting peptide.

3. The reagent according to claim 1, characterized in that In the DNA fragment containing the 35S enhancer, bZIP The copy number of the domain targeting sequence is 6 to 7 copies; The 35S enhancer insertion site is OsMYB106 Gene promoter region -200 bp.

4. The reagent according to any one of claims 1 to 3, characterized in that The nucleotide sequence of the DNA fragment containing the 35S enhancer is shown in SEQ ID NO: 8; The said bZIP The backbone vector in the plant gene editing vector encoding the gene domain is pYLCRISPR / Cas9Pubi- H carrier.

5. The method for preparing the reagent according to any one of claims 1 to 4, characterized in that: include: The preparation method of the DNA fragment containing the 35S enhancer is as follows: a forward primer containing the upstream homology arm of the 35S enhancer insertion site and a forward primer containing the upstream homology arm of the 35S enhancer insertion site. bZIP The 35S enhancer was amplified using reverse primers targeting the homology arms of the domain targeting sequence and the downstream homology arms of the 35S enhancer insertion site to obtain the 35S enhancer sequence with the homology arms; Chemical synthesis of 35S enhancer sequence homology arms bZIP domain targeting sequence; The 35S enhancer sequence with homology arms and the 35S enhancer sequence containing homology arms bZIP The domain targeting sequence was connected to obtain a DNA fragment containing the 35S enhancer; The said bZIP Preparation method of plant gene editing vector encoding gene domain, for the use of bZIP Forward primer and homology arm containing restriction site downstream bZIP Reverse primer amplification bZIP Domain coding sequence, and obtained homology arms with restriction site bZIP domain-encoding sequences; Chemically synthesized 5' homology arm with a restriction enzyme cleavage site at one end and a bZIP The first connecting peptide sequence of the homology arm at the 5' end of the domain encoding sequence; The homology arms with insertion sites bZIP The structural domain coding sequence and the first connecting peptide sequence are subjected to a recombination reaction with a linear backbone vector digested with an endonuclease of the type corresponding to the enzyme cleavage point to obtain a bZIP Plant gene editing vectors containing domain-encoding genes.

6. The preparation method according to claim 5, characterized in that: when bZIP When the domain coding sequence is 2 copies, the two bZIP The domain encoding sequences are connected by a second connecting peptide sequence; The preparation method of the second connecting peptide sequence is to chemically synthesize a bZIP The 5' end of the domain coding sequence has a homology arm, and the other end has bZIP The second connecting peptide sequence of the homology arm at the 3' end of the domain encoding sequence; The second connecting peptide sequence is connected to the homology arm with the enzyme cleavage site bZIP The domain encoding sequence, the first connecting peptide sequence and the linear backbone vector are subjected to a recombination reaction together.

7. Use of the reagent according to any one of claims 1 to 4 or the reagent prepared by the preparation method according to claim 5 or 6 in preparing transgenic rice varieties and / or rice genetic breeding. The transgenic rice variety and / or the rice variety obtained by rice genetic breeding has at least one characteristic of salt-alkali tolerance, disease resistance and high yield.

8. The application according to claim 7, characterized in that: The disease resistance includes bacterial blight and / or rice blast; The high yield includes at least one of the following: increasing the yield per unit area of ​​rice, increasing the number of grains per rice panicle, and increasing the length of the rice panicle.

9. A method for improving rice yield, salt-alkali tolerance and disease resistance based on 35S enhancer knock-in technology, characterized in that: The following steps are involved: The reagent according to any one of claims 1 to 4 is mixed with gold powder to prepare micro-bullets, and the micro-bullets are bombarded into rice callus tissue using a gene gun to obtain OsMYB106 Gene overexpression transgenic rice.

10. The method according to claim 9, characterized in that: The disease resistance includes bacterial blight and / or rice blast; The high yield includes at least one of the following: increasing the yield per unit area of ​​rice, increasing the number of grains per rice panicle, and increasing the length of the rice panicle; The DNA fragment containing the 35S enhancer, bZIP The mass ratio of the plant gene editing vector encoding the domain gene to the gold powder is 10:(1-3):1000; The bombardment conditions are as follows: 2 The bombardment area is 3~6 MPa, the bombardment pressure is 3~6 MPa, and the bombardment voltage is 9~15V.

Citation Information

Patent Citations

  • Cloning and application of rice salt-stress-resistant gene OsMYB106

    CN111778261A

  • Rice OsTCP11 gene and application thereof in rice disease resistance

    CN119193618A