Indel molecular marker related to color of chicken green-shell egg and application of Indel molecular marker
By developing an ACT-inserted InDel molecular marker upstream of the chicken SLCO1B3 gene and combining it with the PCR-RFLP method, the problem that existing technologies could not accurately identify the genotype of green-shell laying hens in southwest China was solved, and rapid and efficient green-shell laying hen breeding was achieved.
Patent Information
- Application Number
- CN202511029617.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2025-10-10
AI Technical Summary
Existing molecular marker methods are unable to accurately identify the genotypes of Lueyang green-shell laying hens and Jiuyuan green-shell laying hens in southwest China, resulting in low efficiency in green-shell laying hen selection.
An InDel molecular marker was developed, located at the ACT insertion site between positions 65222792 and 65222793 on chromosome 1 of the chicken reference genome GRCg7b version. Genotype identification was performed using the amplification product digested with BsrG I in combination with the PCR-RFLP method.
It achieves rapid and accurate distinction between homozygotes and heterozygotes, reduces breeding costs, and improves the selection efficiency and genetic progress of green-shell laying hens.
Smart Images

Figure CN120758642A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biology-assisted breeding, and specifically provides an InDel molecular marker related to the color of chicken green-shell eggs and an application thereof. Background Art
[0002] As people's living standards improve, green-shelled eggs, considered high-end eggs, are becoming increasingly popular in the egg market. Molecular breeding techniques have been widely applied to purify green-shell laying hens, overcoming the long breeding years and low selection efficiency associated with traditional breeding. For example, Dongxiang Green-Shell Laying Hens and Lushi Green-Shell Laying Hens have utilized this technology to create homozygous green-shelled laying hen lines.
[0003] The most common green-shell laying hen mutation in China is the EAV-HP insertion, cloned by Wang Zhepeng et al. in 2013, into the 5' flank of the SLCO1B3 gene. Recent research has discovered another green-shell laying hen mutation in southwestern China (including Chongqing, Sichuan, and Shaanxi). Representative breeds include the Lueyang and Jiuyuan green-shell laying hens. These green-shell laying hens are interbred with green-shell laying hens harboring the EAV-HP insertion mutation, making it difficult to genotype these birds using the EAV-HP insertion mutation detection method. Wang Zhepeng et al. (2022, 2024) reported that SNP markers upstream and in the fourth intron of the SLCO1B3 gene are strongly associated with the new green-shell laying hen gene. However, further research by our research group found that these SNPs are not 100% associated with the new green-shell phenotype; the causative mutation in the new green-shell gene is not a reported SNP marker. Identification of the new green-shell gene in chickens requires more stable molecular markers. The development of new molecular markers and the use of molecular marker-assisted selection can accelerate the breeding of new green-shell laying hens and provide new materials and new strategies for the improvement of domestic chicken germplasm resources. Summary of the Invention
[0004] In order to solve the problem of low selection efficiency of new green-shell laying hens, the inventors conducted a lot of research and selected green-shell laying hens without EAV-HP insertion mutations as experimental materials (mainly Lueyang green-shell laying hens and Jiuyuan green-shell laying hens). The causative mutation of the new green-shell laying hens was identified. The site of the InDel molecular marker is located between bases 65222792 and 65222793 on chromosome 1 of the chicken reference genome GRCg7b version, that is, between positions 3802 and 3803 upstream of the SLCO1B3 gene, and the inserted base there is ACT. The InDel site is closely related to the new green-shell egg phenotype of the chicken.
[0005] On the one hand, the present application discloses an InDel molecular marker related to the color of chicken green-shell eggs. The InDel molecular marker is located between bases 65222792 and 65222793 on chromosome 1 of the chicken reference genome GRCg7b version, and is an insertion and deletion of the base ACT.
[0006] Furthermore, the nucleotide sequence of the InDel molecular marker is SEQ ID NO.3 or SEQ ID NO.4.
[0007] On the other hand, the present application provides a kit for detecting the above-mentioned InDel molecular marker, which comprises a primer pair for amplifying the position of the above-mentioned Indel molecular marker and a restriction endonuclease.
[0008] Furthermore, the nucleotide sequences of the primer pair are SEQ ID NO.1 and SEQ ID NO.2.
[0009] Furthermore, the restriction endonuclease is BsrG I.
[0010] Furthermore, the kit also contains Taq enzyme, dNTP, and buffer.
[0011] On the other hand, the present application provides a method for identifying green-shell laying hens using the above-mentioned InDel molecular markers, the method comprising: using a primer pair with sequences such as SEQ ID NO.1 and SEQ ID NO.2 to amplify the genomic DNA of the chicken to be tested; using BsrG I enzyme to digest the amplified product; and detecting the enzyme digestion product by electrophoresis.
[0012] Further, if the enzyme digestion product is a 129bp fragment, or the enzyme digestion product is a 129bp fragment and a 171bp fragment, the hen to be tested is a hen that lays green-shell eggs; if the enzyme digestion product is a 171bp fragment, the hen to be tested is a hen that does not lay green-shell eggs.
[0013] Furthermore, the green-shell laying hens are Lueyang green-shell laying hens, Jiuyuan green-shell laying hens or Jingyuan chickens.
[0014] On the other hand, the present application provides the application of the above method in breeding laying hens producing green shell eggs.
[0015] Furthermore, the hens to be tested whose enzyme digestion products are 129 bp fragments are selected for breeding.
[0016] Compared with the existing green-shell egg shell color breeding technology, the present invention has the following advantages and effects:
[0017] (1) The present invention studies and determines the molecular markers that affect the shell color of green-shelled eggs. When using the molecular markers for molecular marker-assisted selection, the present invention does not require sequencing and can accurately distinguish between homozygous and heterozygous samples. The method has the advantages of being fast, efficient, low-cost, and simple to operate;
[0018] (2) The present invention also provides the sequence of the InDel molecular marker and the primers for identification. By using the molecular marker and primer, a rapid, efficient and accurate molecular marker-assisted breeding technology can be established using the PCR-RFLP method to select individuals with the genotype of producing green-shelled eggs. This technology can be used for early breeding, reducing breeding costs and improving production efficiency.
[0019] (3) The identification efficiency of the InDel molecular marker provided in this study is 100%. The use of this InDel molecular marker can effectively improve the genetic progress of green-shell eggshell color and achieve the purpose of rapid breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments.
[0021] Figure 1 This is the Manhattan plot of the genome-wide association study (GWAS) of green-shell eggshell color between Jiuyuan green-shell laying hens and brown-shell laying hens. The horizontal axis represents the chromosome number of the chicken; the vertical axis represents the -logP value, and the horizontal line represents the significant expression level threshold.
[0022] Figure 2 A schematic diagram of the primer design strategy for inserting ACT into the promoter region of the New Green Shell Layer marker. The sequence in the figure is the upstream region of the New Green Shell Layer promoter, and ACT is its significantly associated InDel sequence;
[0023] Figure 3 The results of identifying the genotype of the new green-shelled eggs of Lueyang chickens with known EAV-HP insertion genotypes are shown in the figure. In the figure, M is marker 2000, lanes 1-9 are Lueyang new green-shelled laying hens (all without EAV-HP insertions), and lanes 10-18 are Lueyang brown-shelled laying hens (all without EAV-HP insertions).
[0024] Figure 4 The results of identification of the new green-shelled egg genotype of Jiuyuan chickens with known EAV-HP insertion genotypes are shown. M is marker 2000, lanes 1-12, 14, and 16 are from Jiuyuan new green-shelled laying hens (all without EAV-HP insertions), and lanes 13, 15, and 17-24 are from Jiuyuan brown-shelled laying hens (all without EAV-HP insertions).
[0025] Figure 5 The identification results of new green-shelled egg gene genotypes of Yimeng green-shelled egg chickens with known EAV-HP insertion genotypes, wherein M is marker 2000, lanes 1-3 correspond to samples of new green-shelled egg chicken genotypes BB, Bb and bb respectively, and lanes 4-8 are Yimeng green-shelled egg chickens (all with EAV-HP insertion), and lanes 9-18 are Yimeng brown-shelled egg chickens (all without EAV-HP insertion);
[0026] Figure 6 The identification results of new green-shelled egg gene genotypes of Bailaihang and Dongxiang green-shelled egg chickens with known EAV-HP insertion genotypes, wherein M is marker 2000, lanes 1-3 correspond to samples of new green-shelled egg chicken genotypes BB, Bb and bb respectively, lanes 4-13 are Bailaihang chickens (all without EAV-HP insertion), and lanes 14-22 are Dongxiang green-shelled egg chicken samples (all with EAV-HP insertion). DETAILED DESCRIPTION
[0027] The following examples facilitate a better understanding of the present application, but are not limited thereto, and are only for illustrative purposes, which in no way limit the protection scope of the present application.
[0028] Except for special instructions, the equipment and reagents used in each example are all commonly commercially available.
[0029] Example 1 Genome-wide association study and resequencing analysis
[0030] Fourteen green-shelled egg chicken breeds were collected from 11 provinces in China, and more than 600 DNA samples from different green-shelled egg chickens were detected for EAV-HP insertion in the 5' flanking region of the SLCO1B3 gene. The research results show that all green-shelled egg chickens carry EAV insertion mutant alleles except for Jiuyuan (JY) and Liuyang (LY) chickens in Sichuan and Shaanxi. There are EAV-HP insertion types and new green-shelled egg genotypes without EAV-HP insertion in Jiuyuan and Liuyang green-shelled egg chickens. The entire genomic region of the SLCO1B3 gene and the DNA sequence of about 8.9 kilobases (Kb) upstream of the Jiuyuan and Liuyang green-shelled chickens without EAV-HP insertion were further amplified, but no EAV-HP insertion fragment was detected, which indicates that there are different causative mutations in the green-shelled egg phenotype of these two breeds and other breeds. In order to find out the potential new mutations that cause the green-shelled egg of Jiuyuan and Liuyang chicken breeds, 149 chickens of green-shelled and brown-shelled phenotypes in these two breeds were genotyped (all without EAV-HP insertion) using high-density chips, and genome-wide association study (GWAS) was performed on the green-shelled egg traits of Jiuyuan and Liuyang populations respectively.
[0031] (1) Wing vein blood was collected from Jiuyuan and Lueyang hens, and genomic DNA was extracted using the standard phenol-chloroform method. DNA quality and concentration were determined using standard procedures, and DNA with an OD 260 / 280 ratio between 1.8 and 2.0 was selected as qualified for subsequent testing. The DNA was diluted to a concentration of 50 ng / μL for genotyping.
[0032] (2) Genotyping was performed using the Affymetrix Chicken 600K High-Density Gene Chip. Genotyping and quality control were performed according to the chip instructions, including quality control using PLINK v 1.9, single nucleotide polymorphism (SNP) detection rate > 0.9, individual detection rate > 0.9, minimum allele frequency > 0.05, and Hardy–Weinberg equilibrium test P value > 1E-6. Considering a window size of 25 SNPs, a step size of every 5 SNPs, and pairwise r 2 All SNPs were pruned with a threshold of 0.2.
[0033] (3) GWAS analysis was performed using GCTA software and linear mixed models. Meta-analysis of genome-wide association studies was performed using Metal software. Population structure was assessed using ADMIXTURE, and mixed analysis was performed using TreeMix. The results of the GWAS analysis are shown in Figure 2. Figure 1 As shown, a significantly associated region was found on chromosome 1. Subsequently, we conducted a GWAS meta-analysis on the Jiuyuan and Lueyang breeds and identified 25 single nucleotide polymorphisms (SNPs) significantly associated with the green-shelled egg phenotype, including 3 completely associated SNPs, which can be used to infer homozygosity and heterozygosity in the Jiuyuan and Lueyang breeds.
[0034] (4) To further investigate the genomic mutations that cause green-shelled eggs in the Jiuyuan and Lueyang varieties, we performed whole-genome sequencing on 13 green-shelled and brown-shelled DNA samples from these two varieties and found a variety of genomic variations, including structural variations (SVs), copy number variations (CNVs), insertions / deletions (InDels), and SNPs. We compared the absolute allelic differences between dominant and recessive homozygotes and found that multiple SNPs and two InDels near the SLCO1B3 gene on chromosome 1 were segregated with the relative phenotypes. The genotypes of these variants were completely consistent with the green-shelled and brown-shelled phenotypes. The isolated SNPs and two InDels were located in non-coding regions, and 16 of the SNPs were located in the introns of SLCO1B3. The alleles in the green-shelled population were all new mutations relative to the reference genome. One of the inDels is an insertion of three nucleotides (ACT) located between bases 65,222,792 and 65,222,793 on chromosome 1 of the chicken reference genome, version GRCg7b, that is, between bases 3802 and 3803 upstream of the SLCO1B3 gene. PCR validation revealed that the ACT molecular marker is 100% associated with the green shell phenotype, indicating that ACT is the causative mutation of the neo-green shell phenotype.
[0035] Example 2 Establishment of a method for detecting alleles in new green-shelled chicken eggs
[0036] The kit contains the following components: the primer pair, the restriction endonuclease BsrGI (NEB), and 2×Taq PCR mastermix (Beijing Xinhuitiandongfang Technology Co., Ltd.).
[0037] (1) For the target fragment of the ACT insertion site disclosed in the present invention, such as Figure 2 The primers introduced with the BsrGI restriction site amplified a 173 bp nucleotide fragment. The upstream and downstream primers for sequence amplification are:
[0038] Upstream primer Blue-F: AAGGAGAAACAGAACAAGTG (SEQ NO. 1)
[0039] Downstream primer Blue-R: ATATATTTTTATAAAATAATTATCCTTCTAGTTCCACAGTTGTAC (SEQ NO. 2)
[0040] (2) PCR amplification:
[0041] Unless otherwise specified, the experimental methods used in the following examples are all routine experimental operations.
[0042] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0043] ① Collect blood samples from the chickens to be tested, extract DNA using the phenol-imide extraction method, and dilute to a concentration of 50 ng / μL.
[0044] ②PCR amplification of the target gene containing the molecular marker, the amplification system is as follows:
[0045]
[0046] The PCR reaction procedure is as follows:
[0047] 95℃5min
[0048] 95℃30s
[0049] 56℃30s
[0050] 72℃30s
[0051] 72℃7min
[0052] Loop 35 times
[0053] Take 5 μL of PCR product and use 1% agarose gel electrophoresis to check whether PCR amplification is successful. The PCR amplification product Blue_SEQ is Sanger sequenced at Shanghai Bioengineering Co., Ltd., and the gene fragment is subjected to both forward and reverse reactions. The obtained sequence is compared with the chicken reference genome GRCg7b to obtain the corresponding SNP marker site mutation, such as Figure 4 shown.
[0054] The PCR amplification product Blue_SEQ is shown as SEQ NO. 3 (without insertion) or SEQ NO. 4 (with InDel insertion).
[0055] SEQ NO.3:
[0056]
[0057] SEQ NO.4:
[0058]
[0059] TTATAAAAATATAT.
[0060] Note: SEQ NO.4 is the sequence containing ACT insertion. The variant sequence is bolded and underlined. The beginning and end of the sequence are bolded as primer sequences.
[0061] (3) After successful PCR amplification, Bsr G I Enzyme digestion was performed according to the instructions, and 8 μL of the digestion product was taken and used to determine the genotype of the chicken new green shell egg using 3% agarose gel.
[0062] BB genotype: the enzyme cleavage product is a single band of 129 bp (phenotype is producing green-shelled eggs); Bb genotype: the enzyme cleavage product is two bands of 171 bp and 129 bp (phenotype is producing green-shelled eggs); (a3) bb genotype: the enzyme cleavage product is a single band of 171 bp (phenotype is producing brown or white shelled eggs).
[0063] (4) The newly established PCR-RFLP method was used to identify the genotypes of different breeds of chickens (such as Lueyang green-shell laying hens, Jiuyuan green-shell laying hens, Yimeng chickens, Bailaihang and Dongxiang green-shell laying hens, etc.). The identification results are as follows: Figure 3-Figure 6 The present application discovered that another green-shell egg mutation exists in southwestern China (including Chongqing, Sichuan, Shaanxi, etc.). This mutation is concentrated in Lueyang green-shell laying hens and Jiuyuan green-shell laying hens, but is not found in other green-shell laying hens. Figure 3 、 Figure 4 The test results showed that the new mutation was 100% associated with the green shell trait. The green shell laying hens were all BB and Bb, while the brown shell laying hens were all bb. Figure 5 、 Figure 6 The test results showed that the new mutation was not present in the Yimeng green-shell laying hens, Bailaihang, and Dongxiang green-shell laying hens, all of which had the genotype bb. The newly established PCR-RFLP method was further validated in a large number of samples from multiple breeds, and the results showed that the molecular markers in this application can accurately identify the genotype of the new green-shell laying hens.
Claims
1. An InDel molecular marker related to the color of chicken green-shell eggs, characterized in that: The InDel molecular marker is located between bases 65222792 and 65222793 on chromosome 1 of the chicken reference genome GRCg7b version, and is an insertion and deletion of the base ACT.
2. The InDel molecular marker according to claim 1, wherein the nucleotide sequence of the InDel molecular marker is SEQ ID NO. 3 or SEQ ID NO.
4.
3. A kit for detecting the InDel molecular marker according to claim 1 or 2, characterized in that: The kit comprises a primer pair for amplifying the position of the Indel molecular marker and a restriction endonuclease. The kit according to claim 3 , wherein the nucleotide sequences of the primer pair are SEQ ID NO. 1 and SEQ ID NO.
2. The kit according to claim 3 or 4, wherein the restriction endonuclease is BsrG I. The kit according to claim 3 , further comprising Taq enzyme, dNTP, and buffer.
7. The method for identifying green-shell laying hens using the InDel molecular marker according to claim 1, characterized in that: The method comprises: using a primer pair with sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 to amplify genomic DNA of a chicken to be tested; using BsrG I enzyme to digest the amplified product; detecting the digestion product by electrophoresis; and identifying green-shell laying hens based on the digestion product.
8. method according to claim 7, wherein said green-shell laying hens are mainly Lueyang green-shell laying hens or Jiuyuan green-shell laying hens or Jingyuan chickens.
9. The method according to claim 7 or 8, wherein the green-shell laying hens are identified based on the enzyme digestion product: if the enzyme digestion product is a 129 bp fragment, or the enzyme digestion product is a 129 bp fragment and a 171 bp fragment, the chicken to be tested is a green-shell laying hen; if the enzyme digestion product is a 171 bp fragment, the chicken to be tested is a non-green-shell laying hen.
10. Use of the method according to any one of claims 7 to 9 in breeding green-shell laying hens.