SNP (Single Nucleotide Polymorphism) molecular marker for regulating and controlling horn length of sheep and application of SNP molecular marker

By using SNP molecular markers on chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0, the length of sheep horns can be accurately identified, which solves the problem of lack of direct markers in existing technologies and achieves early precision breeding and improvement of survival adaptability.

CN120758645AActive Publication Date: 2025-10-10SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511281592.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2025-10-10
Estimated Expiration
2045-09-09

AI Technical Summary

Technical Problem

The existing technology lacks SNP molecular markers directly related to sheep horn length, which makes it difficult to accurately screen sheep individuals with ideal horn length, affecting breeding efficiency and survival adaptability.

Method used

The SNP molecular marker at chromosome 17, position 35071069, of the sheep reference genome ARS-UI_Ramb_v2.0 was provided. By detecting the T/C mutation type, using a specific primer set for PCR amplification and using fluorescence signals to distinguish genotypes, the accurate identification of sheep horn length was achieved.

Benefits of technology

It has achieved early and accurate identification of sheep horn length genotypes, breaking through the bottleneck of traditional breeding relying on phenotypic measurements after maturity, optimizing breeding efficiency, and improving the survival adaptability and breeding management benefits of sheep.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758645A_ABST
    Figure CN120758645A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker for sheep horn length regulation and control and application thereof. The SNP molecular marker is characterized in that T / C mutation exists at the site 35071069 of the No.17 chromosome of a sheep reference genome AR-UIRambv2.0, and T / C mutation exists at the site 35071069 of the No.17 chromosome of the sheep reference genome. The sheep horn length can be identified by using the SNP molecular marker provided by the invention, and breeding can be selectively carried out according to environmental adaptability.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to a SNP molecular marker for regulating the horn length of sheep and application thereof. BACKGROUND

[0002] In the field of animal morphology research, the related discussion of animal horn length has not been given enough attention compared to other physiological characteristics, and there are relatively few research reports on this topic at home and abroad. Animal horns, as a prominent external feature, play a role as a weapon in fighting, but also may be closely related to sexual selection, environmental adaptation and many other factors in species. In nature, most animals have moderate or small-sized horns, but there are some special animal species, such as some wild animal breeds and some ruminants in high mountain environments, whose horns are unusually long. Long horns may help to dominate in territorial disputes or intra-population competition, especially in relatively wide geographical environments and intense survival competition, long-horned animals can deter opponents and attract the opposite sex through the prominence of horns, thereby gaining more opportunities in reproduction and survival competition. At the same time, the length and structure of the horn may also have a potential link to the animal's perception of the surrounding environment and its own balance regulation.

[0003] In this particular species of sheep, the difference in horn length is also a product of adaptive evolution. Traditional concepts believe that the horns of sheep generally have moderate length, but after in-depth observation of different breeds of sheep, it is found that there are obvious differences in horn length. The formation of these differences may be influenced by a variety of factors, including the living environment of sheep, genetic composition, and long-term breeding selection by humans. Sheep with moderate-length horns may have reached a relatively balanced state in the process of survival and reproduction, while sheep with excessively long or short horns may exhibit their own unique advantages and disadvantages in specific environmental conditions. For example, in complex terrain, excessively long horns may hinder the movement of sheep, affecting their ability to avoid predators and efficiently forage; while in some scenarios that require horn display to compete for mates or territory, moderate horn length may not meet their survival competition needs.

[0004] With the rapid development of molecular biology and genomics technology, the use of molecular markers to assist animal breeding has become a reality. In-depth exploration of the genetic mechanism of sheep horn length can not only reveal the genetic mystery behind the variation of horn length, but also play a key role in the breeding practice of sheep, i.e. precisely selecting sheep individuals with ideal horn length characteristics, so that they can better adapt to specific ecological environments and meet the production management requirements of animal husbandry. Therefore, genetic research on sheep horn length has significant practical application value and potential scientific significance, but detailed genetic research reports on this topic are still relatively scarce. SUMMARY

[0005] The main purpose of the present invention is to provide a SNP molecular marker related to sheep horn length. The SNP molecular marker can be used to accurately perform gene selection, thereby efficiently breeding sheep with ideal horn length, making up for the technical defect of the existing technology that there is a lack of SNP molecular markers directly related to sheep horn length.

[0006] The present invention adopts the following technical solutions to achieve the above-mentioned purpose: The first aspect of the present invention provides a SNP molecular marker that affects the length of sheep horns. The SNP molecular marker is a T / C mutation at site 35071069 of chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0. When the genotype of the polymorphic site of the SNP molecular marker is TT or CC, the sheep horn length is a large-horn type; when the genotype is TC, the sheep horn length is a small-horn type.

[0007] The second aspect of the present invention provides a primer set for detecting SNP molecular markers related to sheep horn length, the primer set comprising: a forward primer F1 with a nucleotide sequence as shown in SEQ ID NO.1, a forward primer F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a reverse primer R with a nucleotide sequence as shown in SEQ ID NO.3.

[0008] Furthermore, the physical position of the SNP molecular marker is based on the 35071069th site of chromosome 17 of the sheep reference genome version ARS-UI_Ramb_v2.0, and the polymorphism of this site is T / C.

[0009] Furthermore, the 5'-end of the forward primer F1 is connected to a FAM-tail universal fluorescent tag sequence, and the 5'-end of the forward primer F2 is connected to a HEX-tail universal fluorescent tag sequence.

[0010] A third aspect of the present invention provides a detection kit containing the above primer set for detecting SNP molecular markers associated with sheep horn length.

[0011] The fourth aspect of the present invention provides any of the following applications of the above-mentioned primer set and the above-mentioned detection kit: (1) Application in sheep horn length identification; (2) Application in molecular marker-assisted breeding of sheep.

[0012] A fifth aspect of the present invention provides a method for identifying the length of sheep horns, the method comprising: using the DNA of the sheep to be tested as a template, and performing PCR amplification on it using the above-mentioned primer set; directly distinguishing the genotype and the correlation between the genotype and the length of the sheep horns through fluorescent signals, and identifying the length of the sheep horns.

[0013] Further, the genotype includes a TT genotype, a CC genotype, and a TC genotype, wherein the sheep horn length is large horn type when the genotype is TT or CC, and the sheep horn length is small horn type when the genotype is TC.

[0014] The beneficial effects of the present application are as follows: The sheep horn length is closely related to its survival adaptability and breeding management: large horn individuals can effectively resist the invasion of natural enemies by relying on horn defense in a free-range environment, reducing the risk of predation of lambs, while small horn phenotype significantly reduces the casualty rate caused by fighting in intensive breeding, and optimizes the space utilization rate of the shed. Through the SNP molecular marker provided by the present application, the horn length related genotype (TT / TC / CC) can be accurately identified in the lamb period, breaking through the technical bottleneck of traditional breeding relying on mature phenotype measurement. The marker supports early selection of breeding sheep with target horn length characteristics, which can not only cultivate adaptive strains for different breeding modes (such as highland grazing and factory feeding), but also reduce the cost of invalid feeding through genotyping. In addition, the marker data can deeply analyze the molecular regulation network of horn development, provide cross-dimensional genetic information for sheep disease resistance breeding and behavior characteristic research, and ultimately realize the coordinated optimization of the improvement of the resistance ability of the population and the economic benefit of animal husbandry. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 is a genotyping chart in Example 1; Figure 2 is a box plot of SNP and sheep horn length phenotype correlation analysis in Example 1. DETAILED DESCRIPTION

[0016] The specific embodiments of the present application are described below to facilitate those skilled in the art to understand the present application, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all applications utilizing the concept of the present application are within the scope of protection.

[0017] Example 1: Identification of sheep horn length using SNP molecular marker chr17: 35071069 1. Experimental object: A total of 35 small-tail Han sheep were selected (Table 3).

[0018] 2. SNP molecular marker detection: (1) Collect 5 mL of venous blood from sheep and extract DNA using the traditional CTAB method. Calculate the DNA stock solution based on the concentration and mix it with nuclease-free water to dilute it to 20 ng / ul. Dilute the primer powder to 100 uM with nuclease-free water, and then prepare the primer mixture according to the ratio of F1:F2:R:water = 24:24:48:100.

[0019] Forward primer F1 (SEQ ID NO. 1): GAAGGTCGGAGTCAACGGATTCGGCTATCTGTTGCCTCTAGGT; Forward primer F2 (SEQ ID NO. 2): GAAGGTGACCAAGTTCATGCTGGCTATCTGTTGCCTCTAGGC; Reverse primer R (SEQ ID NO. 3): GAAACTGGATTAGTCCCATTCTAAA.

[0020] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using specific primers for SNP molecular markers. The amplification system is shown in Table 1, and the amplification procedure is shown in Table 2 to obtain PCR products. Table 1 PCR amplification system

[0021] Table 2 PCR amplification procedure

[0022] (3) After the PCR amplification cycle is completed, the fluorescence value is read using a fluorescent quantitative PCR instrument in an environment below 40°C, the PCR products are sequenced, and then the sequencing results are analyzed using the LGC_OMEGA genotype reading software (Kluster Caller). The genotypes are divided into three types according to the sample cluster and fluorescence type: TT, TC, and CC. Figure 1 shown.

[0023] (4) Result determination: After removing the three samples with CC genotype and the unused sample that lacked horn length data, the horn length of the sheep was determined to be large-horn type or small-horn type according to the different genotypes; sheep with TT or CC genotypes were large-horn type; sheep with TC genotypes were small-horn type.

[0024] Table 3 Marker identification of 35 Small Tail Han sheep

[0025] SNP correlation analysis of sheep horn length Figure 2 As shown in the figure, sheep with the TT or CC gene at locus 35071069 on chromosome 17 in the sheep reference genome ARS-UI_Ramb_v2.0 are large-horned sheep, with an average horn length of 40.1 cm for sheep with the TT gene and 28.3 cm for sheep with the CC gene. Sheep with the TC gene at locus 35071069 on chromosome 17 in the sheep reference genome ARS-UI_Ramb_v2.0 are small-horned sheep, with an average length of 9.7 cm. The difference in horn length based on the gene is significant.

Claims

1. A primer set for detecting SNP molecular markers associated with sheep horn length, characterized in that: The primer set includes: a forward primer F1 having a nucleotide sequence as shown in SEQ ID NO. 1, a forward primer F2 having a nucleotide sequence as shown in SEQ ID NO. 2, and a reverse primer R having a nucleotide sequence as shown in SEQ ID NO.

3.

2. The primer set according to claim 1, characterized in that The physical position of the SNP molecular marker is based on the 35071069th site of chromosome 17 of the sheep reference genome version ARS-UI_Ramb_v2.0, and the polymorphism of this site is T / C.

3. The primer set according to claim 1, wherein The 5'-end of the forward primer F1 is connected to the FAM-tail universal fluorescent tag sequence, and the 5'-end of the forward primer F2 is connected to the HEX-tail universal fluorescent tag sequence.

4. A detection kit comprising the primer set according to claim 1 for detecting SNP molecular markers associated with sheep horn length.

5. Any of the following uses of the primer set according to claim 1 or the detection kit according to claim 4: (1) Application in sheep horn length identification; (2) Application in molecular marker-assisted breeding of sheep.

6. A method for determining the length of sheep horns, characterized in that: The method comprises: using the DNA of the sheep to be tested as a template and performing PCR amplification on it using the primer set described in claim 1; directly distinguishing the genotype and the correlation between the genotype and the sheep horn length through fluorescent signals, and identifying the sheep horn length.

7. The method according to claim 6, characterized in that The genotypes include TT genotype, CC genotype and TC genotype. When the genotype is TT or CC, the sheep's horn length is a large-horn type; when the genotype is TC, the sheep's horn length is a small-horn type.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to size of sheep horn and application of SNP molecular marker

    CN118547079A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to sheep horn length character and application thereof

    CN119320831A

  • SNP (Single Nucleotide Polymorphism) molecular genetic marker related to sheep horn length character and application of SNP molecular genetic marker

    CN119351575A