Improved BCG bacillus calmette guerin vaccine

Abstract

The present invention relates to a recombinant Mycobacterium bovis BCG strain comprising a plasmid having a short guide RNA (sgRNA) target sequence for knocking out the Mb3739 gene. Also provided are vaccine compositions for eliciting an immune response against Mycobacterium tuberculosis comprising a recombinant Mycobacterium bovis BCG strain engineered to activate the NOD-1 pathway. The recombinant Mycobacterium bovis BCG strain or vaccine composition can be used in a method against an immune response initiated by Mycobacterium tuberculosis. The invention also relates to a method for obtaining the recombinant bovine mycobacterium BCG strain.

Description

TECHNICAL FIELD

[0001] The present invention relates to recombinant Mycobacterium bovis BCG strains and vaccine compositions for eliciting an immune response against Mycobacterium tuberculosis. The recombinant Mycobacterium bovis BCG strains or vaccine compositions can be used in methods for eliciting an immune response against Mycobacterium tuberculosis and can be used as tuberculosis (TB) vaccines. The present invention also relates to methods of producing the recombinant Mycobacterium bovis BCG strains. BACKGROUND

[0002] Tuberculosis (TB) caused by Mycobacterium tuberculosis (Mtb) remains a leading cause of infectious disease mortality worldwide. Despite the existence of the Bacille Calmette-Guerin (BCG) vaccine for TB, approximately 2 billion people worldwide are latently infected with Mtb and will become potential carriers of active disease in the future. BCG is the only licensed TB vaccine and has been in use since the 1920s, with nearly 1 billion infants having been vaccinated globally to date. BCG is protective against tuberculous meningitis and miliary TB in children; however, the vaccine is not completely protective against adult TB, with efficacy ranging between 0-80%. In fact, the efficacy of BCG is believed to be completely diminished in adulthood. The traditional BCG strain was made by repeatedly culturing a pathogenic Mycobacterium bovis strain in the laboratory until the strain lost genetic material and became too weak to be pathogenic, but was still sufficient to induce an immune response as a vaccine.

[0003] Several TB vaccine candidates have been developed, some of which have successfully entered clinical trial phases. However, despite decades of research, no TB vaccine candidate has been found that induces sterilizing immunity. This is partly due to the limited understanding of the protective correlates required to clear Mtb infection. In most preclinical mouse challenge experiments of TB vaccine candidates, only a 1-1.5 log reduction in Mtb colony forming units (CFU) was achieved when administered intradermally or subcutaneously, which is generally considered to be sufficient protection for further development. Intravenous inoculation of mice and non-human primates with conventional BCG has been shown to induce sterilizing immunity against Mtb infection. Some studies have emphasized the role of trained innate immunity induced by BCG, which is a factitious innate immune memory that relies on the NOD-2 pathway for the development of anti-TB immunity, in addition to the role of helper T cell-1 (Th1)-mediated immune responses and antibody responses. These findings have reinvigorated interest in the use of recombinant BCG strains that have been engineered to produce various immunomodulatory molecules, including pro-inflammatory cytokines, bacterial toxins, and other non-protein immunomodulatory molecules, to target innate immunity. Other strategies to improve the efficacy of BCG include the deletion of immune escape / suppression genes from BCG to induce an enhanced anti-TB immune response.

[0004] NOD-1 is a ubiquitously expressed intracellular innate pathogen recognition receptor (PRR) that senses the component iE DAP of bacterial peptidoglycan (PG) during infection. NOD-1 appears to be important for the rapid detection of bacterial infection, particularly Gram-negative bacterial infection. Activation of NOD-1 triggers the production of pro-inflammatory cytokines through nuclear factor kappa B (NF-κΒ) and mitogen-activated protein kinase (MAPK). Mycobacterium evade activation of NOD-1 by modifying the NOD-1 ligand iE-DAP to iQ-DAP, thus increasing the immune evasion / suppression strategy. Amidation of peptidoglycan is an immune evasion strategy because amidated peptidoglycan cannot be recognized by the human NOD-1 system. Therefore, the BCG vaccine does not produce a long-lasting immune response, and although this vaccine is given to infants, the protective immunity it confers wanes at puberty. Protection in adults varies greatly. Therefore, the present invention seeks to address at least some of the current limitations of BCG vaccine. SUMMARY

[0005] The present invention relates to a Mycobacterium bovis BCG strain comprising disrupted expression of the Mb3739 gene, in particular a recombinant Mycobacterium bovis BCG strain comprising a plasmid having a short guide RNA (sgRNA) target sequence for knocking out the Mb3739 genome. Also provided is a method of producing a Mycobacterium bovis BCG strain comprising a disrupted Mb3739 gene. The present invention also relates to a vaccine composition comprising the recombinant Mycobacterium bovis BCG strain. The recombinant Mycobacterium bovis BCG strain or vaccine composition can be used in a method of eliciting an immune response against Mycobacterium tuberculosis in a subject.

[0006] According to a first aspect of the present invention, there is provided a Mycobacterium bovis BCG strain comprising disrupted expression of the Mb3739 gene. The skilled person will appreciate that several methods of disrupting gene expression are known, including the use of recombinant DNA technology. Preferably, the Mycobacterium bovis BCG strain described herein is a recombinant Mycobacterium bovis BCG strain.

[0007] In a first embodiment of the Mycobacterium bovis BCG strain of the present invention, the recombinant Mycobacterium bovis BCG strain can comprise a plasmid having a short guide RNA (sgRNA) target sequence for knocking out the expression of the Mb3739 gene.

[0008] According to a second embodiment of the Mycobacterium bovis BCG strain of the present invention, the sgRNA can target the 5' region of the murT-gatD operon.

[0009] In a third embodiment of the Mycobacterium bovis BCG strain of the present invention, the sgRNA can comprise the nucleotide sequence of SEQ ID NO: 3.

[0010] In a fourth embodiment of the Mycobacterium bovis BCG strain of the application, the plasmid can be a CRISPRi-dCas9 plasmid.

[0011] According to a fifth embodiment of the Mycobacterium bovis BCG strain of the application, the disruption or knockdown of the expression of the Mb3739 gene can result in a modification of the peptidoglycan in the Mycobacterium bovis BCG strain.

[0012] In another embodiment of the Mycobacterium bovis BCG strain of the application, the modification reduces the amidation of the peptidoglycan to activate the NOD-1 pathway.

[0013] In another embodiment of the Mycobacterium bovis BCG strain of the application, the recombinant Mycobacterium bovis BCG strain comprising the modification is capable of eliciting an immune response against Mycobacterium tuberculosis.

[0014] According to a second aspect of the application, there is provided a method for producing a recombinant Mycobacterium bovis BCG strain comprising an interruption of the expression of the Mb3739 gene, the method comprising the steps of: a) cloning a short guide RNA (sgRNA) target sequence for knocking down the genomic expression of the Mb3739 gene into a CRISPRi-dCas9 plasmid to obtain a cloning plasmid; and b) introducing the cloning plasmid from step a) into Mycobacterium bovis BCG, wherein the cloning plasmid results in a downregulation of the expression of the Mb3739 gene in the recombinant Mycobacterium bovis BCG strain.

[0015] In a first embodiment of the method for producing a recombinant Mycobacterium bovis BCG strain of the application, the sgRNA can comprise the nucleotide sequence of SEQ ID NO: 3.

[0016] According to a second embodiment of the method for producing a recombinant Mycobacterium bovis BCG strain, the knockdown of the expression of the Mb3739 gene can result in a modification of the peptidoglycan in the Mycobacterium bovis BCG strain.

[0017] In a third embodiment of the method for producing a recombinant Mycobacterium bovis BCG strain of the application, the modification can reduce the amidation of the peptidoglycan to activate the NOD-1 pathway.

[0018] According to a fourth embodiment of the method for producing a recombinant Mycobacterium bovis BCG strain of the application, the introduction of the cloning plasmid into the Mycobacterium bovis BCG strain can be by electroporation.

[0019] In a third aspect of the application, there is provided a recombinant Mycobacterium bovis BCG strain produced by the method for producing a recombinant Mycobacterium bovis BCG strain of the application.

[0020] According to a fourth aspect of the present invention, there is provided a vaccine composition comprising the Mycobacterium bovis BCG strain of the present invention as described herein.

[0021] In one embodiment of the vaccine composition of the present invention, the composition may further comprise a pharmaceutically acceptable carrier or adjuvant.

[0022] According to a fifth aspect of the present invention, there is provided a method for eliciting an immune response against Mycobacterium tuberculosis in a subject (preferably a human subject), the method comprising administering to the subject an immunogenic effective amount of the recombinant Mycobacterium bovis BCG strain of the present invention as described herein or the vaccine composition of the present invention as shown herein.

[0023] In another aspect of the present invention, there is provided a method for eliciting an immune response against Mycobacterium tuberculosis in a subject (preferably a human subject) using the recombinant Mycobacterium bovis BCG strain of the present invention as described herein or the vaccine composition of the present invention as shown herein, the method comprising administering to the subject an immunogenic effective amount of the recombinant Mycobacterium bovis BCG strain or the vaccine composition. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Non-limiting embodiments of the present invention will now be described, by way of example only, with reference to the following drawings:

[0025] Figure 1 Knockdown of murT-gatD gene expression using CRISPRi-dCas9 was shown. Short guide RNAs targeting the murT-gatD dual gene operon were introduced into the BCG strain.

[0026] Figure 2 Schematic diagram showing the mechanism of CRISPRi in bacteria. Schematic diagram of CRISPRi-mediated transcriptional repression. Anhydrotetracycline (ATc)-inducible (P Tet dCas9 is guided to a specific DNA target by an ATc-inducible sgRNA, which then blocks transcription initiation or elongation. RNAP: RNA polymerase; NT: non-template; T: template.

[0027] Figure 3 The murT-gatD operon showing the MurT (Mb3739)-GatD (Mb3740) sequence is shown. The PAM sequence is shown in the box and the sgRNA sequence is underlined. This sequence is referred to as SEQ ID NO: 1.

[0028] Figure 4Schematic showing the murT-gatD deletion in rBCG::iE-DAP was hypothesized to reduce PG amidation leading to NOD-1 and NOD-2 activation.

[0029] Figure 5 qPCR data showing CRISPRi depletes murT-gatD in rBCG::CRISPRi-murT-gatD. Activation of CRISPRi with ATc (200 ng / ml) leads to inhibition of murT expression.

[0030] Figure 6 NOD-1 and NOD-2 gene expression measured by quantitative PCR in unactivated (A&B) and INFy activated (C&D) THP-1 macrophages stimulated with E. coli, WT BCG and rBCG::iE-DAP.

[0031] Figure 7 Schematic showing murT-gatD mediated amidation of PG precursors.

[0032] Figure 8 Phenotypic characterization of rBCG::CRISPRi-murT-gatD: Scanning electron micrographs of WT BCG and rBCG-CRISPRi-murT-gatD grown in media supplemented with 200 ng / ml ATc. Depletion of murT-gatD in rBCG-CRISPRi-murT-gatD leads to outer wall defects (cell wall rugae and invaginations).

[0033] Figure 9 Phenotypic characterization of rBCG::CRISPRi-murT-gatD: Frequency of cells with cell wall defects.

[0034] Figure 10 Phenotypic characterization of rBCG::CRISPRi-murT-gatD: Minimal inhibitory concentrations of antibiotics targeting cell wall biosynthesis in wild-type BCG and rBCG-CRISPRi-murT-gatD grown in media supplemented with 200 ng / ml Atc. AMX: amoxicillin, CLV: clavulanate, MPM: meropenem, VANC: vancomycin, ETM: ethionamide. Depletion of murT-gatD in rBCG-CRISPRi-murT-gatD leads to increased sensitivity to cell wall targeting antibiotics.

[0035] Figure 11Phenotypic characterization of rBCG::CRISPRi-murT-gatD is shown: murT-gatD-depleted cells labeled with fluorescent BODIPY-FL vancomycin exhibit lateral wall labeling.

[0036] Figure 12 Phenotypic characterization of rBCG::CRISPRi-murT-gatD is shown: Transmission electron micrographs of WT BCG and rBCG-CRISPRi-murT-gatD grown in medium supplemented with 200 ng / ml ATc. Depletion of murT-gatD results in cell wall defects.

[0037] Figure 13 Shown are the phenotypic characteristics of rBCG::CRISPRi-murT-gatD: the frequency of cells with cell wall defects.

[0038] Figure 14 Figure 2 Phenotypic characterization of rBCG::CRISPRi-murT-gatD: Flow cytometric analysis of WT BCG and rBCG-CRISPRi-murT-gatD cells labeled with a PG amidation reporter probe (TAMRA-Ala-D-Glutamine-L-Lys-D-Ala [TetraFI]). Depletion of murT-gatD resulted in increased labeling of the PG amidation reporter, indicating reduced PG amidation in murT-gatD-depleted cells.

[0039] Figure 15 Depletion of MurT and GatD results in reduced PG amidation: (A) Schematic diagram of the evaluation of PG amidation in murT-gatD-depleted cells by labeling PG with Alexa Fluor 488 NHS ester compared to control cells (ATc- and WT BCG). Primary amines (R-NH2) labeled with Alexa Fluor 488 NHS ester are also found in PG due to amidation. (B) Quantification of Alexa Fluor 488 NHS ester-labeled PG from murT-gatD-depleted cells, with no ATc control cells serving as a control. MurT-gatD depletion results in reduced PG amidation, which results in reduced labeling with Alexa Fluor 488 NHS ester.

[0040] Figure 16rBCG::CRISPRi-murT-gatD enhances Mtb H37Rv killing capacity of macrophages derived from trained U937 monocytes: Macrophages derived from monocytes trained with heat-killed rBCG were able to control the growth of Mtb H37Rv, which was significantly different from macrophages derived from monocytes trained / stimulated with BCG, LPS, MDP and non-stimulated macrophages (RPMI control). Statistical analysis was performed using Student's t-test: p value: <0.01.

[0041] Figure 17 Analysis of rBCG-CRISPRi-murT-gatD in IFNy activation, survival and proinflammatory cytokine release from bone marrow-derived macrophages (BMDM): IFNy activated BMDM (1 x 105cells) were infected with BCG and rBCG at MOI (multiplicity of infection): 1. ATc was added to the medium for induction of the CRISPRi system in rBCG at a concentration range of 100 ng / ml - 500 ng / ml and the growth of the strains was assessed after 3 and 5 days. Addition of 400-500 ng / ml of ATc in the medium resulted in a significant reduction in the growth of rBCG at day 5 compared to WT BCG. 6

[0042] Figure 18 Analysis of proinflammatory cytokine release: TNFa and IL-6 levels secreted by non-activated and IFNy-activated BMDM infected with WT BCG and rBCG-CRISPRi-murT-gatD at MOI 1 :20. No differences were observed in IL-6 secretion by WT BCG or rBCG-CRISPRi-murT-gatD infected BMDM. An increase in TNF secretion was observed in IFNy-activated BMDM infected with rBCG-CRISPRi-murT-gatD cultured in medium supplemented with 500 ng / ml ATc. LPS was used as a control.

[0043] Figure 19 In vitro growth rate of WT BCG represented by OD 600 (Figure A) and CFU count (Figure B) and rBCG-CRISPRi-murT-gatD represented by OD 600 (Figure C) and CFU count (Figure D) at different concentrations of ATc (A&C) and Dox (B&D) in complete 7H9 medium.

[0044] Figure 20 Determination of Dox concentration for activation of rBCG-CRISPRi-murT-gatD in vivo. About 2.5 log 10 ​Recombinant BCG and Dox (doses of 0.125-1 mg / kg / day) aerosol infected mice were dosed by oral gavage for 10 days. Shown are CFU counts from the experiment. Dox at a dose of 1 mg / kg / day resulted in reduced growth of rBCG-CRISPRi-murT-gatD, indicating that the CRISPRi system was fully activated. Lung homogenates were plated on 7H11 with and without kanamycin (25 g / ml) to assess loss of CRISPRi plasmid during in vivo growth. There was no difference in growth of recovered bacteria on media containing kanamycin, indicating that the CRISPRi plasmid was present in the recovered bacteria. Statistical analysis used Student's t-test. *: p-value < 0.05.

[0045] Figure 21 Efficacy of 1 mg / kg / day dose of doxycycline on CRISPRi activation: Schematic of aerosol infection of mice with WT BCG and rBCG::CRISPRi-murT-gatD and efficacy analysis of 1 mg / kg / day dose of doxycycline on CRISPRi-murT-gatD activation in vivo.

[0046] Figure 22 Efficacy of 1 mg / kg / day dose of doxycycline on CRISPRi activation: Day 1 implantation of WT BCG and rBCG::CRISPRi-murT-gatD in lungs of aerosol infected mice.

[0047] Figure 23 Efficacy of 1 mg / kg / day dose of doxycycline on CRISPRi activation: Panel A = Day 28 lung bacterial burden of WT BCG and rBCG infected mice: Panel B = Chart of CFUs of lung bacterial burden at day 28; Panel C = Day 56 lung bacterial burden of WT BCG and rBCG::CRISPRi-murT-gatD aerosol infected mice; Panel D = Chart of CFUs of lung bacterial burden at day 56.

[0048] Figure 24 Efficacy of 1 mg / kg / day dose of doxycycline on CRISPRi activation: PCR amplification of dCas9 in large or small rBCG::CRISPRi-murT-gatD colonies recovered as shown in Figure 23

[0049] Figure 25 Efficacy of 1 mg / kg / day dose of doxycycline on CRISPRi activation: rBCG::CRISPRi-murT-gatD in liquid broth supplemented with doxycycline as shown in Figure 21 ​Growth kinetics of large and small colonies (shown). Statistical analysis was performed using the Student's t-test. *: p-value: <0.01.

[0050] Figure 26 Schematic diagram showing analysis of rBCG::CRISPRi-murT-gatD strain attenuation: Schematic diagram of aerosol infection of SCID mice with WT BCG and rBCG::iE-DAP for analysis of strain attenuation. In vivo activation of rBCG::iE-DAP was achieved by administering Dox at a dose of 1 mg / kg / day. SCID mice (n=5 per group) were aerosol-infected with approximately 100 colony-forming units (CFU) / mouse of WT BCG or rBCG::iE-DAP. A WT BCG+Dox group was included as a control.

[0051] Figure 27 Shown is analysis of rBCG::CRISPRi-murT-gatD strain attenuation: Percent survival of SCID mice after low-dose challenge with WT BCG and rBCG compared to WT BCG+Dox or rBCG+Dox groups.

[0052] Figure 28 Shown is the efficacy of rBCG::CRISPRi-murT-gatD in preventing M. tuberculosis H37Rv infection in mice compared to standard WT BCG: Schematic diagram of the mouse immunization and M. tuberculosis H37Rv challenge protocol.

[0053] Figure 29 Shown is the efficacy of rBCG::CRISPRi-murT-gatD in protecting against MtbH37Rv infection in mice compared to standard WT BCG: percent weight change immediately before Mtb challenge.

[0054] Figure 30 The efficacy of rBCG::CRISPRi-murT-gatD in protecting mice from Mtb H37Rv infection compared to standard WT BCG is shown: Lung (Panel A) and spleen (Panel B) weights at 4 and 8 weeks after Mtb challenge. Bacterial inoculum size in the lung (Panel C) and spleen (Panel D) at 4 and 8 weeks after Mtb challenge. At 4 and 8 weeks after Mtb challenge, rBCG::CRISPRi-murT-gatD+Dox was superior to WT BCG or WT BCG+Dox in controlling Mtb H37Rv growth in the lungs. Statistical analysis was performed using the Student's t-test. *: p-value < 0.05.

[0055] Figure 31Figures 20 and 21 show histopathological analysis of lung samples: Figures A and B = Histological hematoxylin and eosin (H&E) staining of lung samples at week 4 after Mtb challenge. Analysis of the percentage of lung inflammation area per mouse in each immunization group (n=5 per group) showed that mice immunized with rBCG::CRISPRi-murT-gatD+Dox developed early lung inflammation compared to WT BCG+Dox. Figures C and D = Histological hematoxylin and eosin (H&E) staining of lung samples at week 8 after Mtb H37Rv infection. Analysis of the percentage of lung inflammation area per mouse (n=5 per group) showed that mice immunized with rBCG::CRISPRi-murT-gatD+Dox developed sustained lung inflammation compared to WT BCG and WT BCG+Dox. The percentage of inflamed area was assessed using ImageJ software (NIH) and plotted as whisker boxplots (whiskers represent minimum and maximum values). Statistical analysis was performed using Student's t-test. *: p-value < 0.05.

[0056] Sequence Listing

[0057] The nucleic acid and amino acid sequences listed in this paper or the appended sequence listing are shown using standard letter abbreviations for nucleotide bases and amino acid standard one or three letter abbreviations. It will be understood by those skilled in the art that only one strand is shown for each nucleic acid sequence, but the complementary strand is included in the shown strand.

[0058] SEQ ID NO: 1 - Nucleotide sequence of the murT-gatD operon

[0059] SEQ ID NO: 2 - Nucleotide sequence of PAM located on the template strand

[0060] SEQ ID NO: 3 - Nucleotide sequence of sgRNA located on the template strand

[0061] SEQ ID NO: 4 - Nucleotide sequence of CRISPRi forward primer

[0062] SEQ ID NO: 5-nucleotide sequence of CRISPRi reverse primer

[0063] SEQ ID NO: 6 - Nucleotide sequence of MurT (MB 3739) gene

[0064] SEQ ID NO: 7—Nucleotide sequence of GatD (MB 3740) gene

[0065] SEQ ID NO: 8—Nucleotide sequence of the PAM binding region

[0066] SEQ ID NO: 9 – Nucleotide sequence of the sgRNA binding region DETAILED DESCRIPTION

[0067] The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the invention are shown.

[0068] The invention described is not to be limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the invention. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0069] As used throughout the specification and the claims that follow, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0070] The terms and expressions used herein are for descriptive purposes and should not be considered limiting. As used herein, the terms "including," "comprising," "having," and "comprising" and variations thereof are intended to encompass the items listed thereafter and their equivalents as well as additional items. However, as a specific embodiment of the present disclosure, the term "including" encompasses the possibility that no additional members may be present, that is, in some embodiments, "including" should be understood to mean "consisting of."

[0071] The inventors of the present invention have developed a modified Mycobacterium bovis BCG vaccine. In this study, the inventors have characterized a BCG vaccine redesigned by CRISPRi that activates the NOD-1 pathway by targeting the elimination of peptidoglycan (PG) amidating enzymes (MurT and GatD). In the present invention, the inventors provide a recombinant BCG strain carrying a CRISPRi-dCas9 plasmid with a short guide RNA for targeting the promoter region of the gene Mb3739 (MurT), which encodes a glutaminase that forms an enzyme complex with an aminotransferase (GatD) that modifies the stem peptide structure of the peptidoglycan in Mycobacterium bovis BCG, enabling transcriptional repression of the target gene Mb3739. Inducing the CRISPRi system in this bacterial strain leads to changes in the bacterial cell wall, particularly the amidation of peptidoglycan subunits, which is believed to have the ability to activate an enhanced innate immune response. The inventors further demonstrated that the recombinant BCG vaccine of the present invention activates the NOD-1 pathway by quantitative PCR analysis of NOD-1 transcription in THP-1 macrophages grown in vitro.

[0072] Mycobacteria amidate the stem peptides of their peptidoglycans, a modification that occurs on peptidoglycan monomers while they are still being synthesized inside the cell. When the monomers are exported to the extracellular space to build the cell wall, these modified peptidoglycan monomers undergo cross-linking and are exposed on the cell surface. Therefore, the inventors of the present invention targeted the amidotransferase complex, murT-gatD (i.e., modifying iE-DAP to iQ-DAP), necessary for PG amidation, to develop a recombinant BCG vaccine with reduced PG amidation. Depletion of murT-gatD by CRISPRi reduced bacterial growth, caused disturbances in cell wall morphology observed by scanning and transmission electron microscopy, and sensitized the bacteria to antibiotics targeting the cell wall. Labeling cells depleted of murT-gatD with a fluorescent PG-amidation reporter probe showed an increase in cells labeled with the probe, indicating that PG-amidation decreased when murT-gatD was depleted. This was confirmed by comparing PG from a recombinant BCG strain with PG from a wild-type (WT) BCG vaccine labeled with an amide-reactive dye.

[0073] The inventors hypothesized that murT-gatD depletion in BCG would lead to increased expression of the NOD-1 ligand (iE-DAP) and increase the immunogenicity of the recombinant strain. Therefore, they further tested the activation of the NOD-1 pathway in THP-1 macrophages and indeed observed NOD-1 activation, as assessed by quantitative PCR, showing an increase in NOD-1 transcription in THP-1 macrophages infected with the recombinant BCG strain. The survival and immunogenicity of the recombinant BCG strain in mouse bone marrow-derived macrophages (BMDM) were also tested. First, the inventors analyzed the survival of the strain in IFNγ-activated BMDM after CRISPRi activation, and secondly analyzed the expression of cytokines by ELISA. Activation of CRISPRi during infection of BMDM with rBCG::CRISPRi murT-gatD revealed a decrease in bacterial survival in vivo and an increase in the production of the proinflammatory cytokine TNFα rather than IL-6. Aerosol infection experiments in mice with rBCG::CRISPRi-murT-gatD compared with wild-type (WT) BCG revealed activation of rBCG::CRISPRi murT-gatD after administration of doxycycline, a tetracycline analog capable of activating CRISPRi, as evidenced by the recovery of bacteria that formed small colonies compared to WT BCG that formed typical mycobacterial colonies on solid agar medium, although colony-forming units were similar among the groups tested.

[0074] Inoculation of mice with rBCG::CRISPRi murT-gatD and subsequent activation of the CRISPRi system by administration of doxycycline to induce murT-gatD depletion prior to Mtb infection significantly reduced the Mtb inoculum in the lungs of rBCG::CRISPRi murT-gatD inoculated mice compared to mice inoculated with no vaccine and WT BCG or WT BCG inoculated mice given doxycycline as a control. This study demonstrates that targeting essential mycobacterial genes that produce immunomodulatory molecules enhances the immunogenicity of BCG and improves the efficacy of BCG against M. tuberculosis infection in mice.

[0075] A "protein," "peptide," or "polypeptide" is any chain of two or more amino acids, including naturally occurring or non-naturally occurring amino acids or amino acid analogs, regardless of post-translational modifications (e.g., glycosylation or phosphorylation).

[0076] An "antigen" is a compound, composition, or substance that is capable of stimulating the production of antibodies and / or a CD4+ or CD8+ T cell response in an animal, including a composition that is injected or absorbed into the animal. An antigen reacts with products of specific humoral or cellular immunity, including products induced by heterologous immunogens. The term "antigen" includes all relevant antigenic epitopes. An "epitope" refers to a site on an antigen that includes a chemically reactive group or a

[0077] The terms "nucleic acid," "nucleic acid molecule," and "polynucleotide" are used interchangeably herein and include ribonucleotides (RNA) and deoxyribonucleotides (DNA), including cDNA, genomic DNA, and synthetic DNA. A nucleic acid can be double-stranded or single-stranded. When a nucleic acid is single-stranded, the nucleic acid can be sense or antisense. A nucleic acid molecule can be any chain of two or more covalently bonded nucleotides, including naturally occurring or non-naturally occurring nucleotides, or nucleotide analogs or derivatives. "RNA" refers to a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides. The term "DNA" refers to a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides. "cDNA" refers to complementary or copy DNA produced from an RNA template by the action of an RNA-dependent DNA polymerase (reverse transcriptase). Thus, a "cDNA clone" refers to a double-stranded DNA sequence complementary to a RNA molecule of interest, which is carried in a cloning vector.

[0078] The term "complementary" refers to two nucleic acid molecules, e.g., DNA or RNA, that are capable of forming Watson-Crick base pairs, thereby creating a double-stranded region between the two nucleic acid molecules. Those skilled in the art will appreciate that each nucleotide in a nucleic acid molecule need not form a matching Watson-Crick base pair with a nucleotide in the opposite complementary strand to form a duplex. Thus, a nucleic acid molecule is "complementary" to a second nucleic acid molecule if the nucleic acid molecule hybridizes to the second nucleic acid molecule under high stringency conditions. Nucleic acid molecules according to the present application include both complementary molecules.

[0079] In some embodiments of the present application, nucleic acid molecules are described for improving BCG. The nucleic acid molecules can be substantially identical to the nucleotide sequences described herein.

[0080] As used herein, a "substantially identical" sequence is an amino acid or nucleotide sequence that differs from a reference sequence only in one or more conservative substitutions, or one or more non-conservative substitutions, deletions, or insertions, which are located in a sequence position that does not destroy or substantially reduce the antigenicity of the expressed polypeptide or polypeptide encoded by the nucleic acid molecule. Alignment for purposes of determining percent sequence identity can be achieved using various methods known to those skilled in the art. These methods include, e.g., using computer software, such as ALIGN, Megalign (DNASTAR), CLUSTALW, or BLAST software. Those skilled in the art can easily determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length sequence being compared. In one embodiment of the present application, polypeptide or polynucleotide sequences having at least about 80% sequence identity, at least about 90% sequence identity, or even higher sequence identity, such as about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity, to the sequences described herein are provided.

[0081] Alternatively, or in addition, two nucleic acid sequences can be "substantially identical" if they hybridize under high stringency conditions. One of ordinary skill in the art can readily determine "stringency" of a hybridization reaction, often as a function of probe length, wash temperature, and salt concentration. Generally, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization is often dependent on the ability of a denatured DNA to renature when the complementary strand is present in an environment below its melting temperature. A typical example of "stringent" hybridization conditions are hybridization under gentle agitation at 65°C for 18 hours, in wash buffer A (0.5% SDS; 2X SSC), and in wash buffer B (0.1% SDS; 0.5% SSC).

[0082] Those skilled in the art will appreciate that polypeptide, peptide or peptide analogs can be synthesized using standard chemical techniques, for example, by automatic synthesis using solution or solid phase synthesis. Automatic peptide synthesizers are commercially available and use technology known in the art. Polypeptide, peptide and peptide analogs can also be prepared using recombinant DNA technology from their corresponding nucleic acid molecules.

[0083] As used herein, the term "gene" refers to a nucleic acid encoding a functional product, such as RNA, a polypeptide or a protein. A gene may include regulatory sequences upstream or downstream of the sequence encoding the functional product.

[0084] As used herein, the term "coding sequence" refers to a nucleic acid sequence that encodes a specific amino acid sequence. On the other hand, a "regulatory sequence" refers to a nucleotide sequence located upstream, downstream, or within a coding sequence. Typically, regulatory sequences influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, effector binding sites, enhancers, introns, polyadenylation recognition sequences, promoters, RNA processing sites, stem-loop structures, and translation leader sequences.

[0085] In some embodiments, the gene used in the method of the present invention can be operably linked to other sequences." operably linked " refers to that the nucleic acid molecule encoding the recombinant polypeptide of the present invention and the regulating sequence are connected in such a way that when the appropriate molecule is combined with the regulating sequence, protein expression is allowed. This operably linked sequence can be included in a vector or expression construct, which can be transformed or transfected into a host cell for expression. It should be understood that any vector can be used to express a recombinant antigenic polypeptide of the present invention.

[0086] The term "promoter" refers to a DNA sequence that is capable of controlling the expression of a nucleic acid coding sequence or functional RNA. A promoter can be entirely based on a natural gene, or it can be composed of different elements from different promoters found in nature. Different promoters can direct the expression of a gene in different cell types, or at different developmental stages, or in response to different environmental or physiological conditions. A "constitutive promoter" refers to a promoter that directs the expression of a gene of interest in most host cell types at most times.

[0087] The term "recombinant" refers to something that has been recombined. When used in reference to a nucleic acid construct, the term refers to a molecule comprising nucleic acid sequences that are joined or created using molecular biological techniques. The term "recombinant" when used in reference to a protein or polypeptide refers to a protein or polypeptide molecule expressed from a recombinant nucleic acid construct that was generated using molecular biological techniques. A recombinant nucleic acid construct can include nucleotide sequences that are joined to or manipulated to be joined to nucleic acid sequences that are not joined to them in nature, or are joined to them at a different location in nature. Thus, a recombinant nucleic acid construct indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e., by human intervention. A recombinant nucleic acid construct can be introduced into a host cell by transformation. Such a recombinant nucleic acid construct can include sequences from the same host cell species or from a different host cell species.

[0088] The term "vector" refers to a means by which a polynucleotide or gene sequence can be introduced into a cell. Various types of vectors are known in the art, including plasmids, viruses, phages, and cosmids. Typically, a polynucleotide or gene sequence is introduced into a vector by way of a cassette. The term "cassette" refers to one or more gene sequences inserted into a vector, which in some embodiments provides regulatory sequences for expression of the polynucleotide or gene sequence. In other embodiments, the vector provides regulatory sequences for expression of a polypeptide of the application. In further embodiments, the vector provides some regulatory sequences, and the nucleotide or gene sequence provides other regulatory sequences. "Regulatory sequences" include, but are not limited to, promoters, transcription terminators, enhancers, splice acceptor sites, donor sites, introns, ribosome binding sites, polyadenylation sequences, and / or origins of replication.

[0089] The vaccine of the present application comprises a recombinant Mycobacterium bovis BCG strain having an altered cell wall after removal of amidation modifications. This strain is used to immunize U937 monocyte-derived macrophages, which subsequently show better protection than the currently used BCG vaccine. The vaccine of the present application can be provided alone or in combination with other compounds (e.g., nucleic acid molecules, small molecules, peptides, or peptide analogs) in the presence of a liposome, an adjuvant, or any carrier (e.g., a pharmaceutically acceptable carrier) and in a form suitable for administration to a mammal (e.g., a human, a cow, a sheep, etc.).

[0090] As used herein, "pharmaceutically acceptable carrier" or "excipient" includes any and all physiologically compatible antibacterial and antifungal agents, coatings, dispersion media, solvents, isotonic agents and absorption delaying agents, etc. "Pharmaceutically acceptable carrier" may include solid or liquid fillers, diluents or encapsulating materials that can be safely used to administer the recombinant antigen or vaccine composition to a subject. Pharmaceutically acceptable carriers may be suitable for intramuscular, intradermal, intravenous, intraperitoneal, subcutaneous, oral or sublingual administration. Pharmaceutically acceptable carriers include sterile aqueous solutions, dispersions and sterile powders for preparing sterile solutions. The use of media and reagents to prepare pharmaceutically active substances is well known in the art. When any conventional media or reagents are incompatible with the active compound, they are not considered for use in the pharmaceutical compositions of the present invention. Supplementary active compounds may also be incorporated into the composition.

[0091] Suitable preparations or compositions of the vaccine construct comprising recombinant Mycobacterium bovis BCG bacterial strain are used to a subject infected with Mycobacterium tuberculosis. Any suitable route of administration can be adopted, for example, parenteral, intravenous, intradermal, subcutaneous, intramuscular, intracranial, intraorbital, intraocular, intraventricular, intracapsular, intraspinal, intrathecal, intracartilaginous, intraperitoneal, intranasal, aerosol, topical or oral administration. Vaccine formulations and compositions that can be used for the present invention include constructs containing recombinant Mycobacterium bovis BCG bacterial strains that induce and / or enhance the immune response to Mycobacterium tuberculosis infection.

[0092] Typically, an effective amount of the vaccine, or a formulation or composition comprising the vaccine, is administered to the subject.As used herein, the term "subject" includes all mammals, especially human subjects.

[0093] The present invention also relates in part to a method of eliciting a protective immune response against Mycobacterium tuberculosis or treating tuberculosis infection in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount, an immunogenic effective amount, or a prophylactically effective amount of a vaccine of the present invention or a composition or formulation thereof to prevent or treat tuberculosis in the subject.

[0094] " Effective amount " of recombinant Mycobacterium bovis BCG bacterial strain or the vaccine composition comprising this bacterial strain comprises therapeutically effective dose, immunization effective dose or prevention effective dose." therapeutically effective dose " refers to the effective amount that reaches required therapeutic effect (such as treating infection or the disease relevant to this infection) in necessary dosage and time period.The result of treatment can be measured for example by the minimizing of bacteremia, the delay of the pathological development relevant to TB infection, the stimulation of immune system or any other method for determining therapeutic benefit.The therapeutically effective amount of compound can be according to factors such as individual's disease state, age, sex and body weight and the ability that compound causes desired reaction in individual and changes.Dosage regimen can be adjusted to provide best therapeutic response.The therapeutically effective amount is also the amount that any toxicity or harmful effect of compound is exceeded by the therapeutic beneficial effect.

[0095] Preferably, the recombinant Mycobacterium bovis BCG strain or vaccine composition of the present invention is used for administration to infants, young children or healthy adults. In some embodiments, the recombinant Mycobacterium bovis BCG strain or vaccine composition of the present invention may be suitable for administration to a subject suffering from TB infection. The dosage of the recombinant Mycobacterium bovis BCG strain or vaccine composition of the present invention will vary according to the patient's symptoms, age and weight, the nature and severity of the disease to be treated or prevented, the route of administration and the form of the composition. Any composition of the present invention can be administered in single doses or multiple doses. The dosage of the composition of the present invention can be easily determined by techniques known to those skilled in the art or the techniques taught herein.

[0096] An "immunogenically effective amount" is an amount effective to achieve the desired immune response at the dosage and for the period of time necessary. The desired immune response may include stimulation or initiation of an immune response, such as a T cell response.

[0097] A "prophylactically effective amount" is an amount effective at the dosage and time necessary to achieve the desired prophylactic effect (e.g., preventing the onset of disease associated with TB infection). Typically, a prophylactic dose is administered before a subject becomes infected or at an early stage of infection, and thus a prophylactically effective amount may be less than a therapeutically effective amount.

[0098] Dosage values ​​can vary and be adjusted over time based on individual needs. The dosage ranges presented herein are exemplary only and do not limit the dosage ranges that can be selected. The amount of modified BCG strain in the composition can vary based on individual disease state, age, sex, and weight. The dosage regimen can be adjusted to provide the best therapeutic response. For example, a single dose can be administered, or multiple doses can be administered over time. For ease of administration and dosage uniformity, it may be advantageous to formulate the composition in a dosage unit form.

[0099] The term "prevention," when applied to infectious diseases such as TB, is well known in the art and includes administering a composition that reduces the frequency of symptoms of the disease or delays the onset of symptoms of the disease in a subject relative to a subject that has not received the composition. Prevention of disease includes, for example, reducing the number of diagnoses of infection in a treated population compared to an untreated control population and / or delaying the onset of symptoms of infection in a treated population compared to an untreated control population.

[0100] The terms "prophylactic or therapeutic" treatment are well known to those skilled in the art and include administering to a subject one or more compositions of the present invention. If the composition is administered prior to clinical manifestation of an unwanted condition (e.g., a disease or other unwanted state in a subject), the treatment is prophylactic, i.e., it protects the host from developing the unwanted condition, whereas if administered after manifestation of the unwanted condition, the treatment is therapeutic (i.e., it is intended to reduce, ameliorate, or stabilize an existing unwanted condition or its side effects).

[0101] As defined herein, the vaccination regimen for inducing an immune response for TB infection in a subject generally includes a series of single doses of recombinant BCG as herein described or compositions. As used herein, single dose or multiple dose refer to a pre-dose (that is, the initial first or second dose with the same antigen) and any subsequent dose, which are preferably administered to "strengthen" immune response. In this case, each single dose includes administering a recombinant BCG bacterial strain according to the present invention or compositions, wherein the interval between two single doses can be at least one week, preferably at intervals of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 weeks. It should be understood that in the process of the immunization regimen, the interval between the single dose can be constant or variable, for example, and the interval can be shorter when the regimen begins, longer near the end. In addition, according to the interval between the sum of the single doses and the single dose, the immunization regimen can continue for a period of time. Each single dose includes administering a construct comprising mycobacterium bovis BCG bacterial strain described herein.

[0102] Toxicity and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical procedures in cell cultures or using experimental animals, for example, by determining the LD 50 and ED 50 The data obtained from cell culture and / or animal studies can be used in formulating a range of dosage for use in subjects. The dosage of any composition of the invention is preferably in the range including ED 50 The dosage may vary within this range, depending on the dosage form and route of administration. For the compositions of the present invention, the therapeutically effective dose may be estimated starting from cell culture assays.

[0103] In some embodiments, the modified BCG strain or composition according to the application can be provided in the form of a kit, optionally containing a carrier and / or adjuvant, and instructions for use.

[0104] The following examples are illustrative and not limiting.

[0105] Example 1

[0106] Construction and cloning of the recombinant BCG::CRISPRi murT-gatD strain

[0107] Growth conditions for E. coli DH5a and its derivative strains

[0108] E. coli DH5a and its derivative strains were grown at 37°C in Luria-Bertani broth (LB) or Luria-Bertani agar (LA) with the appropriate antibiotics added to the medium. The concentrations of the antibiotics used were as follows: Kanamycin (Kan): 50 pg / ml. Liquid cultures were grown at 37°C with shaking at 100 rpm.

[0109] Growth conditions for Mycobacterium and derivative strains

[0110] Mycobacterium bovis, Mycobacterium tuberculosis H37Rv and the recombinant BCG::CRISPRi murT-gatD strain were grown at 37°C in Middlebrook 7H9 broth supplemented with OADC enrichment, 0.5% glycerol, 0.05% Tween 80 and the appropriate antibiotics (hereinafter referred to as Middlebrook 7H9 broth) or on Middlebrook 7H11 agar supplemented with OADC enrichment and 0.5% glycerol and the appropriate antibiotics. The concentrations of the antibiotics used were as follows: Kan: 50 pg / ml.

[0111] Construction of the recombinant BCG::CRISPRi murT-gatD strain

[0112] As previously described by Rock et al. (2017), the entire contents of which are incorporated herein by reference, a programmable Mycobacterium CRISPRi system for gene transcription repression was used to generate the recombinant BCG::CRISPRi murT-gatD strain. Briefly, a short guide RNA (sgRNA) sequence targeting the murT-gatD bi-gene operon knock-out was introduced into the BCG strain (BCG::CRISPRi murT-gatD). The CRISPRi system utilizes a catalytically inactive dehydratetetracycline / doxycycline (ATc / Dox)-inducible CRISPRi dcas9 from Streptococcus thermophilus guided by an (ATc)-inducible sgRNA to the specific target gene to prevent transcription initiation or elongation (Rock et al., 2017). Figure 1 )Figure 2 and Figure 3 The sgRNA (near the PAM sequence 5'-NNAGCAA-3' (SEQ ID NO: 2)) has the sequence 5'-CCAGCTGGTCTCGGGAGAGGT-3' (SEQ ID NO: 3), targeting the 5' region of the murT-gatD operon (SEQ ID NO: 1). It was synthesized by annealing the sgRNA primer set (SEQ ID NO: 4 and SEQ ID NO: 5) and then cloning into the BsmBI-digested CRISPRi vector pLJR965, which expresses the dCas9 endonuclease. The sgRNA sequences bind to complementary sequences on the murT-gatD operon shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

[0113] This clone was amplified in E. coli to generate the plasmid pLJR965-CRISPRi murT-gatD. This plasmid was introduced into M. bovis BCG by electroporation using the following cloning strategy:

[0114] 1. The CRISPRi vector pLJR965 was amplified in E. coli (kanamycin selection), hydrolyzed with BsmBI (NEB), and gel-purified before cloning sgRNAs.

[0115] 2. Anneal the primers (Table 1) and ligate them into the agarose gel-purified BsmBI-digested CRISPRi vector.

[0116] 3. Transform the ligation reaction into E. coli DH5α competent cells and plate on Luria-Bertani agar (LA) containing 50 μg / ml kanamycin and incubate at 37° C. Surviving colonies will contain these clones.

[0117] 4. Amplify the CRISPRi construct in E. coli DH5α, extract the plasmid, purify it, and electroporate it into Mycobacterium bovis BCG. Plate the transformants on 7H11 Middlebrook agar supplemented with OADC enrichment, 0.5% glutathione, and kanamycin. Incubate at 37°C for 3 weeks. Pick colonies and evaluate CRISPRi-mediated knockout of murT-gatD.

[0118] Table 1. Primers used for CRISPRi amplification in E. coli DH5α.

[0119] Primer Sequence (5' - 3') SEQ ID NO CRISPR-MurT_F GGGAGCCAGCTGGTCTCGGGAGAGGT SEQ ID NO: 4 CRISPR-MurT_R AAACACCTCTCCCGAGACCAGCTGG SEQ ID NO: 5

[0120] Example 2

[0121] In vitro testing of recombinant BCG::CRISPRi murT-gatD strains

[0122] rBCG::CRISPRi-murT-gatD activates NOD-1 pathway and trains U937 monocytes and Mycobacterium tuberculosis H37Rv killing capacity

[0123] Standard BCG vaccines in use have immune evasive proteins, lipids or molecules that limit their efficacy during vaccination. Transposon mutagenesis screens have been previously successfully used to identify non-essential immunomodulatory proteins that limit BCG vaccine efficacy. However, essential mycobacterial immunomodulatory proteins remain to be investigated to assess their role in limiting BCG vaccine efficacy. The inventors analyzed the list of essential genes published for Mycobacterium bovis BCG Danish and Mycobacterium bovis BCG Pasteur strains (in Mtb) from transposon mutagenesis screens to identify essential immunomodulatory proteins or enzymes involved in the production of immunomodulatory molecules (Mendum et al., 2019). Essential enzymes related to cell wall biosynthesis were the focus of the study as mycobacteria are known to produce modified cell envelopes during infection that are associated with immunomodulation. The inventors targeted genes involved in the biosynthesis of different layers or components of the cell wall and identified essential genes: treS - involved in the production of cell wall glycolipids, lpqW - involved in the production of lipoarabinomannan, mmaA4 - encodes a methyltransferase required for the introduction of distal oxygen modifications of mycolic acids, embC - involved in arabinogalactan biosynthesis, and murT-gatD genes encode an amidotransferase complex known to modify peptidoglycan, as potential essential cell wall-related enzymes for the production of immunomodulatory cell wall components. To investigate the impact of these genes on limiting BCG vaccine efficacy, the inventors first used an in vitro macrophage culture assay to assess Mtb H37Rv killing activity by cultured macrophages using CRISPRi-engineered Mycobacterium bovis BCG strains that lack the essential enzymes encoded by the above-mentioned genes, respectively.

[0124] For cell-based in vitro infection assays, human monocytic U937 cell lines and BMDM extracted from the bone marrow (BM) of 6-8 week old female wild-type Balb / c mice were cultured in RPMI-glutamine (Cat. 61870-036, Fischer Scientific) medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Cat. 10082147, Fischer Scientific) at 37°C and 5% CO2. BMDM were generated as previously described by Toda et al. (23), which is incorporated herein by reference. Briefly, to differentiate BM cells into macrophages, BM cells were seeded in BMDM differentiation medium (RPMI-glutamine medium supplemented with 10% FBS and 10% L929 conditioned medium) and differentiated for 6 days. Non-adherent cells were washed away with warm BMDM differentiation medium, and adherent macrophages were used for in vitro infection assays.

[0125] In vitro monocyte culture was performed according to the model of Bekkering et al., 2016 and Pan et al., 2020, both of which are incorporated herein by reference. Briefly, U937 monocytes (1×10 6 / mL) were transferred into 24-well plates and the cells were incubated with medium alone as a negative control or MDP (muramyl dipeptide), LPS (lipopolysaccharide), heat-killed WT BCG or heat-killed rBCG::CRISPRi strain and 5% CO2 at 37°C for 24 hours. The cells were washed twice with 1 mL of warm PBS and then incubated in RPMI with 10% FBS and penicillin-streptomycin in the presence of 25 nM phorbol 12-myristate 13-acetate (PMA) for 2 days. After washing twice with 1 mL of warm PBS, differentiated macrophages were infected with Mtb H37Rv at an MOI of 1 and incubated for 24 hours. After 24 hours, the cells were lysed and the bacterial inoculum was counted by CFU counting plates. CRISPRi-mediated depletion of murT-gatD in rBCG::CRISPRi-murT-gatD assumes that reduced PG amidation leads to activation of NOD1 and NOD2 ( Figure 4 Activation of CRISPRi with ATc resulted in a 1000-fold decrease in murT(Mb3739) expression ( Figure 5 ).like Figure 6 As shown, NOD-1 and NOD-2 expression was present at basal levels in unactivated and uninfected cells, as shown previously; WT BCG infection did not induce significant changes in NOD expression ( Figure 6Infection with rBCG::CRISPRi-murT-gatD resulted in an approximately 15-fold increase in NOD-2 expression in IFNγ-activated macrophages, and an approximately 55-fold and approximately 200-fold increase in NOD-1 expression in unactivated and IFNγ-activated THP-1 macrophages, respectively ( Figure 6 ).

[0126] Effects of modifications on cell wall morphology

[0127] With the removal of the amidation modification, the resulting modified M. bovis BCG strain has an altered cell wall ( Figure 7-9 Depletion of murT-gatD by CRISPRi reduced bacterial growth in vitro; caused perturbations in bacterial cell wall morphology as observed by scanning and transmission electron microscopy, and sensitized bacteria to cell wall-targeting antibiotics ( Figure 8-13 The murT-gatD enzyme functions as an amidotransferase complex required for the amidation of D-isoglutamate to D-isoglutamine during peptidoglycan biosynthesis, a modification essential for peptidoglycan cross-linking and evasion of activation of the pathogen recognition receptor NOD-1 during infection ( Figure 7 Labeling of murT-gatD-depleted cells with a fluorescent PG-amidation reporter chemical probe showed an increase in cells labeled with this probe, indicating a decrease in PG-amidation after murT-gatD depletion ( Figure 14 This was confirmed by labeling PG from recombinant BCG strains with an amide-reactive dye and comparing it with PG from wild-type (WT) BCG ( Figure 15 Further microscopic imaging of murT-gatD-depleted cells labeled with the fluorescent peptidoglycan dye BODIPY-vancomycin revealed complete labeling of the cells with this dye compared to wild-type cells that were labeled at the cell pole ( Figure 11 ), a phenotype indicating reduced peptidoglycan cross-linking in rBCG::CRISPRi-murT-gatD, leading to cell wall defects observed by electron microscopy and increased sensitivity to cell wall-targeting antibiotics. Compared to wild-type M. bovis BCG-trained macrophages, CRISPRi-murT-gatD-trained macrophages showed enhanced control of Mtb H37Rv ( Figure 16 Therefore, the present inventors further characterized the rBCG::CRISPRi-murT-gatD strain to evaluate the potential role of the murT-gatD complex in limiting BCG vaccine efficacy.

[0128] Example 3

[0129] BMDM immunogenicity of rBCG::CRISPRi-murT-gatD and its activation in vitro and in mice following doxycycline aerosol infection

[0130] Immunogenicity in BMDM

[0131] To test the hypothesis that inhibition of murT-gatD expression in rBCG::CRISPRi-murT-gatD enhances the immunogenicity of the recombinant strain by increasing expression of the NOD-1 ligand iE-DAP, we infected IFNγ-activated bone marrow-derived macrophages (BMDMs) with rBCG::CRISPRi-murT-gatD and supplemented the growth medium with increasing concentrations of anhydrotetracycline (ATc) to assess activation of the CRISPRi system in vitro and document this by counting rBCG::CRISPRi-murT-gatD colony-forming units (CFU) on days 3 and 5 after infection.

[0132] On day 3, bacterial killing was observed with all ATc concentrations tested for CRISPRi activation, which contributed to growth inhibition of activated BMDMs, and dose-dependent inhibition of rBCG::CRISPRi-murT-gatD growth was observed on day 5, with 500 ng / ml ATc (the maximum concentration used) resulting in an approximately 3-fold difference in growth inhibition of rBCG::CRISPRi-murT-gatD compared to WT BCG and rBCG::CRISPRi-murT-gatD without ATc supplementation ( Figure 17 ).

[0133] Secondly, sandwich ELISA was performed to measure cytokines (TNF-α and IL-6) in the culture supernatant. The inventors evaluated the expression of the proinflammatory cytokines TNFα and IL-6 because rBCG::CRISPRi-murT-gatD is designed to express the NOD-1 ligand iE-DAP and potentially induce increased NF-κB activation, leading to a potential increase in proinflammatory cytokine expression. The culture supernatant was used for ELISA immediately after cell collection. Sandwich ELISAs (R&D Systems) were performed according to the manufacturer's recommendations.

[0134] Activation of rBCG::CRISPRi-murT-gatD by supplementing the growth medium with ATc (to reduce murT-gatD expression) resulted in a dose-dependent increase in TNFα expression, but not IL-6 expression, compared with WT BCG ( Figure 18 These results indicate that rBCG::CRISPRi-murT-gatD responds to signals for in vitro activation and increased expression of proinflammatory cytokines.

[0135] In vitro activation of rBCG::CRISPRi-murT-gatD by doxycycline and aerosol infection of BALB / c mice with doxycycline

[0136] Doxycycline (Dox) is a tetracycline analog that is used to temporarily modulate mycobacterial gene expression in in vivo models of tuberculosis. The CRISPRi platform used in rBCG::CRISPRi-murT-gatD is also based on Dox-responsive TetR-tetO units (Rock et al., 2017). rBCG::CRISPRi-murT-gatD was grown in the presence of increasing concentrations of Dox to assess activation of CRISPRi in vitro. Activation of CRISPRi in rBCG::CRISPRi-murT-gatD with Dox resulted in a dose-dependent inhibition of rBCG::CRISPRi-murT-gatD growth compared to the WT BCG control, which exhibited minimal sensitivity to Dox during growth in liquid broth, as the murT-gatD enzyme is required for growth ( Figure 19 ).

[0137] To determine the inoculum of wild-type and rBCG::CRISPRi-murT-gatD strains of Pneumococcus, 6-8 week-old female BALB / c mice were infected using an aerosol route in a Glasscol inhalation exposure system (Glasscol). In female BALB / c mice, the inoculum implanted into the lungs on day 1 was determined by plating whole lung homogenates on 7H11 selective plates containing carbenicillin (50 mg / ml), trimethoprim (20 mg / ml), polymyxin B (25 mg / ml) and cycloheximide (10 mg / ml) (n=3 mice per group). A defined dose of doxycycline was administered in vivo for CRISPRi activation by daily oral gavage, and after infection, mouse lungs (n=5 animals / group) were harvested, homogenized in sterile PBS and plated on 7H11 selective plates at different dilutions. 7H11 selective plates were incubated at 37°C, and single colonies were counted on days 10, 4 weeks, and 8 weeks. Individual colonies were expressed as log CFU per organ.

[0138] To test the activation of rBCG::CRISPRi-murT-gatD in vivo and the minimum effective dose of Dox, the inventors infected Balb / C mice with approximately 100 CFU of rBCG::CRISPRi-murT-gatD aerosol as described above and administered them at doses of 0.125-1 mg / kg / day for 10 days. They found that 1 mg / kg / day resulted in a significant reduction in the growth of rBCG::CRISPRi-murT-gatD in the lungs (Figure 20 To assess the retention of the CRISPRi plasmid (PLRJ965, which has a kanamycin [Kan] resistance cassette) by rBCG::CRISPRi-murT-gatD in vivo, lung homogenates were plated on media with or without Kan, and it was found that rBCG::CRISPRi-murT-gatD bacilli recovered from the lungs of aerosol-infected mice formed similar CFU counts on media with and without Kan ( Figure 20 These results demonstrate the long-term retention of the CRISPRi plasmid by rBCG::CRISPRi-murT-gatD under in vivo conditions.

[0139] We further evaluated the long-term efficacy of 1 mg / kg / day Dox on rBCG::CRISPRi-murT-gatD activation at 4 and 8 weeks after aerosol infection in mice ( Figure 21-22 ) and found that recovered rBCG::CRISPRi-murT-gatD bacilli formed small colonies on solid agar compared to WT BCG recovered from infected mice also exposed to a 1 mg / kg / day Dox dose, indicating the long-term efficacy of Dox on CRISPRi activation in vivo ( Figure 23 ). Genomic DNA was extracted from small colonies (SC), large colonies (BC) were recovered, and PCR was performed to verify the presence of the CRISPRi plasmid. PCR amplification of the dCas9 ORF (encoding the degenerate endonuclease dCas9 used in this CRISPRi platform) demonstrated the presence of dCas9 in all analyzed colonies ( Figure 24 rBCG::CRISPRi-murT-gatD SC and BC were subsequently regenerated in the presence of Dox and both showed reduced growth rates in liquid broth supplemented with Dox, whereas the WT strain showed minimal sensitivity to Dox ( Figure 25 These results indicate that 1 mg / kg / day of Dox is effective for rBCG::CRISPRi-murT-gatD activation in vivo and enable the determination of the minimal Dox dose for in vivo CRISPRi activation, as high-dose Dox administration is known to have immunomodulatory effects.

[0140] Example 4

[0141] Analysis of rBCG::CRISPRi-murT-gatD attenuation in SCID mice

[0142] rBCG::CRISPRi-murT-gatD is not more attenuated than WT BCG and does not cause more disease in SCID mice

[0143] To further explore the attenuating effect of rBCG::CRISPRi-murT-gatD, we aerosol-infected female SCID (severe combined immunodeficiency) mice with a low dose (~100 CFU) of WT BCG and rBCG::CRISPRi-murT-gatD and included Dox-receiving groups (i.e., WT BCG+Dox and rBCG::CRISPRi-murT-gatD+Dox) ( Figure 26 WT BCG-infected mice showed an expected early decline in survival, followed by WT BCG+Dox group mice ( Figure 27 Although rBCG::CRISPRi-murT-gatD-infected mice, whether or not they received Dox, showed a slight increase in survival, this data was not significantly different from WT BCG-infected mice ( Figure 27 This indicates that rBCG::CRISPRi-murT-gatD is not more attenuated than WT BCG after CRISPRi activation and does not cause more disease in SCID mice compared to WT BCG.

[0144] Example 5

[0145] In vivo testing of recombinant BCG::CRISPRi murT-gatD strains

[0146] Mouse immunization and determination of the protective efficacy of rBCG::CRISPRi-murT-gatD, as well as lung tissue pathology analysis

[0147] To test the efficacy of rBCG::CRISPRi-murT-gatD, BalB / c mice (10 per group) were intradermally immunized with 105 CFU / 100 L of WT BCG or rBCG::CRISPRi-murT-gatD strains ( Figure 28 ). Mice were sham-immunized with saline, and Dox was administered daily by oral gavage to saline+Dox (n=5), WT BCG+Dox (n=5), and rBCG::CRISPRi-murT-gatD+Dox (n=5) groups for 6 weeks. Mice were weighed weekly to monitor the effects of Dox administration on the health of the mice. The inventors evaluated the percent weight change of mice that received Dox compared to the group that did not receive Dox and found that the percent weight change of WT BCG-immunized mice that received Dox was significantly different from that of WT BCG-immunized mice that did not receive Dox treatment ( Figure 29 However, the rBCG::CRISPRi-murT-gatD immunized group that received Dox did not show significant changes in body weight compared to all groups (Figure 29 Importantly, 6 weeks prior to challenge with Mtb H37Rv, the weights of the saline+Dox, WT BCG+Dox, and rBCG::CRISPRi-murT-gatD+Dox groups were similar.

[0148] Six weeks after immunization, mice were challenged with approximately 100 CFU of Mycobacterium tuberculosis H37Rv strain by aerosol in a Glasscol inhalation exposure system (Glasscol). Lungs and spleens of infected animals were harvested at weeks 4 and 8 after Mtb infection, and lung bacterial inoculum was analyzed by plating whole lung homogenates on 7H11 selective plates containing carbenicillin (50 mg / ml), trimethoprim (20 mg / ml), polymyxin B (25 mg / ml), and cycloheximide (10 mg / ml).

[0149] The WT BCG+Dox group showed lower lung weights, the WT-BCG and rBCG::CRISPRi-murT-gatD groups without Dox treatment showed similar lung weights, whereas the saline+Dox and rBCG::CRISPRi-murT-gatD+Dox groups showed increased lung weights, indicating increased lung inflammation ( Figure 30 A). Saline+Dox group showed increased spleen weight compared to other groups ( Figure 30 B). Analysis of lung bacterial burden at week 4 showed that rBCG::CRISPRi-murT-gatD+Dox was superior to WT BCG and WT BCG+Dox in protecting the lungs from Mtb H37Rv challenge and reducing bacterial dissemination to the spleen, similar to WT BCG or WT BCG+Dox ( Figure 30 C and D). At 8 weeks post-challenge, the rBCG::CRISPRi-murT-gatD+Dox group showed reduced lung weight, indicating control of the bacterial inoculum, and analysis of the lung bacterial inoculum again demonstrated that rBCG::CRISPRi-murT-gatD+Dox was superior to WT BCG or WT BCG+Dox in controlling Mtb H37Rv growth in the lung, which showed diminished efficacy in this model ( Figure 30 A and C). In the spleen, rBCG::CRISPRi-murT-gatD+Dox showed similar efficacy to WT BCG in controlling infection compared with the saline+Dox group ( Figure 31 D).

[0150] Histopathological analysis of lung pathology after vaccination with rBCG::CRISPRi-murT-gatD+Dox compared to WT BCG after Mtb infection

[0151] For histopathology, the left lung vertical halves were fixed in 10% buffered formalin, 5 pm thick sections of formalin-fixed and paraffin-embedded tissue were cut onto glass slides, and stained with H&E for histopathological examination.

[0152] Histopathological analysis of hematoxylin and eosin (H&E) stained lung samples from vaccinated and Mtb challenged mice showed that rBCG::CRISPRi murT-gatD + Dox immunized mice exhibited increased lung inflammation early on compared to WT BCG + Dox vaccinated mice. Also at week 8, rBCG::CRISPRi murT-gatD + Dox immunized mice exhibited an increased proportion of inflammation in lung area compared to WT BCG + Dox immunized mice, indicating sustained inflammation to control infection References ). The increase in early inflammation in rBCG::CRISPRi murT-gatD + Dox immunized mice reflects early induction of anti-tuberculosis immune responses that are able to control bacterial growth early on before infection is established, and the sustained inflammation at week 8 suggests an enhancement of immune responses during chronic disease that are able to control disease progression.

[0153] ​

[0154] Bekkering, S., Blok, B. A., Joosten, L. A., Riksen, N. P., van Crevel, R. and Netea, M. G., 2016. In vitro experimental model of trained innate immunity in human primary monocytes. Clinical and Vaccine Immunology, 23(12), pp. 926-933.

[0155] Mendum, T. A., Chandran, A., Williams, K., Vordermeier, H. M., Villarreal-Ramos, B., Wu, H., Singh, A., Smith, A. A., Butler, R. E., Prasad, A. and Bharti, N., 2019. Transposon libraries identify novel Mycobacterium bovis BCG genes involved in the dynamic interactions required for BCG to persist during in vivo passage in cattle. BMC genomics, 20(1), pp. 1-13.

[0156] Pan, W., Hao, S., Zheng, M., Lin, D., Jiang, P., Zhao, J., Shi, H., Yang, X., Li, X. and Yu, Y., 2020. Oat-derived beta-glucans induced trained immunity through metabolic reprogramming. Inflammation, 43(4), pp. 1323-1336.

[0157] Rock, J. M., Hopkins, F. F., Chavez, A., Diallo, M., Chase, M. R., Gerrick, E. R., Pritchard, J. R., Church, G. M., Rubin, E. J., Sassetti, C. M. and Schnappinger, D., 2017. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nature microbiology, 2(4), pp. 1-9.

[0158] Toda,G.,Yamauchi,T.,Kadowaki,T.and Ueki,K.,2021.Preparation andculture of bone marrow-derived macrophages from mice for functionalanalysis.STAR protocols,2(1),p.100246.

Claims

1. A recombinant Mycobacterium bovis BCG strain comprising disrupted expression of the Mb3739 gene.

2. The recombinant Mycobacterium bovis BCG strain according to claim 1, wherein the recombinant Mycobacterium bovis BCG strain comprises a plasmid having a short guide RNA (sgRNA) target sequence, wherein the short guide RNA (sgRNA) target sequence was used to knock down Mb3739 gene expression. 3 . The recombinant Mycobacterium bovis BCG strain according to claim 2 , wherein the sgRNA targets the 5′ region of the murT-gatD operon. The recombinant Mycobacterium bovis BCG strain according to claim 2 or 3, wherein the sgRNA comprises the nucleotide sequence of SEQ ID NO:

3.

5. The recombinant Mycobacterium bovis BCG strain according to any one of claims 2 to 4, wherein the plasmid is a CRISPRi-dCas9 plasmid.

6. The recombinant Mycobacterium bovis BCG strain according to any one of claims 1 to 5, wherein disruption or knockout of the expression of the Mb3739 gene results in modification of the peptidoglycan in the recombinant Mycobacterium bovis BCG strain.

7. The recombinant Mycobacterium bovis BCG strain according to claim 6, wherein the modification reduces the amidation of peptidoglycan and activates NOD-1. 8 . The recombinant Mycobacterium bovis BCG strain according to claim 6 or 7 , wherein the recombinant Mycobacterium bovis BCG strain comprising the modification is capable of eliciting an immune response against Mycobacterium tuberculosis .

9. A method for producing a recombinant Mycobacterium bovis BCG strain, comprising disrupting the expression of the Mb3739 gene, the method comprising: a) cloning a short guide RNA (sgRNA) target sequence for knocking down the expression of the Mb3739 gene into a CRISPRi-dCas9 plasmid to obtain a cloned plasmid; and b) introducing the cloned plasmid from a) into Mycobacterium bovis, The cloned plasmid resulted in knockdown of Mb3739 gene expression in a recombinant Mycobacterium bovis BCG strain.

10. The method of claim 9, wherein the sgRNA comprises the nucleotide sequence of SEQ ID NO:

3.

11. The method according to claim 9 or 10, wherein knockdown of Mb3739 gene expression results in modification of peptidoglycan in the Mycobacterium bovis BCG strain.

12. The method of claim 11, wherein the modification reduces amidation of peptidoglycan and activates NOD-1.

13. The method according to any one of claims 9 to 12, wherein the cloned plasmid is introduced into Mycobacterium bovis by electroporation.

14. A recombinant Mycobacterium bovis BCG strain produced by the method of any one of claims 9 to 13.

15. A vaccine composition comprising the recombinant Mycobacterium bovis BCG strain of any one of claims 1 to 8 and 14. The vaccine composition according to claim 15 , further comprising a pharmaceutically acceptable carrier or adjuvant.

17. A method of eliciting an immune response against Mycobacterium tuberculosis in a subject, the method comprising administering to the subject an immunogenic effective amount of the recombinant Mycobacterium bovis BCG strain of any one of claims 1 to 8 and 14 or the vaccine composition of claim 15 or 16.

18. The method of claim 17, wherein the subject is a human subject.

19. The recombinant Mycobacterium bovis BCG strain according to any one of claims 1 to 8 and 14, or the vaccine composition according to claim 15 or 16, for use in a method of eliciting an immune response against Mycobacterium tuberculosis in a subject, the method comprising administering to the subject an immunogenic effective amount of the recombinant Mycobacterium bovis BCG strain or the vaccine composition.

20. The recombinant Mycobacterium bovis BCG strain or vaccine composition for use according to claim 19, wherein the subject is a human subject.

Images