Recombinant beauveria bassiana for catalyzing high-concentration substrate as well as construction method and application of recombinant beauveria bassiana
By overexpressing cytochrome P450 enzymes and transmembrane transporters in Beauveria bassiana, the problem of poor tolerance to high-concentration substrates in microbial fermentation was solved, and efficient production of R-2-(4-hydroxyphenoxy)propionic acid was achieved, making it suitable for industrial production.
Patent Information
- Application Number
- CN202511040818.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-10-14
AI Technical Summary
In the existing microbial fermentation method for producing R-2-(4-hydroxyphenoxy)propionic acid, the strain has poor tolerance to high concentrations of substrates and low yield, making it unsuitable for industrial scale-up production.
Through metabolic engineering and efflux transport engineering strategies, a recombinant Beauveria bassiana was constructed to overexpress cytochrome P450 enzymes and plant-derived transmembrane transporters to enhance the strain's tolerance to high-concentration substrates and its product conversion ability.
The strain's tolerance to high-concentration substrates and the yield of R-2-(4-hydroxyphenoxy)propionic acid were significantly improved, the fermentation cycle was shortened, and the method has prospects for industrial application.
Smart Images
Figure CN120775893A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering, and particularly relates to the field of preparing R-2-(4-hydroxyphenoxy)propionic acid by biological fermentation, and more particularly relates to a recombinant Beauveria bassiana for catalyzing high-concentration R-2-phenoxypropionic acid to generate R-2-(4-hydroxyphenoxy)propionic acid, and a construction method and application thereof. BACKGROUND
[0002] R-2-(4-hydroxyphenoxy)propionic acid is an important intermediate for synthesizing optically pure aryloxyphenoxypropionic acid herbicides. At present, the effective components of many herbicides on the market exist in the form of racemates, and the aryloxyphenoxypropionic acid herbicides are a typical class of herbicides with racemic structure developed in the past forty years. The main characteristics of this class of herbicides are good weeding effect, long shelf life, no toxicity to crops, and easy degradation in soil, and even if used in excess, it will not pollute the environment, and so far it is still one of the best herbicide types.
[0003] At present, the methods for obtaining R-2-(4-hydroxyphenoxy)propionic acid at home and abroad mainly adopt chemical synthesis and microbial fermentation method which appeared in recent years. Among them, the chemical synthesis method has the disadvantages of low safety, high cost of raw materials, many steps, long period, weak optical activity, low yield, and generation of environmental pollution by-products. The microbial fermentation method has the advantages of easy access to raw materials, low production cost, and easy expansion of production capacity, and is the development direction of R-2-(4-hydroxyphenoxy)propionic acid industrialization. However, at present, the method of improving the yield of R-2-(4-hydroxyphenoxy)propionic acid mainly through screening excellent strains or optimizing the fermentation conditions, and rarely using molecular biology means to improve the strain to improve the yield. The production of R-2-(4-hydroxyphenoxy)propionic acid by Beauveria bassiana biofilm fermentation is still in the process optimization stage, and a large amount of carbon and nitrogen sources need to be added in the production fermentation process, and the fermentation period is long, the high-concentration substrate tolerance is poor, and liquid deep fermentation cannot be carried out, which also leads to its inability to be applied to industrial scale production. Therefore, it is necessary to use molecular biology technology to genetically modify the original strain, and construct an engineered strain of Beauveria bassiana with high substrate tolerance and short fermentation period, so as to improve the synthesis efficiency of R-2-(4-hydroxyphenoxy)propionic acid. SUMMARY
[0004] In order to solve the problems of poor high-concentration substrate tolerance and low yield of strains in the process of producing R-2-(4-hydroxyphenoxy) propionic acid by microbial fermentation in the prior art, the application provides a recombinant Beauveria bassiana for catalyzing high-concentration substrate and a construction method and application thereof. The construction method is based on metabolic engineering and efflux transport engineering strategy, and the Beauveria bassiana is modified to promote the process of converting intracellular substrate into product and to expel the product to the outside of the cell, so as to improve the flux of the biosynthesis pathway, so as to realize the efficient production of the target metabolic product R-2-(4-hydroxyphenoxy) propionic acid.
[0005] The technical scheme adopted by the application is: a construction method of a recombinant Beauveria bassiana for catalyzing high-concentration substrate, comprising: taking Beauveria bassiana with R-2-(4-hydroxyphenoxy) propionic acid production capacity as a chassis fungus, overexpressing cytochrome P450 enzyme or plant-derived transmembrane transport protein in the chassis fungus, and constructing the recombinant Beauveria bassiana; the transmembrane transport protein is selected from at least one protein in the NPF protein family and the SWEET protein family.
[0006] Beauveria bassiana is the main producer of R-2-(4-hydroxyphenoxy) propionic acid, however, high intracellular product concentration can cause feedback inhibition and produce certain cytotoxicity, reduce the catalytic activity of the upstream pathway metabolic enzyme, and further limit the fermentation yield of the target metabolite. In order to solve this problem, the application provides another strategy for efficiently converting high-concentration R-2-phenoxypropionic acid into R-2-(4-hydroxyphenoxy) propionic acid based on transmembrane transport protein transport engineering, specifically by strengthening the transmembrane transfer of metabolic products in microbial cells, reducing the intracellular target metabolite concentration in time, thereby weakening the feedback inhibition and cytotoxicity caused by the target metabolite to enhance the tolerance of cells to high-concentration substrate. Specifically, by means of genetic engineering, cytochrome P450 enzyme is overexpressed, or heterologous transmembrane transport proteins from the NPF protein family or the SWEET protein family are constructed into R-2-(4-hydroxyphenoxy) propionic acid production strains and expressed, so as to achieve the purpose of keeping the catalytic activity of cells in a high substrate concentration environment.
[0007] Specifically, the transmembrane transporter is derived from Arabidopsis thaliana. The transmembrane transporter Nucleobase Ascorbate Transporter Proton Symporter (NPF) existing in Arabidopsis thaliana belongs to the Peptide Transporter (PTR) family, is responsible for mediating the transmembrane transport of nucleotides and ascorbic acid, and plays an important regulatory role in cell metabolism, growth and immunity, etc. The transmembrane transporter Sugars Will Eventually be Exported Transporters (SWEET) existing in Arabidopsis thaliana is a kind of protein widely existing in plants and closely related to the transmembrane transport of sugar substances, and is responsible for the transmembrane transport of sugars such as glucose, fructose and sucrose.
[0008] Specifically, the NPF protein family includes NPF1.2, NPF2.5, NPF5.5, NPF8.1, and preferably NPF1.2. The amino acid sequence of NPF1.2 is shown as SEQ ID NO. 1, the amino acid sequence of NPF2.5 is shown as SEQ ID NO. 2, the amino acid sequence of NPF5.5 is shown as SEQ ID NO. 3, and the amino acid sequence of NPF8.1 is shown as SEQ ID NO. 4.
[0009] Specifically, the SWEET protein family includes SWEET1 and SWEET5, and preferably SWEET5. The amino acid sequence of SWEET1 is shown as SEQ ID NO. 5, and the amino acid sequence of SWEET5 is shown as SEQ ID NO. 6.
[0010] Specifically, the cytochrome P450 enzyme includes CYP56, CYP625A1, CYP54B3, CYP53A11 and CYP57B3, and is derived from the chassis strain Beauveria bassiana ZJB23323, and preferably CYP53A11 or CYP57B3 which plays an important role in the process of hydroxylating the para-position of aromatic ring in aromatic compounds. The amino acid sequence of CYP53A11 is shown as SEQ ID NO. 7, and the amino acid sequence of CYP57B3 is shown as SEQ ID NO. 9.
[0011] Specifically, the chassis fungus is Beauveria bassiana ZJB23323, which is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 2023584, the preservation date April 21, 2023, and the address China, Wuhan, Wuhan University, 430072. Beauveria bassiana ZJB23323 has been disclosed in patent CN116590153A.
[0012] Specifically, the method for overexpressing cytochrome P450 enzymes and plant-derived transmembrane transport proteins in the chassis fungus comprises: introducing a recombinant vector overexpressing the cytochrome P450 enzyme or transmembrane transport protein coding gene into the chassis fungus by using a LiAc / ssDNA / PEG high-efficiency transformation method, and obtaining the recombinant Beauveria bassiana after screening. The recombinant vector is constructed by inserting one or more cytochrome P450 enzyme and transmembrane transport protein coding genes into an expression vector, and the expression vector is preferably pUC-fFuCas-Amp-BlpR and pBARGPE1. The screening is preferably performed by CDA medium, and the CDA medium comprises: salmon sperm 2 g, peg 2 g, lithium acetate 2 g; add deionized water to 1 L, high-temperature high-pressure moist heat sterilization at 115℃ for 20 min, and store at room temperature. The solid medium needs to add 2-3% agar powder.
[0013] The application also provides the recombinant Beauveria bassiana for catalyzing high-concentration substrates constructed by the method. After the Beauveria bassiana transformants constructed by the above method and preliminarily screened are subjected to liquid bacterial PCR, and the correct ones are verified by sequencing, the Beauveria bassiana engineering bacteria Beauveria bassiana ZJB23323-P450, Beauveria bassiana ZJB23323-NPF, and Beauveria bassiana ZJB23323-SWEET are obtained. The preferred recombinant Beauveria bassiana is Beauveria bassiana ZJB23323-CYP53A11, Beauveria bassiana ZJB23323-CYP57B3, Beauveria bassiana ZJB23323-NPF1.2, or Beauveria bassiana ZJB23323-SWEET5.
[0014] The present invention also provides the use of the recombinant Beauveria bassiana in the fermentation preparation of R-2-(4-hydroxyphenoxy)propionic acid. The genetically engineered bacteria are subjected to liquid fermentation and sampling. The R-2-(4-hydroxyphenoxy)propionic acid content in the fermentation broth is detected by HPLC. After multiple subcultures and liquid fermentation verification, a recombinant Beauveria bassiana strain is obtained that catalyzes the conversion of high-concentration R-2-phenoxypropionic acid into R-2-(4-hydroxyphenoxy)propionic acid and exhibits stable genetic stability.
[0015] Specifically, the application includes: inoculating the recombinant Beauveria bassiana into a fermentation medium containing 100-300 g / L (preferably 100-200 g / L) of R-2-phenoxypropionic acid, culturing at 200-300 rpm and 25-30° C. for 6-30 days, and then collecting the bacterial liquid to obtain R-2-(4-hydroxyphenoxy)propionic acid.
[0016] Specifically, the fermentation medium includes: glucose 20-40 g / L, yeast extract 5-10 g / L, MgSO4, 0.5-1 g / L, CaCl2, 0.5-1 g / L, K2HPO, 1-2 g / L, KH2PO, 0.5-1 g / L, trace element solution 30-50 mL / L, the solvent is water, pH 6-7; the trace element solution includes: EDTA-2Na·2H2O 1-2 g / L, FeSO 4· 7H2O 0.5~0.6g / L, ZnSO4·7H2O 0.1~0.2g / L, MnSO4·H2O 0.1 ~0.2g / L, NiC12·6H2O 0.01~0.04g / L, CoC120.01~0.02g / L, H3BO3 0.01~0.03g / L, Na2MoO4H2O 0.001~0.01g / L, solvent is water, pH 6~8.
[0017] The application has the beneficial effects that: the application constructs the recombinant Beauveria bassiana capable of stably catalyzing the conversion of high-concentration R-2-phenoxypropionic acid into R-2-(4-hydroxyphenoxy) propionic acid based on metabolic engineering and efflux transport engineering strategies, and the tolerance of the experimental group to the concentration of R-2-phenoxypropionic acid is significantly improved compared with the control strain. Under the condition of 200g / L substrate concentration, the substrate conversion rate of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-NPF1.2 reaches 100% at 24 days of fermentation, and the substrate conversion rates of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-CYP53A11 and BbZJB23323-CYP57B3 are both more than 90% at 27 days of fermentation, which are greatly improved compared with the control group, and the fermentation period is shortened. The construction method based on metabolic engineering and efflux transport engineering provided by the application provides an important target for catalyzing high-concentration R-2-phenoxypropionic acid into R-2-(4-hydroxyphenoxy) propionic acid based on genetic engineering modification of Beauveria bassiana, and has the industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 It is the plasmid map of the expression vector pUC19-NPF of Example 1 of the application.
[0019] Figure 2 It is the plasmid map of the expression vector pUC19-SWEET of Example 1 of the application.
[0020] Figure 3 It is the verification gel map of CYP53A11 and CYP57B3 fragments of Example 1 of the application; 1 and 2 are CYP53A11, and 3 and 4 are CYP57B3.
[0021] Figure 4 It is the verification gel map of the resistance gene fragments of Example 1 of the application; 1 and 2 are CYP53A11, and 3 and 4 are CYP57B3.
[0022] Figure 5 It is the verification gel map of NPF1.2 and SWEET5 fragments of Example 1 of the application.
[0023] Figure 6 It is the 100g / L substrate concentration fermentation R-2-phenoxypropionic acid conversion rate line graph of the strains BbZJB23323-CYP53A11 and BbZJB23323-CYP57B3 of Example 2 of the application.
[0024] Figure 7The conversion rate fold line chart of R-2-phenoxypropionic acid fermented by 200 g / L substrate concentration of the strain BbZJB23323-CYP53A11 and BbZJB23323-CYP57B3 of Example 2 of the present application.
[0025] Figure 8 The conversion rate fold line chart of R-2-phenoxypropionic acid fermented by 200 g / L substrate concentration of the strain BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 of Example 2 of the present application. DETAILED DESCRIPTION
[0026] The present application can be implemented or applied in other different specific embodiments, and the details in the specification can be modified or changed based on different views and applications without departing from the spirit of the present application. It should be noted that the following examples and features in the examples can be combined with each other without conflict. The methods used in the examples of the present application are conventional methods, and the reagents used can be obtained from commercial channels.
[0027] Example 1: Construction of recombinant Beauveria bassiana
[0028] The following examples use the strain Beauveria bassiana ZJB23323 as the chassis strain (the strain has been disclosed in patent CN116590153A), and subsequent steps are carried out on this basis.
[0029] In order to improve the expression amount of the corresponding cytochrome P450 enzyme in Beauveria bassiana, the plasmids pUC-CYP53A11 and pUC-CYP57B3 were introduced into the competent Beauveria bassiana ZJB23323, respectively, and the colony PCR was verified using the primers shown in Table 1, and the cytochrome P450 enzyme overexpression Beauveria bassiana BbZJB23323-CYP53A11 and BbZJB23323-CYP57B3 were obtained.
[0030] Table 1. Primer table
[0031] Primer Sequence CYP53-F CTTGAGCAGACATCACCATGGCCGTGGTTGAGCTCGTCTTT CYP53-R TGGGGTGGACGAGAAAACTATCATCGCCTAGCCAGTGCAAT CYP57B3-F CTTGAGCAGACATCACCATGTTCCTGTTCTACGTCATT CYP57B3-R TGGGGTGGACGAGAAAACTATTACAATCTGCGCTTCACCT YZ-F CTTTTCCCATCTTCAGTATATTC YZ-R CTTGTCAAACGACACAAATTTTG
[0032] In order to verify the biological function of the transmembrane transporter protein, the plasmids pUC-fFuCas9-HTB NLS -hph-NPF1.2, pUC-fFuCas9-HTBNLS PCR was performed on the target transmembrane transport protein NPF1.2, SWEET5 using the primers shown in Table 2. Figure 5 The transmembrane transport protein coding genes were then connected to the linearized plasmid pUC19 using one-step cloning, and the recombination plasmids pUC19-NPF1.2 and pUC19-SWEET5 containing the transmembrane transport protein coding genes were obtained through colony PCR verification screening. The recombination plasmids include the target transport protein, lactose operon elements, and ampicillin resistance screening tags. Figure 1 The recombination plasmids were transformed into Beauveria bassiana ZJB23323, and the recombinant Beauveria bassiana BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 with high yield of R-2-(4-hydroxyphenoxy)propionic acid were obtained.
[0033] The plasmid pUC-fFuCas9-HTB NLS The construction process of -hph-NPF1.2 is as follows: Fresh Arabidopsis thaliana plant root, stem, tender leaf, flower bud, and other tissue samples were immediately frozen in liquid nitrogen, and the tissues were thoroughly ground and broken using a pestle. The treated tissues were used to extract total RNA according to the instructions of the Nuaidian RC101-01 kit. The concentration of the extracted RNA was determined, and the RNA sample was subjected to reverse transcription according to the instructions of the Nuaidian R223-01 kit. The reverse transcription product was verified by running a nucleic acid gel, and the cDNA fragment of the target transport protein NPF1.2 was obtained. Figure 2 The reverse transcription sample can be stored at -80°C for long-term preservation. The NPF1.2 cDNA fragment was amplified to obtain the NPF1.2 gene fragment. The vector pUC-fFuCas9-HTB NLS -hph was linearized. One-step cloning was used to connect the previously obtained NPF1.2 gene fragment to the linearized vector, and the expression plasmid pUC-fFuCas9-HTB NLS -hph-NPF1.2 was obtained. The construction method of plasmid pUC-fFuCas9-HTBNLS-hph--SWEET5 is the same as above.
[0034] PCR reaction system: 50 uL, 2 uL template, 25 uL 2x Phanta Mix Buffer, 2 uL each of upstream and downstream primers, 1 uL dNTP Mix, 1 uL Phanta Mix Super-Fidelity, and 50 uL ddH2O (PCR reagents were purchased from Novozyme Biotech Co., Ltd.). PCR reaction conditions: 95°C for 10 min, (95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles) and 72°C for 10 min extension.
[0035] Table 2. Primer table
[0036] Primer Sequence NPF1.2-F AGAAGGAGATATACCATGGAGAACCCTCCCAATGAAAC NPF1.2-R GTGGTGGTGGTGGTGATTGGTAACAACTGGACTTA SWEET5-F AGAAGGAGATATACCATGACCGACCCTCACACCGCTC SWEET5-R GTGGTGGTGGTGGTGAGCCTGACCGAGCTCGATGC pUC19-F TGAGATCCGGCTGCTAACAAAGC pUC19-R CATGGTATATCTCCTTCTTAAAGTTAAACAAAA
[0037] Preparation of conidial competent cells: fungal conidia were inoculated in PDB medium and shaken at 200 rpm at 28°C for 3 days. The formed conidia were collected by filtering through four layers of lens paper and concentrated by centrifugation at 3000 rpm for 5 min at 40°C. The harvested conidia were washed twice with sterile ddH2O by centrifugation at 3000 rpm for 5 min at 4°C, then suspended in 0.1 M LiAc (1:50). The conidial suspension was transferred to a 1.5 mL Eppendorf tube, precipitated by centrifugation at 7000 rpm for 5 min at 4°C, then resuspended in 0.1 M LiAc (1:50) with a final concentration of 3x10° cells / mL, and immediately frozen (liquid nitrogen) in 100 uL aliquots and stored at -80°C. The PDB medium has a concentration of 6 g / L potato infusion powder, 20 g / L glucose, and water as solvent.
[0038] For transformation, all operations were performed using ice-cold solutions at 4°C. The frozen fungal conidial competent cells were thawed on ice and harvested by centrifugation at 7000 rpm for 5 min. The following reagents were added in the following order: 240 uL 50 % PEG 4000, 35 uL 1 M LiAc, 50 uL 2 g / L denatured genomic salmon sperm DNA fragments, and 20 ug of expression plasmid.
[0039] The preparation method of E. coli BL21 competent cells is as follows: the strain preserved at-80℃ is placed on ice until it is thawed, then a small amount of bacterial body is dipped, three-zone streaking is carried out on an antibiotic-free plate, and the plate is cultured at 37℃ overnight; a single colony with correct morphology is selected and inoculated into 10 mL of LB test tube, which is cultured at 37℃ and 200 rpm for 12 h; 200 uL of bacterial liquid in the test tube is inoculated into 50 mL of LB shake flask medium, which is cultured at 37℃ and 200 rpm until OD = 0.4-0.6; the shake flask is removed and pre-cooled for 15-30 min on ice, centrifuged at 4℃ and 4500 X g for 5 min, and the bacterial body is collected; the supernatant is discarded, and an appropriate amount of pre-cooled 0.1M CaCl2 solution is added, the cells are resuspended on ice, and the ice bath is placed for 30 min; the bacterial body is collected by centrifugation at 4℃ and 4500 X g for 6 min, 1-2 mL of pre-cooled mixed solution containing 0.1M CaCl2 and 15% glycerol is added, and the cells are resuspended on ice; the suspended competent cells are each 100 uL and are dispensed into sterilized and pre-cooled EP tubes, which can be stored in a-80℃ refrigerator for short-term use.
[0040] Example 2: Application of recombinant Beauveria bassiana in liquid fermentation of R-2-(4-hydroxyphenoxy)propionic acid in a high-concentration substrate environment
[0041] The liquid fermentation of the Beauveria bassiana engineering bacteria CYP57B3 and CYP53A11 transformants was carried out with the chassis fungus Beauveria bassiana ZJB23323 as a control group. After the two transformants were cultured on hard agar medium for 5 days, they were picked into seed culture medium with a toothpick, and cultured at 250 rpm for 3 days, then transferred to fermentation medium with different substrate concentrations, and the inoculation amount was 10%. After 15 (100 g / L) or 24 (200 g / L) days of culture at 28℃ and 250 rpm, the bacterial liquid was collected, diluted, and the yield of R-2-(4-hydroxyphenoxy)propionic acid was determined by high performance liquid chromatography. The results are shown in Table 1. Figure 6 7 .
[0042] The liquid fermentation of the Beauveria bassiana engineering bacteria BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 was carried out with the chassis fungus Beauveria bassiana ZJB23323 as a control group. After the two transformants were cultured on hard agar medium for 5 days, they were picked into seed culture medium with a toothpick, and cultured at 250 rpm for 3 days, then transferred to fermentation medium, and the inoculation amount was 10%. After 24 days of culture at 28℃ and 250 rpm, the bacterial liquid was collected, diluted, and the yield of R-2-(4-hydroxyphenoxy)propionic acid was determined by high performance liquid chromatography. The results are shown in Table 2. Figure 8 .
[0043] The culture media used in the experiment include:
[0044] Seed culture medium (1 L): R-2-phenoxypropionic acid 50 g / L, glucose 40 g / L, yeast extract 10 g / L, MgS04 1 g / L, CaC12 1 g / L, K2HPO42 g / L, KH2PO41 g / L, trace element solution 50 mL / L, solvent is water, pH 7; the trace element solution includes the following components: EDTA-2Na·2H2O 2 g / L, FeS04 7H2O 0.6 g / L, ZnS04·7H2O 0.2 g / L, MnS04·H2O 0.2 g / L, NiC12 6H2O 0.04 g / L, CoC12 0.02 g / L, H3BO3 0.03 g / L, Na2MoO4-H2O 0.01 g / L, solvent is water, pH 8.
[0045] Fermentation medium: R-2-phenoxypropionic acid 100 g / L or 200 g / L, glucose 40 g / L, yeast extract 10 g / L, MgS04 1 g / L, CaC12 1 g / L, K2HPO42 g / L, KH2PO41 g / L, trace element solution 50 mL / L, solvent is water, pH 7; the trace element solution includes the following components: EDTA-2Na·2H2O 2 g / L, FeS04 7H2O 0.6 g / L, ZnS04·7H2O 0.2 g / L, MnS04·H2O 0.2 g / L, NiC12 6H2O 0.04 g / L, CoC12 0.02 g / L, H3BO3 0.03 g / L, Na2MoO4-H2O 0.01 g / L, agar 2 g / L, pH 8, solvent is water.
[0046] The content of R-2-(4-hydroxyphenoxy)propionic acid in the fermentation broth is detected by high performance liquid chromatography. The high performance liquid chromatography conditions are as follows: an ultrapure water is used to prepare a phosphoric acid solution with pH of 2.0, and mixed with chromatographic grade acetonitrile at a ratio of 6:4 (V:V). The prepared mobile phase is filtered by a 0.22 μm organic filter membrane, and degassed by ultrasonic before use. The chromatographic column is Hypersil ODS25 μm (4.6 mm x 250 mm); the mobile phase is phosphoric acid aqueous solution (pH = 2): acetonitrile = 6:4 (V:V); the flow rate is 1 mL / min; the detector is DAD; the detection wavelength is 220 nm; the injection amount is 5 μL; the column temperature is 30°C. Sample treatment and detection: 1.0 mL of the fermentation broth is centrifuged at 12000 rpm for 8 min. The supernatant is appropriately diluted with ultrapure water, filtered by a 0.22 μm microporous filter membrane, and then detected by the above method.
[0047] The present application is based on metabolic engineering and efflux transport engineering strategy, constructs a recombinant Beauveria bassiana capable of catalyzing high concentration of R-2-phenoxypropionic acid and stably converting into R-2-(4-hydroxyphenoxy) propionic acid, the experimental group compared with the control strain, the yield of R-2-(4-hydroxyphenoxy) propionic acid is significantly improved after liquid fermentation. Under the condition of 200g / L substrate concentration, the substrate conversion rate of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-NPF1.2 reaches 100% after fermentation for 24 days, the substrate conversion rate of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-CYP53A11 and BbZJB23323-CYP57B3 both exceeds 90% after fermentation for 27 days, which is significantly improved compared with the control group, and the fermentation period is shortened. The construction method based on efflux transport engineering provided by the present application provides an important target for the efficient production of R-2-(4-hydroxyphenoxy) propionic acid based on genetically engineered Beauveria bassiana, and has industrial application prospect.
[0048] The above-described embodiments are merely preferred embodiments of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application.
Claims
1. A method for constructing a recombinant Beauveria bassiana that catalyzes high-concentration substrates, characterized in that: include: Using Beauveria bassiana with the ability to produce R-2-(4-hydroxyphenoxy)propionic acid as the base fungus, overexpressing cytochrome P450 enzyme or plant-derived transmembrane transporter in the base fungus to construct the recombinant Beauveria bassiana; The transmembrane transporter is selected from at least one protein in the NPF protein family and the SWEET protein family.
2. The method according to claim 1, wherein The cytochrome P450 enzymes include CYP56, CYP625A1, CYP54B3, CYP53A11, and CYP57B3; The NPF protein family includes NPF1.2, NPF2.5, NPF5.5, and NPF8.1; The SWEET protein family includes SWEET1 and SWEET5.
3. The method according to claim 1, wherein The transmembrane transporter is derived from Arabidopsis thaliana Arabidopsis thaliana .
4. The method according to claim 1, wherein The bottom plate bacteria is Beauveria bassiana ZJB23323, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO: M 2023584, deposit date: April 21, 2023, address: Wuhan University, Wuhan, China, 430072.
5. The method according to claim 1, wherein The method for overexpressing cytochrome P450 enzymes and plant-derived transmembrane transport proteins in the chassis fungus comprises: using the LiAc / ssDNA / PEG high-efficiency transformation method to introduce a recombinant vector that overexpresses the cytochrome P450 enzyme or transmembrane transport protein encoding gene into the chassis fungus, and obtaining the recombinant Beauveria bassiana after screening.
6. The recombinant Beauveria bassiana constructed by the method according to any one of claims 1 to 5.
7. Use of the recombinant Beauveria bassiana constructed according to any one of claims 1 to 5 or the recombinant Beauveria bassiana according to claim 6 in the fermentative preparation of R-2-(4-hydroxyphenoxy)propionic acid.
8. The use according to claim 7, characterized in that The application comprises: inoculating the recombinant Beauveria bassiana into a fermentation medium containing 100-300 g / L R-2-phenoxypropionic acid, and performing fermentation culture to obtain R-2-(4-hydroxyphenoxy)propionic acid.
9. The use according to claim 8, characterized in that The fermentation culture conditions include: culturing at 200-300 rpm and 25-30° C. for 6-30 days.
10. The use according to claim 8, characterized in that The fermentation medium comprises: 20-40 g / L glucose, 5-10 g / L yeast extract, 0.5-1 g / L MgSO4, 0.5-1 g / L CaCl2, 1-2 g / L K2HPO4, 0.5-1 g / L KH2PO4, 30-50 mL / L trace element solution, the solvent is water, pH 6-7; the trace element solution comprises: 1-2 g / L EDTA-2Na·2H2O, 1-2 g / L FeSO4, 0.5-1 g / L KH2 ...0.5-1 g / L KH2PO4, 30-50 mL / L trace element solution, the solvent is water, pH 6-7 4· 7H2O 0.5~0.6g / L, ZnSO4·7H2O 0.1~0.2g / L, MnSO4·H2O 0.1 ~0.2g / L, NiC12·6H2O0.01~0.04g / L, CoC12 0.01~0.02g / L, H3BO3 0.01~0.03g / L, Na2MoO4H2O 0.001~0.01g / L, solvent is water, pH 6~8.