SNP (Single Nucleotide Polymorphism) molecular marker combination for identifying taro germplasm resources and application

Abstract

The invention discloses an SNP molecular marker combination for identifying taro germplasm resources and application, and belongs to the technical field of molecular biology. According to the invention, 252 SNP loci are screened out and used for developing the PARMS-SNP marker, and 27 original PARMS-SNP markers are successfully obtained. 27 SNP markers are utilized to carry out genetic typing on 72 taro resources, and population structure analysis, PCA principal component analysis and genetic evolution analysis are further carried out. The taro germplasm resources can be well distinguished, and reference is provided for evaluation and identification of the taro germplasm resources and breeding of new germplasm.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a SNP molecular marker combination for identifying taro germplasm resources and application thereof. BACKGROUND

[0002] Taro (Colocasia esculenta) is a perennial plant of Araceae, which is usually planted as an annual plant and contains more starch than potatoes, sweet potatoes and other crops. According to the statistics of the Food and Agriculture Organization of the United Nations, the global taro planting area was 39,000 hectares in 2020, and taro is considered to be the fifth most important root crop in the world and has become an important food crop in tropical and subtropical countries. Taro has been cultivated in China for more than 2,300 years. In the long process of cultivation, various local varieties have been formed due to environmental factors and human selection in different regions.

[0003] Germplasm resources are the premise of breeding, and accurate evaluation of germplasm resources can greatly improve the utilization rate of materials by breeders or researchers. Traditional field phenotype evaluation and identification can only visually investigate resources, and is greatly affected by subjective personal judgment and objective environmental factors. However, the current popular DNA molecular marker technology can distinguish intra- and inter-species individual differences based on crop genetic information, has a short cycle, is not affected by environment and biological development cycle, has no tissue specificity, has high-throughput detection, and has been widely used in genetic diversity analysis and fingerprinting of germplasm resources. As the third generation of molecular marker technology, SNP has the characteristics of large number, stable genetic force, simple and rapid operation, wide application, etc.

[0004] There are few studies on the genetic diversity analysis of taro resources. Wang et al. analyzed the genetic diversity of 234 taro germplasm resources from 16 provinces in China using whole genome SNP markers, and considered that the test materials could be divided into 8 groups. Pan et al. developed high-density InDel SSR sites covering the entire genome based on the resequencing data of taro core germplasm, and divided 121 resources into three groups, but they did not screen out core markers for subsequent effective use. Guo et al. screened 22 pairs of SSR molecular markers from 100 pairs of SSR molecular markers, and completed the genetic diversity analysis of 109 taro resources, providing useful markers for the identification and evaluation of taro resources. However, SSR markers rely on PCR amplification and electrophoresis analysis, and compared with SNP, its throughput is lower, time-consuming is longer, and genetic stability is lower. SUMMARY

[0005] The application aims to provide a SNP molecular marker combination for identifying taro germplasm resources and an application.

[0006] To achieve the above-mentioned purpose, the application provides the following technical solutions.

[0007] In a first aspect, the application provides a SNP molecular marker combination for identifying taro germplasm resources, which comprises 27 SNP markers and is specifically as follows.

[0008] The first locus is located at 142740049 of LG01 chromosome, and the variation type is C / T;

[0009] The second locus is located at 208737408 of LG01 chromosome, and the variation type is C / T;

[0010] The third locus is located at 64737033 of LG02 chromosome, and the variation type is T / C;

[0011] The fourth locus is located at 65417421 of LG02 chromosome, and the variation type is T / C;

[0012] The fifth locus is located at 8979131 of LG08 chromosome, and the variation type is C / G;

[0013] The sixth locus is located at 22020255 of LG01 chromosome, and the variation type is G / T;

[0014] The seventh locus is located at 48214697 of LG01 chromosome, and the variation type is A / T;

[0015] The eighth locus is located at 99501267 of LG12 chromosome, and the variation type is G / A;

[0016] The ninth locus is located at 109034243 of LG10 chromosome, and the variation type is T / G;

[0017] The tenth locus is located at 165161699 of LG05 chromosome, and the variation type is A / C;

[0018] The eleventh locus is located at 144128461 of LG04 chromosome, and the variation type is T / C;

[0019] The twelfth locus is located at 867311 of LG14 chromosome, and the variation type is A / G;

[0020] the 13th locus is located at 148250105 of LG04, and the variation type is T / G;

[0021] the 14th locus is located at 153062049 of LG05, and the variation type is C / T;

[0022] the 15th locus is located at 89325049 of LG11, and the variation type is T / C;

[0023] the 16th locus is located at 170119348 of LG08, and the variation type is C / A;

[0024] the 17th locus is located at 7248248 of LG10, and the variation type is A / G;

[0025] the 18th locus is located at 130247652 of LG06, and the variation type is G / T;

[0026] the 19th locus is located at 68668940 of LG08, and the variation type is G / A;

[0027] the 20th locus is located at 17307221 of LG08, and the variation type is T / C;

[0028] the 21st locus is located at 102781792 of LG14, and the variation type is T / C;

[0029] the 22nd locus is located at 51666285 of LG13, and the variation type is T / A;

[0030] the 23rd locus is located at 206486904 of LG01, and the variation type is T / A;

[0031] the 24th locus is located at 64252159 of LG04, and the variation type is T / C;

[0032] the 25th locus is located at 185181757 of LG02, and the variation type is G / A;

[0033] the 26th locus is located at 83510795 of LG12, and the variation type is A / G;

[0034] the 27th locus is located at 179908017 of LG01, and the variation type is A / T.

[0035] In a second aspect, the present application provides a DNA fingerprint of taro, which is constructed by using the SNP molecular marker combination.

[0036] In a third aspect, the present application provides an application of the SNP molecular marker combination in genotyping of taro germplasm resources.

[0037] In a fourth aspect, the present application provides an application of the SNP molecular marker combination in constructing a DNA fingerprint of taro.

[0038] In a fifth aspect, the present application provides an application of the SNP molecular marker combination in identification of taro resources.

[0039] In a sixth aspect, the present application provides a method for identifying taro resources, comprising:

[0040] extracting total DNA of the sample to be identified, and identifying the genotype of the SNP molecular marker combination on the locus on the genome of the sample to be identified;

[0041] comparing the genotype of the sample to be identified with the fingerprint, and determining the variety of the sample to be identified according to the comparison result.

[0042] Based on the above technical solutions, the embodiments of the present application can at least produce the following technical effects:

[0043] The present application is based on the resequencing of the reduced genomes of 29 taro germplasm collected from Hunan and some other provinces during the Third National Crop Resources Survey. A total of 86596792 single nucleotide polymorphisms (SNPs) were identified. Further screening of SNP loci screened out 252 SNP loci for the development of PARMS-SNP markers, and 27 original PARMS-SNP markers were successfully obtained. The 27 SNP markers were used to genotype 72 taro resources, and further population structure analysis, PCA principal component analysis and genetic evolution analysis were performed. Combined with field phenotypes and clustering results, it was found that there was a large amount of gene mixing between diploid and triploid taro. A taro germplasm resource fingerprint was constructed, which provides a reference for the evaluation and identification of taro germplasm resources and the breeding of new germplasm. BRIEF DESCRIPTION OF DRAWINGS

[0044] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from the structures shown in the drawings without creative labor.

[0045] Figure 1is the result of genotyping 72 taro resources by 27 pairs of primers according to the application;

[0046] Figure 2 A is the cross-validation error rate chart; B is the cluster chart of the number of subgroups (K value);

[0047] Figure 3 A is the PAC chart obtained based on SNP data; B is the phylogenetic tree constructed according to SNP data; C is the phylogenetic tree of taro samples;

[0048] Figure 4 is the marker fingerprint of taro. DETAILED DESCRIPTION

[0049] The technical solutions in the embodiments of the application will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work are within the protection scope of the application. In addition, the technical solutions in each embodiment can be combined with each other, but it must be based on that the combination of technical solutions can be realized by those skilled in the art. When the combination of technical solutions appears contradictory or unachievable, it should be considered that the combination of technical solutions does not exist, and is not within the protection scope of the application.

[0050] The object of the application is achieved by the following technical solutions.

[0051] 1. Materials and methods

[0052] 1.1 Materials

[0053] The materials used in the experiment are taro germplasm resources provided by the Vegetable Research Institute of Hunan Agricultural Academy (Table 1). According to the detection of ploidy in the early stage, 29 resources are divided into three groups, wherein A is diploid, B and C are triploid. All the materials are planted in the Gaoqiao Research Base of the Agricultural Academy in Gaoqiao Town, Changsha County, Hunan Province.

[0054] Table 1 Basic information of 29 taro resources

[0055]

[0056]

[0057] 1.2 Genome sequencing

[0058] Fresh leaves were quickly frozen in liquid nitrogen. Genomic DNA was extracted using a kit and the quality of the DNA was detected by 0.8% agarose gel electrophoresis. After quantification by ultraviolet spectrophotometer, the library with an insert size of 400 was constructed according to the standard library construction process of the TruSeq DNA PCR-free prep kit reagent of Illumina Company. The library was subjected to double-end sequencing based on the Illumuna NovaSeq sequencing platform.

[0059] 1.3 SNP analysis

[0060] To ensure the quality of subsequent analysis, the raw data was filtered using the fastp (v0.20.0) sliding window method, the contaminated adapters were removed, the reads with an average Q value of bases <20 and a length <50 bp in the window were deleted, and high-quality sequences were generated. The filtered high-quality data was aligned to the reference genome of taro using the bwa (0.7.12-r1039) mem program. (https: / / ftp.cngb.org / pub / CNSA / data2 / CNP0001082 / CNS0231432 / CNA0014218 / ). GATK software was used for SNP detection. To ensure the reliability of the SNP sites, the obtained SNP sites were further screened according to the following standards: (1) Fisher test of strand bias (FS) ≤60, (2) Haplotype Score ≤13.0, (3) Mapping Quality (MQ) ≥40, (4) Quality Depth (QD) ≥2, (5) ReadPosRankSum ≥-8.0, (6) MQRankSum >-12.5. ANNOVAR software was used for annotation of the filtered SNP sites.

[0061] 1.4 SNP screening and primer design

[0062] Further preliminary screening of SNP sites: (1) minimum allele frequency (MAF) >0.4; (2) false negative rate <0.25; (3) heterozygosity <0.6; (4) no other mutations at 50 bp on both sides of the SNP site. The 50 bp sequence upstream and downstream of the SNP was extracted. According to the TBtools software, the sequence was aligned on the reference genome, and the single aligned sequence was selected on Primer5 for primer design.

[0063] 1.5 Development of PARMS-SNP markers

[0064] The typing reagents of PARMS-SNP were from Wuhan Jingpeibio Technology Co., Ltd. 22 samples were randomly selected for preliminary primer screening, and water was used as a negative control. Primer pairs with good typing results were selected for genetic analysis of 72 materials. PIC, MAF (minimum allele frequency), GD (genetic diversity), and HE (heterozygosity) were calculated using Powermarker software.

[0065] 1.6 Genetic diversity analysis

[0066] Genetic diversity analysis was performed on the typing results of 72 materials. PCA analysis was performed using the ade4R software package. Powermarker was used to construct the phylogenetic tree. The K value was calculated using the Structure Harvester software and the optimal K value was obtained. At the same time, Admixture software (http: / / dalexander.github.io / admixture) combined with SNP information, set the K=2-10 (assuming the existence of 2-7 ancestral populations) model as a mixed model, and used the default settings of the software to analyze the genetic structure of the population. DPS software was used to perform cluster analysis on the phenotypic traits of taro resources using Euclidean distance and sum of squares.

[0067] 1.7 Construction of 72 taro fingerprints

[0068] According to the results, Excel was used to construct the fingerprint. Table 2 shows the relevant sequences of 27 core primers. The genotypes of the best combination of markers were plotted as a heatmap for fingerprinting, with each row representing a SNP site and each column representing a sample. The color coding of the genotypes is as follows: CT = yellow, TT = light green, CC = blue, GG = purple, GC = black, GA = dark red, TG = green, AT = gray, AA = red, CA = white; and no called genotypes are designated as NN = brown.

[0069] Table 2 Information of 27 core PARMS-SNP markers

[0070]

[0071]

[0072]

[0073] Note: Chr: chromosome sequence name; Position: marker position; Ref: reference genome base; Alt: variant base; primer sequence X adds a FAM fluorescent matching adapter: GAAGGTGACCAAGTTCATGCT; primer sequence Y adds a HEX fluorescent matching adapter: GAAGGTCGGAGTCAACGGATT, and Z is the reverse complementary chain.

[0074] 2 Results

[0075] 2.1 Genome sequencing and reference genome alignment

[0076] A total of 10Gb of clean data was obtained, with a Q30 of over 95%. After filtering the raw data using the fastp (v0.20.0) sliding window method, over 55,978,374 high-quality reads were obtained, with a minimum high-quality read alignment rate of 91.79%.

[0077] High-quality reads were aligned to the reference genome. Alignment rates for reads 60, 34, and 45 were low, at approximately 60%. Alignment rates for the other samples were at least 99.3%, with duplicate alignment rates no higher than 18%. Sequencing depths of the samples were above 3×, indicating that the data can be used for the development and screening of SNP markers.

[0078] 2.3 Development of PARMS-SNP markers

[0079] Based on the results of simplified genome sequencing, 252 SNPs were identified from 86,596,792 SNPs. These 252 SNPs were further screened to identify PARMS-SNP markers. Twenty-two random samples were used to validate the 252 primer sets, resulting in a total of 36 usable PARMS-SNP markers. These 36 primer sets were typed in 72 taro samples, and the results of each typing were recorded. Nine primer sets with sample loss rates greater than 15% were removed, resulting in a total of 27 usable primer sets.

[0080] The 27 primer pairs were used to genotype 72 taro resources. Figure 1 As shown in the results, the MAF values ​​of these 27 primer sets ranged from 0.51 to 0.92, with an average MAF value of 0.63; the PIC values ​​ranged from 0.14 to 0.37, with an average PIC value of 0.34; the HE values ​​ranged from 0.07 to 0.90, with an average of 0.49; and the GD values ​​ranged from 0.15 to 0.50, with an average of 0.45. These results indicate that these primers have good genetic diversity and can be used for genetic diversity analysis of taro.

[0081] 2.4 Genetic diversity analysis of 72 taro resources

[0082] As Figure 2 shown, when analyzing the population structure and selecting K = 2-7 model as the mixed model, it is found that when K = 6, the CV error value is closer to 0, indicating that it is more appropriate to divide the 72 taro resources into 6 groups.

[0083] Using GCTA software and SNP data (excluding SNPs with MAF less than 0.05), principal component analysis was performed, as shown in Figure 3 shown, it is found that the 72 resources are divided into multiple groups, and the diploid and triploid are not clustered together. The use of evolutionary tree further confirms this conclusion. Cluster analysis was carried out based on the quality trait results of the field phenotypic trait investigation of 72 resources. It is found that the constructed evolutionary tree is mostly matched with the phenotypic cluster, but there are some resources that are different in classification between the two.

[0084] 2.5 Construction of fingerprint of 72 taro resources

[0085] As Figure 4 shown, the fingerprint of 72 local resources was constructed using 27 pairs of primers, and the research results show that these 27 markers can effectively distinguish resources. Among these resources, samples 40 and 121, 97 and 17, and 59 and 37 show differences at only one site, indicating that there is potential similarity between varieties. These are also very similar in phenotypic traits.

[0086] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited by the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. A SNP molecular marker combination for identifying taro germplasm resources, characterized in that: The SNP molecular marker combination includes 27 SNP markers, as follows: The first site is located at position 142740049 of chromosome LG01, and the mutation type is C / T; The second site is located at position 208737408 of chromosome LG01, and the mutation type is C / T; The third site is located at position 64737033 of chromosome LG02, and the mutation type is T / C; The fourth locus is located at position 65417421 of chromosome LG02, and the mutation type is T / C; The fifth locus is located at position 8979131 of chromosome LG08, and the mutation type is C / G; The sixth locus is located at 22020255 of chromosome LG01, and the mutation type is G / T; The 7th site is located at position 48214697 of chromosome LG01, and the mutation type is A / T; The 8th locus is located at 99501267 on chromosome LG12, and the mutation type is G / A; The 9th locus is located at 109034243 on chromosome LG10, and the mutation type is T / G; The 10th locus is located at 165161699 on chromosome LG05, and the mutation type is A / C; The 11th site is located at position 144128461 of chromosome LG04, and the mutation type is T / C; The 12th locus is located at position 867311 of chromosome LG14, and the mutation type is A / G; The 13th site is located at 148250105 on chromosome LG04, and the mutation type is T / G; The 14th locus is located at position 153062049 of chromosome LG05, and the mutation type is C / T; The 15th locus is located at position 89325049 of chromosome LG11, and the mutation type is T / C; The 16th locus is located at position 170119348 of chromosome LG08, and the mutation type is C / A; Locus 17 is located at position 7248248 of chromosome LG10, and the mutation type is A / G; The 18th locus is located at position 130247652 of chromosome LG06, and the mutation type is G / T; The 19th locus is located at position 68668940 of chromosome LG08, and the mutation type is G / A; The 20th locus is located at position 17307221 of chromosome LG08, and the mutation type is T / C; The 21st locus is located at position 102781792 of chromosome LG14, and the mutation type is T / C; The 22nd site is located at position 51666285 of chromosome LG13, and the mutation type is T / A; The 23rd site is located at 206486904 on chromosome LG01, and the mutation type is T / A; The 24th locus is located at position 64252159 of chromosome LG04, and the mutation type is T / C; The 25th locus is located at 185181757 on chromosome LG02, and the mutation type is G / A; The 26th locus is located at 83510795 on chromosome LG12, and the mutation type is A / G; The 27th site is located at 179908017 on chromosome LG01, and the mutation type is A / T.

2. A taro DNA fingerprint, characterized in that: The method is constructed using the SNP molecular marker combination described in claim 1.

3. Use of the SNP molecular marker combination according to claim 1 in genotyping taro germplasm resources.

4. Use of the SNP molecular marker combination according to claim 1 in constructing a DNA fingerprint of taro.

5. Use of the SNP molecular marker combination according to claim 1 in identifying taro resources.

6. A method for identifying taro resources, characterized in that: include: Extracting total DNA from the sample to be identified, and identifying the genotype of the site where the SNP molecular marker combination according to claim 1 is located on the genome of the sample to be identified; The individual genotype of the sample to be identified is compared with the fingerprint pattern; and the variety of the sample to be identified is determined based on the comparison result.

Images