Application of grape acetyl serotonin O-methyltransferase gene VvAST in induction of seedless

Abstract

The invention discloses an application of a grape acetyl serotonin O-methyltransferase gene VvAST in induction of seedless, and a preparation method of the grape acetyl serotonin O-methyltransferase gene. Nucleotide sequences and amino acid sequences and specific applications are provided. The invention shows that overexpression of VvAST in tomato can significantly inhibit seed development and generate seedless phenotypes. Therefore, the VvAST can be used as a key molecular target for regulating and controlling the development of grape and tomato seeds, and has potential application value. Through gene editing or regulation and control of the expression level, stable and efficient seedless grape breeding is expected to be realized, and industrial development of high-quality seedless grape fruits is promoted.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant molecular biology, and more particularly to an application of a grape acetylserotonin O-methyltransferase gene VvASMT in inducing seedlessness. BACKGROUND

[0002] Grape is widely planted due to its good taste and rich nutrition, and seedless grape is particularly favored by consumers due to its convenience. However, the resources of natural seedless varieties on the market are still limited, which cannot meet the diversified needs of consumers. At present, the main method for seedless treatment of grape is to use plant growth regulators such as gibberellin (GA3), streptomycin (SM) and forchlorfenuron (CPPU) for seedless treatment, but it will increase the economic cost and labor cost, and some seedless treatment agents have certain harm to the environment, which is not conducive to the sustainable development of the industry. Therefore, it has important theoretical significance to use molecular biology and genetics means to mine and identify grape seedless genes and study their regulation mechanism of seedlessness, for cultivating natural seedless high-quality grape varieties.

[0003] The research on grape seedlessness molecular biology mainly focuses on the development of seedlessness related molecular markers and the mining of key seedlessness genes. So far, some seedlessness related structural genes have been identified in grape, including MC4, etc. In addition, many transcription factor families are also involved in the regulation of seedlessness induction, such as MYB, etc. The heterologous overexpression or silencing of some genes in these families in model plants such as Arabidopsis or tomato can lead to seed abortion and increase the seedlessness rate. However, the research on these seedlessness genes and the regulation mechanism of transcription factors in the homologous system grape is still rare.

[0004] ASMT (N-acetylserotonin methyltransferase) gene is a key enzyme gene in the melatonin biosynthesis pathway, which catalyzes the conversion of N-acetylserotonin to melatonin. In addition to regulating melatonin synthesis, ASMT also plays an important role in plant response to various biological and abiotic stresses, participates in the regulation of drought resistance, salt resistance, disease resistance and heavy metal stress response, and has multiple functions such as regulating redox state, removing active oxygen and maintaining cell homeostasis. In recent years, the function of ASMT gene in plants such as rice, tomato and Arabidopsis has been widely studied, and its potential in improving crop stress resistance has been confirmed. However, the research on ASMT gene in grape is relatively lagging behind, especially in the verification of gene function and its regulation mechanism. And there is no report on the function of ASMT in inducing plant seedlessness.

[0005] Therefore, whether a grape acetylserotonin O-methyltransferase gene VvASMT can be used to induce seedlessness is a problem that those skilled in the art need to solve. SUMMARY

[0006] Therefore, the application provides an application of a grape acetylserotonin O-methyltransferase gene VvASMT in inducing seedlessness.

[0007] To achieve the above object, the application adopts the following technical scheme:

[0008] The application of the grape acetylserotonin O-methyltransferase gene VvASMT in inducing seedlessness, wherein the nucleotide sequence of the gene VvASMT is shown in SEQ ID No. 1.

[0009] Preferably, the amino acid sequence encoded by the gene VvASMT is shown in SEQ ID No. 2.

[0010] Preferably, the seedlessness is seedlessness of grape or tomato.

[0011] Preferably, a recombinant vector is constructed by using the gene VvASMT, and overexpression is performed in grape or tomato.

[0012] Preferably, the application is used for breeding.

[0013] Compared with the prior art, the application first discloses the application of the grape acetylserotonin O-methyltransferase gene VvASMT in inducing seedlessness, and the technical effect is that the application shows that overexpression of VvASMT in tomato can significantly inhibit seed development and produce a seedless phenotype. Therefore, VvASMT can be used as a key molecular target for regulating seed development of grape and tomato, and has potential application value. Through gene editing or regulating the expression level, stable and efficient seedless breeding of grape can be achieved, and the industrial development of high-quality seedless grape products is promoted. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description only show the embodiments of the application, and for those skilled in the art, other drawings can be obtained without creative labor on the basis of the provided drawings.

[0015] Figure 1The drawings are sequence analysis and subcellular localization maps of VvASMT provided by the present application; wherein, A: phylogenetic analysis of VvASMT protein sequence of grape and ASMT proteins in Arabidopsis (AT4G35160), Populus trichocarpa (XP_024446865.1), Fragaria vesca (XP_004303127.1), Vaccinium uliginosum (KAH7844778.1), Citrus unshiu (GAY55611.1), Euonymus alatus (XP_059664346.1) and Malus domestica (MD05G1308800); B: real-time quantitative analysis of expression of VvASMT in different tissues of nucellar variety 'Sunrise' (SM) and natural seedless variety 'Thompson Seedless' (TS), data are expressed as mean ± SD (n=3 biological replicates); asterisks indicate statistical significance (*P<0.05, **P<0.01, ns: not significant); C: subcellular localization of VvASMT in Arabidopsis protoplast.

[0016] Figure 2 The drawings are a pRI101-35s-VvASMT-GFP vector map provided by the present application.

[0017] Figure 3 The drawings are a positive situation map of VvASMT overexpression tomato lines provided by the present application, A: semi-quantitative analysis of all transgenic lines; B: OE-VvASMT RT-qPCR comparison of transgenic lines OE-ASMT-#1 / 4 / 7 / 8 and OE-ASMT-#6; taking SlUbi as the internal reference gene, data are expressed as mean ± SD (n=3 biological replicates); asterisks indicate statistical significance (**P<0.01, ***P<0.001).

[0018] Figure 4 The drawings are phenotype and morphological characteristic analysis maps of transgenic tomato plants overexpressing VvASMT provided by the present application, wherein, A: fruit cross section of wild type WT and OE-VvASMT overexpression line, scale bar=1cm; B: single fruit seed number statistics of WT and OE-VvASMT lines, data are at least the average value ± standard deviation of 10 fruits, black dots represent individual values; C: single fruit seed weight of WT and OE-VvASMT lines, data are at least the average value ± standard deviation of 10 fruits, asterisks indicate statistical significance (**P<0.01, ***P<0.001). DETAILED DESCRIPTION

[0019] Clearly, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present application.

[0020] The present application discloses an application of VvASMT in inducing seedlessness.

[0021] The raw materials and reagents not mentioned in the embodiments are all commercially available, and the experimental methods not mentioned are all common experimental methods, which will not be repeated here.

[0022] Embodiment 1

[0023] The sequence information of VvASMT gene (VIT_212s0028g02740.1) was obtained through the phytozome website (https: / / phytozome-next.jgi.doe.gov / ), and it was found to contain an open reading frame of 1077 bp (nucleotide sequence: ATGGCTTTGGCAGTTGGTGAGACATCGACTGAGCTACTTCATGCTCATFigure 1 Middle A).

[0024] Example 2

[0025] To analyze differential expression of the VvASMT gene between seeded and seedless varieties, expression profiling was performed in mature tissues (including flowers, leaves, fruit, and stems) of the seeded grape cultivar 'Sunshine Rose' (SM) and the naturally seedless 'Seedless White' (TS). Total RNA was extracted from ovules of 'Sunshine Rose' and 'Seedless White' grapes using TRIzol reagent (Invitrogen, USA), and genomic DNA was removed using DNase I (TaKaRa, Dalian, China). cDNA was obtained and quantitative RT-PCR (qRT-PCR) was performed using a LightCycler 480 I system (Roche, Switzerland; gene-specific primers are listed in Table 1, RT-VvASMT). VvActin was used as an internal reference gene. Three biological replicates were performed for each reaction.

[0026] Use 2 -ΔΔCT The relative expression levels were calculated using the real-time quantitative PCR and 2(-Delta Delta C(T)) method (Livak, KJ, Schmittgen, TD, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25: 402-408.). The results showed that the VvASMT gene was constitutively expressed and that there were variety-specific differences in flowers and stems (see Appendix). Figure 1 Middle B).

[0027] Table 1

[0028]

[0029] Among them, in pRI101-ASMT, CCGTCGACCCCGGGGGTACC and CCCTTGCTCACCATGAATTC are homology arms.

[0030] System: See Table 2;

[0031] RT-PCR procedure: see Table 3;

[0032] Table 2

[0033] Component System (20 μL) 2x PCR Taq mix 10 μL RT-VvASMT-F / RT-SlUbi-F 0.5 μL RT-VvASMT-R / RT-SlUbi-R 0.5 μL cDNA 1 μL ddH2O qsp to 20 μL

[0034] Table 3

[0035] Temperature Time Cycle number 95℃ 3 min 1 95℃ 15s 25 55℃ 15s 25 72℃ 15s 25 72℃ 5 min 1 16℃ Forever

[0036] Example 3

[0037] To analyze the site where VvASMT might function, subcellular localization analysis was performed. The coding sequence (CDS, without stop codon, primer see Table 1, pRI101-ASMT, amplification system see Table 4, amplification procedure see Table 5) of VvASMT was amplified using high-fidelity enzyme (Novagen, 2x Phanta Max Master Mix, P515-01) with 'Shine Muscat' ovule cDNA as template. Subsequently, the amplified and recovered product of VvASMT was ligated into linearized pRI101-35s-GFP vector using one-step cloning kit (Novagen, ClonExpress II OneStep Cloning Kit, C112-01) to obtain pRI101-35s-VvASMT-GFP (see Appendix 1, Fig. 1). Figure 2 ).

[0038] The enzyme digestion system of linearized pRI101-35s-GFP vector is shown in Table 6.

[0039] The ligation system of homologous recombination is shown in Table 7.

[0040] Table 4

[0041]

[0042]

[0043] Table 5

[0044] Temperature Time Cycle number 95℃ 3 min 1 95℃ 15s 35 55℃ 15s 35 72℃ 30s 35 72℃ 7 min 1 16℃ Forever

[0045] Table 6

[0046]

[0047] Table 7

[0048]

[0049] The resulting pRI101-35s-VvASMT-GFP was introduced into Arabidopsis protoplasts (according to the method described in Yoo, SD, Cho, YH, & Sheen, J., 2007. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat Protoc, 2:1565-1572). The green fluorescence signal of the GFP-tagged protein was observed using a confocal laser scanning microscope (Nikon C2-ER). Subcellular localization was assessed by coexpression of a chlorophyll localization marker with excitation and emission wavelengths of 640 nm and 675 nm, respectively.

[0050] The results showed that the VvASMT gene was expressed at the same position as the chlorophyll marker, indicating that it was located in the chloroplast (see Appendix Figure 1 Middle C).

[0051] Example 4

[0052] To further validate the function of VvASMT, an overexpression system was established in tomato. Using 'Shine Muscat' ovule cDNA as a template, the CDS region of VvASMT was amplified using a high-fidelity enzyme (NoviZen, 2× Phanta Max Master Mix, P515-01) (primers are shown in Table 1, pRI101-ASMT; the amplification system and procedure are the same as in Tables 4 and 5 of Example 3). The recovered VvASMT product was then cloned into the linearized pRI101-35s-GFP vector using a one-step cloning kit (NoviZen, ClonExpress II One Step Cloning Kit, C112-01).

[0053] The restriction enzyme digestion system for the linearized pRI101-35s-GFP vector is shown in Table 6.

[0054] The ligation system for homologous recombination is shown in Table 7.

[0055] After the recombinant plasmid pRI101-35s-VvASMT-GFP vector was constructed, it was introduced into the Agrobacterium tumefaciens GV3101 strain and genetically transformed into Micro-Tom tomatoes using the leaf disc method. The specific steps were as follows: healthy Micro-Tom seedlings were selected, true leaves were cut and cut into leaf discs of about 0.5 cm × 0.5 cm, and the leaf discs were placed in a suspension containing the recombinant strain (OD 600= 0.6) for 10 min, and then the leaf discs were transferred to co-cultivation medium (containing acetosyringone) for 2 days in the dark. After co-cultivation, the leaf discs were transferred to selection medium (containing kanamycin and cefotaxime, the former being resistant to the vector and the latter inhibiting Agrobacterium) for selection and induction of regeneration. After callus and shoots differentiated, the leaf discs were transferred to rooting medium for induction of rooting. Finally, transgenic plants stably expressing VvASMT were obtained.

[0056] Eight regenerated lines were obtained by transformation, and the VvASMT regenerated lines (OE-VvASMT) were detected by molecular means. The expression of the eight independent lines was detected by RT-PCR (using RT-VvASMT primers in Table 1, and RT-SlUbi as an internal control gene). Figure 3 A), and the OE-VvASMT-#6 with weak expression was used as a control. The expression levels of OE-VvASMT-#1 and OE-VvASMT-#7 with the highest transcription levels were further detected by qRT-PCR (primers same as RT-PCR) for subsequent functional analysis Figure 3 B).

[0057] Notably, in these two lines, overexpression of VvASMT significantly inhibited seed formation, and the fruits were almost completely seedless Figure 4 A). The average number of seeds per fruit in wild type was 20.43, while in the overexpression lines it was only 0.38 Figure 4 B), which was 1.86% of the wild type; the average seed weight per fruit in wild type was 23.31 mg, while in the transgenic plants it was only 7.05 mg, which was 30.24% of the wild type Figure 4 C).

[0058] These results show that VvASMT plays an important inhibitory role in regulating seed development and is an important functional gene involved in seedlessness.

[0059] The various embodiments in the specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0060] The above description of disclosed embodiments enables a person skilled in the art to implement or use the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A use of a grape acetyl-serotonin O-methyltransferase gene VvASMT in inducing enucleation, characterized in that: The nucleotide sequence of the gene VvASMT is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that The amino acid sequence encoded by the gene VvASMT is shown in SEQ ID No.

2.

3. The use according to claim 1 or 2, characterized in that The seedless: grapes or tomatoes are seedless.

4. The use according to claim 3, characterized in that The gene VvASMT was used to construct a recombinant vector and overexpressed in grapes or tomatoes.

5. The use according to claim 4, characterized in that Used for breeding.

Images