Application of ZmMIR319A gene in regulation and control of heat resistance of corn

Abstract

The invention relates to the field of genetic engineering breeding and molecular breeding, and particularly discloses application of ZmMIR319A in regulation and control of heat resistance of corn. According to the invention, corn ZmMIR319A is knocked out by using a gene editing technology, three different types of gene knockout mutants are created, and a ZmMIR319A overexpression material is created at the same time. At the normal growth temperature (25-28 DEG C) of corn, the ZmMIR319A knockout mutant and the overexpression material do not show temperature sensitivity to the wild type, but at the high temperature (45 DEG C), compared with the wild type, the ZmMIR319A mutant is more sensitive to high temperature stress, and the sensitivity of the ZmMIR319A overexpression material to the high temperature stress is reduced, which indicates that the ZmMIR319A positively regulates and controls the high temperature stress resistance of the corn. The invention provides reference for studying the high-temperature-resistant stress molecular mechanism of the corn, and provides potential gene resources for cultivating excellent new germplasm of the high-temperature-resistant corn.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering breeding and molecular breeding, and particularly relates to a corn ZmMIR319A gene and its application in corn high temperature stress tolerance. BACKGROUND

[0002] In recent years, global warming has become a significant trend, and high temperature stress has a negative impact on all stages of crop growth and development, especially on major food crops such as corn. Corn is most sensitive to high temperature during flowering, and high temperature above 38°C can directly affect pollen viability and fertilization, resulting in a 15% decrease in seed setting rate (Hu Junpeng et al., 2025). In addition, high temperature during grain filling will shorten the grain filling time, resulting in a decrease in grain weight and quality (Yan Hengyu et al., 2024).

[0003] microRNA (miRNA) is a class of endogenous non-coding small molecule RNA with a length of about 20-24 nucleotides. In plants, miRNA genes (MIR) are transcribed into primary transcripts pri-miRNA by RNA polymerase II, and then processed into pre-miRNA by DCL1, HYL1, SE, and other protein complexes in the nucleus, and finally form mature miRNA / miRNA* double-stranded complexes (Park et al., 2002). After methylation by HEN1, the complex is transported to the cytoplasm by HASTY, combined with AGO protein to form RNA-induced silencing complex (RISC), and negatively regulates gene expression at the post-transcriptional level by cleaving target mRNA or inhibiting its translation (Vaucheret et al., 2004; Yang et al., 2006). Plant miRNA and its target mRNA usually have high complementarity, and its expression has tissue specificity and spatiotemporal dynamics (Zhou Wenjie et al., 2024; Song Zihuo et al., 2024). Multiple conserved miRNA families have been identified in plants, including miR156, miR159, miR160, miR169, miR172, miR319, miR408, and miR528, etc. These miRNAs target specific transcription factors or functional genes and are widely involved in plant growth and development (Qin Cheng et al., 2011; Dai Qian et al., 2022; Zhou Wenjie et al., 2024).

[0004] miRNA is also an important regulatory factor for plants to respond to abiotic stress such as drought, salt stress, extreme temperature, and heavy metals. Under drought stress, miR156 and miR169 are up-regulated, and regulate SPL and NF-YA genes, respectively, to enhance plant drought resistance (Zhang et al., 2023; Wan et al., 2022). Studies have shown that Mdm-miR160 can improve the resistance of apple (Malus pumila Mill., a positive regulator of drought stress, improves plant drought tolerance by promoting root and rhizome development (Shen et al., 2021). Under salt stress, miR398 regulates the reactive oxygen species (ROS) scavenging system by targeting the CSD gene, alleviating salt-induced oxidative stress (Paque et al., 2016). Under heavy metal stress, miR156, miR395, and miR397 mitigate metal toxicity such as Cd and Al by regulating metal transporter and antioxidant enzyme genes (Shen et al., 2017; Huang et al., 2021). Under low temperature stress, miR319 and miR408 expression changes enhance plant cold tolerance by regulating the TCP and LAC genes, respectively. For example, overexpression of rice OsamiR319a and Osa-miR319b resulted in wider rice leaves, an increase in the number of longitudinal veins, and enhanced cold tolerance of plants (Yang et al., 2013); the expression levels of barley miR160a, miR166a, miR167h, and miR5175a increased significantly after high temperature stress, which downregulated the auxin response transcription factor ARF17 、 ARF13, ARF8 and ARF6 The expression of α-miR319d in tomato improves the tolerance of barley to high temperature (Kruszka et al., 2014); GAMYB-like1 miRNA319 regulates the plant's tolerance to low and high temperature stress by regulating its expression level (Shi et al., 2019). However, there are currently no reports on the regulation of high temperature stress response in maize.

[0005] This study used CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create three different types of mutations. ZmMIR319A gene knockout mutants ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 , and created ZmMIR319A Overexpression materials ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 The wild type and ZmMIR319A The knockout mutants and overexpression seedlings were subjected to 45℃ high temperature stress. ZmMIR319A Mutants ( ZmMIR319A- KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3) are more sensitive to high temperature stress, with significant leaf burn symptoms, a significant increase in ROS content in the body, and a decrease in the activity of ROS scavenging enzymes (catalase, superoxide dismutase, and peroxidase). ZmMIR319A Overexpression materials ( ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3 ) decreased sensitivity to high temperature stress, leaf burn symptoms were milder, ROS content in the body was significantly reduced, and the activity of ROS scavenging enzymes (catalase, superoxide dismutase, and peroxidase) was significantly increased, indicating that corn ZmMIR319A Genes play an important role in regulating corn's high-temperature resistance. The present invention provides potential gene resources for the discovery of corn's heat-resistant related genes and the cultivation of new heat-resistant corn varieties. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to clearly ZmMIR319A The application of this technology in regulating the resistance of corn to high temperature stress provides genetic resources and new germplasm for the cultivation of new high temperature resistant corn varieties. The specific technical solution is as follows: Maize inbred line X249 ZmMIR319A Sequence analysis of ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the mature sequence of miR319 is shown in SEQ ID NO. 2. Suitable sites were selected for gene editing target design.

[0007] Constructed using CRISPR / Cas9 gene editing technology ZmMIR319A The gene-editing vector was introduced into callus tissue of the maize inbred line X249 using Agrobacterium-mediated transfection. The resulting T0 transgenic plants were then hybridized with wild-type X249 to produce F1 seeds. After self-pollination and genotyping, homozygous non-transgenic gene-edited seeds were obtained. After germination and growth in soil in an artificial climate chamber for 14 days, they were subjected to a high-temperature treatment at 45°C. Leaf burns and changes in the activity of ROS and their scavenging enzymes were investigated and tested.

[0008] An overexpression vector was constructed and introduced into callus tissue of the maize inbred line X249 using Agrobacterium-mediated transfection. Homozygous positive T2 seeds were obtained and cultured in soil in an artificial climate chamber for 14 days before being subjected to a high-temperature treatment at 45°C. Leaf burns and changes in the activity of ROS and their scavenging enzymes were investigated and tested.

[0009] The present invention utilizes CRISPR / Cas9 technology to ZmMIR319A By performing site-directed gene editing, three mutants of this gene with different editing types were obtained. All three mutants showed a phenotype with significantly increased sensitivity to high temperature treatment. ZmMIR319A Overexpression materials showed a phenotype with significantly reduced sensitivity to high temperature treatment. ZmMIR319AUpregulate the heat tolerance of corn. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 , corn pCas9-ZmMIR319A Vector design map.

[0011] Figure 2 , ZmMIR319A Knockout event gene sequence variation analysis. Base variation sites are represented in blue font, ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 Deletion bases are represented by a blue short line.

[0012] Figure 3 , corn pUbi-ZmMIR319A Vector map Figure 4 , corn ZmMIR319A Comparison of expression levels in overexpression plants. The second leaf of wild type and overexpression plants grown under normal conditions for 14 days was taken for total RNA extraction and reverse transcription, respectively, to compare the relative expression levels of ZmTubulin5 Gene as internal reference for quantitative PCR detection of precursor ZmMIR319A (P<0.05). Among them ZmMIR319A Overexpression plants ZmMIR319A-OE#1 , ZmMIR319A-OE# 2, ZmMIR319A-OE#3 The three homozygous lines were used for heat tolerance research of the present application.

[0013] Figure 5 , corn ZmMIR319A Phenotype and physiological analysis of knockout mutants under high temperature stress. a-b. Phenotypic differences of wild type (WT) and ZmMIR319A knockout mutants ( ZmMIR319A-KO ) after 45℃ high temperature treatment for 14h; c. Differences in reactive oxygen species content (NBT staining) of the first leaf of wild type and ZmMIR319A knockout mutants after 45℃ high temperature treatment for 3h; d. Comparison of reactive oxygen scavenging enzyme (catalase, superoxide dismutase, peroxidase) activity in the second leaf of wild type and ZmMIR319A knockout mutants after 45℃ high temperature treatment for 3h. The asterisk * in the column chart indicates that there is a significant difference (P<0.05) in t-test.

[0014] Figure 6 , corn ZmMIR319A Phenotype and physiological analysis of overexpression plants under high temperature stress. a-b. Phenotypic differences of wild type (WT) and ZmMIR319A overexpression plants ( ZmMIR319A-OE ) after 45℃ high temperature treatment for 14h; c. Differences in reactive oxygen species content (NBT staining) of the first leaf of wild type and ZmMIR319ADifferences in active oxygen content (NBT staining) of the first leaf of the overexpression plants after 3h high temperature treatment at 45℃; d. Comparison of active oxygen scavenging enzyme (catalase, superoxide dismutase, peroxidase) activities in the second leaf of the overexpression plants after 3h high temperature treatment at 45℃. The asterisk * in the column chart indicates that there is a significant difference (P<0.05) in t-test. ZmMIR319A Differences in active oxygen content (NBT staining) of the first leaf of the overexpression plants after 3h high temperature treatment at 45℃; d. Comparison of active oxygen scavenging enzyme (catalase, superoxide dismutase, peroxidase) activities in the second leaf of the overexpression plants after 3h high temperature treatment at 45℃. The asterisk * in the column chart indicates that there is a significant difference (P<0.05) in t-test. DETAILED DESCRIPTION

[0015] Example 1. Creation of mutant plants using CRISPR / Cas9 method ZmMIR319A Mutant material In order to clarify ZmMIR319A the role of the mutant in the heat tolerance of corn, the present application uses gene cloning and vector construction technology to create a mutant by gene editing and investigate the function of the gene in corn. The present application selects corn inbred line X249 as the recipient material for gene editing, designs the target region MT1 of CRISPR / Cas9 gene editing according to the mature sequence (SEQ ID NO. 2) information and the sequence information before the mature sequence. ZmMIR319A ZmMIR319A

[0016] MT1 (SEQ ID NO. 3): CTGTTTGTGGTTGGACTGAAGGG 1, ZmMIR319A Construction of knockout vector The gene editing vector of the present application is pBUE411-ZmMIR319A-Cas9 , the basic vector of the vector is pBUE411-Cas9 , the intermediate vector is pCBCmT1T2 , and gRNA is provided. The present application obtains MT-sgRNA by designing target points on primers and then cutting and connecting to the basic vector through PCR, and the specific construction process is as follows.

[0017] (1) Design of target gRNA. The gene conservative sequence of ZmMIR319A is input into the http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website for target design. The sgRNA skeleton sequence of the present application is obtained by directly amplifying the intermediate vector.

[0018] (2) Obtain MT-sgRNA by designing target points on primers and PCR amplification. Primer ZmMIR319A-MT1-F (SEQ ID NO. 4) and primer ZmMIR319A-MT1-R (SEQ ID NO. 5) amplify the intermediate vector pCBCmT1T2 to obtain a fragment containing the first and second targets. The PCR system and conditions are as follows: template DNA (intermediate vector pCBCmT1T2 ​​≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; sterilized ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The temperature program of PCR was as follows: ① 98 ℃ 2 min; ② 98 ℃ 10 s; ③ 58 ℃ 30 s; ④ 72 ℃ 30 s; ⑤ cycle 33 times from ②-④; ⑥ 72 ℃ 5 min; ⑦ 25 ℃ 10 min. The PCR product was recovered after agarose gel electrophoresis.

[0019] The primer base sequence required for vector construction is shown in SEQ ID NO. 4 and SEQ ID NO. 5.

[0020] SEQ ID NO. 4: 5'-ATATATGGTCTCTGGCGACTGTTTGTGGTTGGACTGAAGGGGTTTTAGAGCTAGAAATAGCAA-3'; SEQ ID NO. 5: 5'-ATTATTGGTCTCTAAACCTGTTTGTGGTTGGACTGAATGCTTCTTGGTGCCGC-3'; (3) Constructed to the backbone vector by enzyme digestion and ligation. The pBUE411-Cas9 vector and the recovered sgRNA fragment with the target were digested with BsaI BsaI, and T4 ligase was added at the same time to ligate the vector and the sgRNA fragment. The enzyme digestion and ligation system was as follows: sgRNA fragment: 2 μL pBUE411-Cas9 vector (≥60 ng / μL): 2 μL 10 x NEB Buffer: 1.5 μL BsaI endonuclease (product number: #R3733S): 1 μL T4 ligase (product number: #M0202M): 1 μL ddH2O: 6 μL.

[0021] The design diagram of the maize pCas9-ZmMIR319A vector component is shown in Figure 1 FIG. 1.

[0022] 2. Agrobacterium-mediated genetic transformation of maize The transformation receptor was maize inbred line X249, which carried one ZmMIR319A copy.

[0023] The pCas9-ZmMIR319A vector constructed above was transformed into thepCas9-ZmMIR319A The vector is transformed into Agrobacterium EHA105 by heat shock method, PCR is used for identification, and the bacterial liquid is stored at -80°C with glycerol. Freshly peeled 1.5 mm or so of inbred line X249 embryo is used as the receptor material, and the peeled corn embryo is placed in a 2 mL plastic centrifuge tube containing 1.8 mL of suspension, and the placement time is not more than 1 h, about 100 embryos are placed in each centrifuge tube; the suspension is sucked off, and the embryos are washed twice with new suspension, a small amount of suspension is reserved at the bottom of the tube which can cover the embryos, then heat shock at 43°C for 2 min, then ice bath for 1 min, use a pipette to suck the remaining washing solution, and add 1.0 mL of Agrobacterium infection solution, shake gently for 30 s, then stand in the dark for 8 min. Next, the embryos and the infection solution in the centrifuge tube are poured onto the co-culture medium, shaken evenly, and the excess infection solution is sucked out with a pipette, all the scutes of the embryos are upwards, and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos are transferred to the recovery medium with sterile forceps, cultured at 28°C for 14 days, and the growing sprouts on the embryos are removed in time during the process. After recovery culture, the embryos are placed on the screening medium containing 1.5 mg / L Bialaphos for 3 rounds of screening, 2 weeks for each round, and then transferred to the screening medium containing 2 mg / L Bialaphos for 2 rounds of screening, 2 weeks for each round. The resistant callus is transferred to the propagation medium and cultured in the dark at 28°C for 2 weeks. Then the resistant callus is transferred to the induction medium and cultured in the dark at 28°C for 2 weeks. Then it is transferred to the differentiation medium and cultured under light at 25°C and 5000 lux for 2 weeks. After the culture, the differentiated seedlings are separated into single seedlings and placed in the rooting medium, and continue to be cultured under light at 25°C and 5000 lux until rooting; the seedlings are transferred to small pots for growth, and after growth and survival, they are transplanted to the greenhouse, and the offspring seeds are harvested after 3-4 months.

[0024] 3. Detection of T0 generation plant knockout mutation results In order to determine the T0 generation plant knockout mutation results, the following steps are taken: In the present application, CTAB method is used to extract corn leaf DNA, and the specific method is as follows: cut the seedling leaves of about 2 cm in length, and put them into a 2 mL centrifuge tube containing steel balls; put the centrifuge tube containing the leaves into liquid nitrogen for 5 minutes, and use a grinder to crush the leaf samples; add 700 μL of CTAB extraction buffer (containing 1% of β-mercaptoethanol), mix well by shaking vigorously, preheat in 65 ℃ constant temperature water bath for 20-30 min (during this period, take out and invert once); after the centrifuge tube cools to room temperature, add 700 μL chloroform: isopropyl alcohol (24:1) extractant, shake vigorously for 30 s, and then stand still at room temperature for a while; centrifuge at 12000 rpm at 4 ℃ for 5 min, take 500 μL supernatant into a new 1.5 mL centrifuge tube; add an equal volume of isopropyl alcohol to the centrifuge tube containing the supernatant, mix well by shaking, and stand still at room temperature for about 10 min; then place the centrifuge tube containing the sample in a 4 ℃ centrifuge, centrifuge at 12000 rpm for 10 min, gently pipette the supernatant, discard the supernatant, and retain the precipitate; add 800 μL 75 % ethanol, wash the precipitate twice, centrifuge at 10000 rpm for 5 min, and discard the supernatant; place the sample at room temperature and dry naturally for 2-4 h, obtain the DNA precipitate, add an appropriate amount of sterile water to dissolve, gently shake, and fully dissolve the DNA. Store the DNA sample at -20 ℃. Detect the DNA concentration with Nanodrop, and dilute to 10 ng / L for use as a PCR template.

[0025] Then according to ZmMIR319A the gene sequence, design PCR primers.

[0026] Detect target: MT1; product size: 636 bp; primer sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7: SEQ ID NO. 6 ZmMIR319A-1 -T-F: 5'-CGTTTGCGTTCACCTCTG-3'; SEQ ID NO. 7 ZmMIR319A-1 -T-R: 5'-GGTCCCCGAGCTCTATCG-3'.

[0027] Amplify according to the following PCR parameters: Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterilized ddH2O, 7.5 μL 2x taq mix (product number: 10103ES); Reaction procedure: conventional PCR: annealing and extension at 58 ℃ for 30 s, 32 cycles.

[0028] Then the PCR product was recovered and ligated into a T-vector for sequencing. The DNA sequences of the target region of multiple T0 generation independent positive transformation events were sequenced to determine whether the target region was genetically edited.

[0029] Three mutation types were obtained by using X249 as the transgenic plant receptor, and the sequences before and after editing are shown in Figure 2 corresponding to three ZmMIR319A homozygous mutants: ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 Compared with the mature sequence of the wild type ZmMIR319A , it is shown that ZmMIR319A-KO#1 there is a 9 bp base deletion in the mature sequence region of the ZmMIR319A gene; ZmMIR319A-KO#2 there is a 3 bp base deletion in the mature sequence region of the ZmMIR319A gene; ZmMIR319A-KO#3 there is a 1 bp base deletion in the mature sequence region of the ZmMIR319A gene. Figure 2 ).

[0030] 4. Genotyping of F1 generation plants Since the T0 generation plants of corn grown in the greenhouse often have uncoordinated development of female and male ears, in order to propagate the T0 generation plants and make the obtained gene editing type hereditary, the present application uses wild type pollen of corn inbred line X249 to pollinate the T0 generation plants of ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 obtained above, and then obtains F1 generation seeds, and the grown plants are F1 generation plants.

[0031] The F1 generation plants include two segregation types, one is Cas9 positive plants (transgenic plants), and the other is Cas9 negative plants (non-transgenic plants). In order to avoid continuous editing of the X249 wild type allele introduced by hybrid pollination by sgRNA and Cas9, thereby causing complexity of mutation types, it is necessary to select plants containing no Cas9 gene but containing T0 generation mutation types from F1 generation plants by genotyping, and such plants can obtain non-transgenic F2 generation after selfing. The genotyping steps of F1 generation plants are as follows: After extracting the leaf DNA according to the above CTAB method, first, the specific primers of the Cas9 gene are used for PCR amplification, and the base sequence is shown as Cas9-F (SEQ ID NO. 8) and Cas9-R (SEQ ID NO. 9): SEQ ID NO. 8: 5'-CCCGGACAATAGCGATGT-3'; SEQ ID NO. 9: 5'-GAGTGGGCCGACGTAGTA-3'.

[0032] PCR reaction system is the same as above; reaction procedure: conventional PCR: 58°C annealing, extension 30 s, 32 cycles. After agarose gel electrophoresis of PCR product, the results are distinguished Cas9 - positive plants and Cas9 - negative plants.

[0033] Further, for Cas9 - negative plants, the primers for detecting the target ZmMIR319A-1 - T-F and ZmMIR319A-1 - T-R are used for PCR amplification; after purification of the PCR product, T vector is connected, and sequencing is performed; the genetic situation of the T0 generation mutation type is analyzed and determined according to the sequencing results.

[0034] 5, Genotyping of F2 generation plants The F1 plants containing no Cas9 gene but containing the T0 generation mutation type are self-crossed (F2) to obtain homozygous, non-transgenic gene editing seeds, which are mutant seeds with a genetic background.

[0035] The F2 offspring obtained by self-crossing of the F1 generation plants includes three separation types, AA, Aa, and aa. We need to select homozygous non-transgenic gene editing plants from the F2 generation plants by genotyping. The next step of heat tolerance determination is performed on these plants. Meanwhile, homozygous non-transgenic gene editing seeds can be obtained by self-crossing of these plants. The genotyping steps of the F2 generation plants are as follows.

[0036] After extracting the leaf DNA of the F2 generation plants according to the CTAB method described above, one round of PCR amplification is performed using the primers ZmMIR319A-T-F and ZmMIR319A-T-R Two rounds of PCR amplification are performed using specific primers ZmMIR319A-T2-F and ZmMIR319A- T2-R Genotyping is performed on the PCR products after amplification by non-denaturing PAGE electrophoresis (gel concentration: 12%; voltage: 150 V; time: 2.5 h). Homozygous gene editing plants are self-crossed to obtain homozygous non-transgenic gene editing seeds. The base sequences are shown in ZmMIR319A-T2-F (SEQ ID NO. 10) and ZmMIR319A-T2-R SEQ ID NO. 11): SEQ ID NO. 10: 5'-AATCAAGCTCTACGCTGTT-3'; SEQ ID NO. 11: 5'-AAGCGTTTGAGCAAACAA-3'.

[0037] Reaction system: 15 μL MIX regular PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL first-round PCR product, 5.5 μL sterilized ddH2O, 7.5 μL 2X M5 HiPer PAGE Taq PCR mix (Polymerase Bio-technology Co., Ltd., item number: 10103ES); Reaction procedure: regular PCR: 58°C annealing, extension 30 s, 32 cycles.

[0038] After the PCR product was subjected to non-denaturing PAGE electrophoresis and silver nitrate staining, the bands were genotyped according to the band size. Homozygous gene-edited plants were subjected to the next step of heat tolerance determination test.

[0039] Example Two: Corn ZmMIR319A Overexpression vector construction and transgenic plant phenotype screening 1、ZmMIR319A Overexpression vector construction (1) Acquisition and amplification of target gene. The precursor sequence pri-miR319A of corn miR319A was obtained from the public database miRBase, and specific primers ZmMIR319A-OE-F (SEQ ID NO. 12) and ZmMIR319A-OE-R (SEQ ID NO. 13) were designed according to the precursor sequence of miR319A. High-fidelity DNA polymerase was used for PCR amplification to obtain the precursor fragment. ZmMIR319A The PCR system and conditions are as follows: template DNA (X249 genomic DNA) 1.2 μL; primer F / R: 1.2 μL each; sterilized ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The temperature program of PCR is as follows: ① 98°C for 2 min; ② 98°C for 10 s; ③ 58°C for 30 s; ④ 72°C for 30 s; ⑤ cycle 33 times from ②-④; ⑥ 72°C for 5 min; ⑦ 25°C for 10 min. The PCR product was recovered after agarose gel electrophoresis.

[0040] The base sequence of the primer required for vector construction is shown in SEQ ID NO. 12 and SEQ ID NO. 13.

[0041] ZmMIR319A-OE-F (SEQ ID NO. 12): TGTTACTTCTGCAGCCCGGGGGTTCA GTTTTCTCTGGAA ZmMIR319A-OE-R (SEQ ID NO. 13): CAAGCGTTTGAGCAAACAAAAG (2) Constructed into the backbone vector by enzyme digestion and ligation, selected plant expression vector pBI121-Ubi containing maize ubiquitin promoter (Ubiquitin promoter) to drive the high efficient expression of Z mMIR319A The vector was double digested by restriction enzymes XmaI and Smal, and the linearized vector fragment was recovered. Preparation for insertion of miR319A precursor. Add recombinant ligase to connect the vector and the target fragment. 5 μL of enzyme digestion and ligation system is as follows, pri-miR319A fragment: 2 μL, pBI121-Ubi vector (≥ 60 ng / μL): 2 μL, DNA recombinant ligase (product number: 7E682G2): 1 μL.

[0042] The ligation product was transformed into competent E. coli (DH5a), positive clones were selected on medium containing antibiotic kanamycin, and the correct insertion of Z mMIR319A precursor was confirmed by sequencing after extraction of the plasmid. The constructed maize pUbi -ZmMIR319A vector map is shown in Figure 3 .

[0043] 2. Agrobacterium-mediated genetic transformation of maize The transformation receptor was maize inbred line X249, which carried one copy of ZmMIR319A.

[0044] The above-constructed pUbiThe ZmMIR319A vector was transformed into Agrobacterium EHA105 by heat shock method, and PCR was used for identification. The bacterial solution was stored at -80°C with glycerol. Freshly peeled 1.5 mm or so of inbred line X249 embryo was used as the recipient material. The peeled corn embryo was placed in a 2 mL plastic centrifuge tube containing 1.8 mL of suspension, and the placement time was not more than 1 h. About 100 embryos were placed in each centrifuge tube; the suspension was sucked off, and the embryos were washed with new suspension for 2 times, and a small amount of suspension was reserved at the bottom of the tube to cover the embryos, then heat shock at 43°C for 2 min, followed by ice bath for 1 min, the residual washing solution was sucked off with a pipette, and 1.0 mL of Agrobacterium infection solution was added, shaken gently for 30 s, and then placed in the dark for 8 min. Next, the embryos and the infection solution in the centrifuge tube were poured onto the co-culture medium, shaken evenly, and then the excess infection solution was sucked off with a pipette. All the embryos were placed with the scutes facing up, and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to the recovery medium with sterile forceps, and cultured at 28°C for 14 days. During the process, the young shoots growing on the embryos were removed in time. After recovery culture, the embryos were placed on the screening medium containing 1.5 mg / L Bialaphos for 3 rounds of screening, each round for 2 weeks, and then transferred to the screening medium containing 2 mg / L Bialaphos for 2 rounds of screening, each round for 2 weeks. The resistant callus was transferred to the propagation medium and cultured in the dark at 28°C for 2 weeks. Then the well-propagated resistant callus was transferred to the induction medium and cultured in the dark at 28°C for 2 weeks. Then it was transferred to the differentiation medium and cultured under light at 25°C and 5000 lux for 2 weeks. After the culture, the differentiated shoots were separated into single seedlings and placed in the rooting medium, and continued to be cultured under light at 25°C and 5000 lux until rooting; the seedlings were transferred to small pots for growth, and after survival, they were transplanted to the greenhouse.

[0045] 3. T0 generation ZmMIR319A Detection of overexpression plant results To determine whether the T0 generation plants are positive seedlings, we screened positive seedlings by Basta resistance gene, and the specific method is as follows: Prepare 1 / 1000 concentration of Basta, and evenly apply it on the leaves of T0 generation plants to screen out positive events. After application, obvious phenotypic differences usually appear within 3-7 days. Plants successfully expressing bar / pat gene keep the applied leaves green and healthy, or only have slight and short-term chlorosis / burn (especially under high concentration or strong light), but can quickly recover.

[0046] T0-generation positive plants (heterozygous) were self-pollinated to obtain T1-generation seeds (due to segregation, T1-generation seeds included transgenic homozygous, heterozygous, and wild-type seeds). Twenty plants were then sown and planted, and each was self-pollinated to harvest T2-generation seeds. Fifty plants were sown from these 20 seeds and screened using the method described above for Basta resistance gene-positive seedlings. T2-generation seeds that tested positive for all 50 plants were considered homozygous transgenic seeds; otherwise, they were heterozygous transgenic seeds or wild-type seeds. The selected T2-generation homozygous transgenic seeds were sown and tested for heat tolerance.

[0047] To compare the differences in ZmMIR319A precursor transcript levels in different overexpressing plants, the present invention took the second leaf 14 days after sowing the wild-type and T2 generation transgenic homozygous seeds of the above-mentioned different lines. Total RNA was extracted from the wild-type and transgenic plants and cDNA reverse transcribed using a total RNA extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd., Catalog No. DP419) and a cDNA reverse transcription kit (Beijing Tiangen Biochemical Technology Co., Ltd., Catalog No. KR118) according to the manufacturer's instructions. The ZmMIR319A precursor transcript levels of the different plants were compared using a SYBRGreen fluorescence quantification kit (Beijing Tiangen Biochemical Technology Co., Ltd., Catalog No. FP205) using the maize ZmTubulin5 gene as an internal reference according to the kit's instructions. The base sequences of the primers for detecting the ZmMIR319A precursor transcript are shown in SEQ ID NOs. 14 and 15, and the base sequences of the primers for detecting the ZmTubulin5 gene are shown in SEQ ID NOs. 16 and 17: Pri-ZmMIR319A-F(SEQ ID NO.14): ACCATGGACAGGTCTGGTCT Pri-ZmMIR319A-R(SEQ ID NO.15): AGCGTTTGAGCAAACAAAAGGG ZmTubilin5-F(SEQ ID NO.1:6):GCCGTTGCCGAGGTGTTC ZmTubilin5-R(SEQ ID NO.17): GTCCTTCTCAAGAGCAGCCAAGT Quantitative test results such as Figure 4 As shown, select ZmMIR319A ZmMIR319A-OE#1, ZmMIR319A-OE#2, and ZmMIR319A-OE#3 with the highest expression levels were subjected to the next heat resistance experiment.

[0048] Example 3 Corn ZmMIR319APhenotypic observation and physiological comparison of knockout mutants and overexpression plants under high temperature treatment Planting of corn materials

[0049] Select the wild type X249 with full development and uniform grain size, ZmMIR319A Mutants ( ZmMIR319A ZmMIR319A-KO# ) seeds and overexpression ( 1、ZmMIR319A-KO#2、ZmMIR319A-KO#3 ZmMIR319A-OE#1、ZmMIR319A-OE#2、 ) seeds were sown in small pots of 20 cm*20 cm and allowed to germinate and grow normally for 14 days (the second leaf was fully expanded) in an artificial climate chamber (16 h light / 8 h dark, temperature 25℃, humidity 50%, light intensity 1000µE).

[0050] 2. Observation of plant heat tolerance phenotype Select wild type with consistent growth, ZmMIR319A-OE#3 Mutant and overexpressing plants were heat-stressed for 14 hours in a preheated 45°C climatic chamber (16 hours light / 8 hours dark, 45°C, 50% humidity, and a light intensity of 1000 µE). Afterwards, they were returned to a normal growth temperature climatic chamber (16 hours light / 8 hours dark, 25°C, 50% humidity, and a light intensity of 1000 µE) to allow growth to resume. Three days later, the entire plant was photographed for burns, and the first, second, and third intact leaves were also photographed for leaf burns. Phenotypic images were also taken of unheated control plants.

[0051] In order to investigate the changes in physiological indicators, wild type, ZmMIR319A Mutant and overexpressing plants were heat-stressed for 3 hours in a preheated 45°C climate chamber (16 hours light / 8 hours dark, 45°C, 50% humidity, and 1000 µE light intensity). The first leaf was then stained with NBT staining solution. The second leaf was then ground with liquid nitrogen and assayed for catalase, superoxide dismutase, and peroxidase activities using a multifunctional microplate reader. Corresponding materials not subjected to heat stress served as controls. Statistical analysis was performed using the Student's t-test to compare significant differences between the results and the wild-type control. Asterisks (*) above the bars indicate significant differences (P < 0.05) compared with the wild-type control.

[0052] Phenotypic investigation revealed that compared with the wild type, ZmMIR319A ZmMIR319A-KO#1、 The leaves of the two varieties showed significant differences in morphology and physiological characteristics, which were manifested in wilting, curling and water loss. ZmMIR319A-KO#2、ZmMIR319A-KO#3 The phenotype is opposite ( ZmMIR319A-OE#1、ZmMIR319A-OE#2、ZmMIR319A-OE#3 a, b; Figure 5a, b). Further comparison of NBT staining results after 3 hours of heat treatment at 45 °C showed that there was no significant difference in NBT staining results between the untreated WT and ZmMIR319A-KO#1, ZmMIR319A-KO#2, ZmMIR319A-KO#3, and ZmMIR319A-OE#1, ZmMIR319A-OE#2, ZmMIR319A-OE#3. The heat-treated group of Figure 6 ZmMIR319A- The blue area of NBT staining of the material was significantly larger than that of the wild type material, KO#1、ZmMIR319A-KO#2、ZmMIR319A-KO#3 The material was significantly smaller than the wild type, indicating that the ROS content in the material was significantly lower than that in the wild type after heat stress ZmMIR319A-OE#1、ZmMIR319A-OE#2、ZmMIR319A-OE#3 The ROS content in the mutant was the highest, and the ROS content in the overexpression plant was the lowest ZmMIR319A c; Figure 5 c). Comparison of ROS scavenging enzymes in the leaves of wild type, Figure 6 mutant and overexpression plants, including peroxidase, superoxide dismutase, and peroxidase activities, found that compared with the wild type, ZmMIR319A the activities of hydrogen peroxidase, superoxide dismutase, and peroxidase in the mutant were significantly decreased ZmMIR319A d), and Figure 5 the activities of hydrogen peroxidase, superoxide dismutase, and peroxidase in the overexpression plant were significantly increased ZmMIR319A d), indicating that under heat stress Figure 6 the mutant had weak ROS scavenging ability, while ZmMIR319A the overexpression plant had strong ROS scavenging ability.

[0053] Therefore, by overexpressing ZmMIR319A the material obtained has strong tolerance to high temperature stress, and exhibits significant advantages in corn planting under high temperature environment. This finding has both great production application value and theoretical innovation significance. In production, it provides key genetic resources for breeding new varieties of heat-resistant corn, which is expected to be directly applied to molecular breeding to cultivate crops that can resist extreme high temperature weather, thereby ensuring food safety production and yield stability under the background of global climate change, and even expanding the suitable planting area of corn. In theory, this study breaks through the traditional understanding of the function of miR319 family, and for the first time reveals its core role in plant heat stress response, discovering a new miRNA-mediated heat stress regulation pathway. This greatly deepens our understanding of the complexity of plant stress resistance molecular network, and provides a new strategy for systematic improvement of complex traits of crops by manipulating "master switch" type regulatory factors, indicating a new direction for future stress resistance breeding.

[0054] References: Huang SL, Zhou JJ, Gao L, Tang YL. Plant miR397 and its functions.Funct Plant Biol. 2021,48:361-370. Kruszka K, Pacak A, Swidabarteczka A, Nuc P, Alaba S, Wroblewska Z,Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z. Transcriptionally andpost-transcriptionally regulated microRNAs in heat stress response in barley,J Exp Bot. 2014, 65(20): 6123-6135. Park W, Li JJ, Song RT, Messing J, Chen XM. CARPEL FACTORY, a dicerhomolog, and HEN1, a novel protein, act in microRNA metabolism in ZmMIR319A Arabidopsis . Curr Biol. 2002, 12, 1484-1495. Paque S, Weijers D. Auxin: the plant molecule that influences almostanything. BMC Biol. 2016,14(1):67. Shen C, Huang YY, He CT, Zhou Q, Chen JX, Tan X, Mubeen S, Yuan JG,Yang ZY. Comparative analysis of cadmium responsive microRNAs in roots of twoIpomoea aquatica Forsk cultivars with different cadmium accumulationcapacities, Plant Physiol. Bioch. 2017, 111: 329-339. Shen XX, He JQ, Ping YK, Guo JX, Hou N, Cao FG, Li XW, Geng DL, Wang SC, Chen PX. The positive feedback regulatory loop of miR160-Auxin Response Factor 17-HYPONASTIC LEAVES 1 mediates drought tolerance in apple trees. Plant Physiol. 2021, 188(3):1686-1708. Shi X, Jiang F, Wen J, Wu Z. Overexpression of Solanum habrochaites microRNA319d (sha-miR319d) confers chilling and heat stress tolerance in tomato (S. lycopersicum). BMC Plant Biol. 2019, 19(1):214. Vaucheret H, Vazquez F, Crété P, Bartel DP. The action of ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant development. Genes Dev. 2004, 18(10): 1187-1197. Wan J, Meng S, Wang Q, Zhao J, Qiu X, Wang L, Li J, Lin Y, Mu L, Dang K, Xie Q, Tang J, Ding D, Zhang Z. Suppression of microRNA168 enhances salt tolerance in rice (Oryza sativa L.). BMC Plant Biol. 2022, 22(1):563. Yang CH, Li DY, Mao DH, Liu X, Ji CJ, Li XB, Zhao XF, Cheng ZK, ChenCY, Zhu LH. Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice ( thaliana Oryza sativa L.). Plant CellEnviron. 2013, 36(12): 2207-2218. Yang Z, Ebright YW, Yu B, Chen Zhang Y, Xiao T, Yi F, Yu J. SimiR396d targets SiGRF1 to regulatedrought tolerance and root growth in foxtail millet. Plant Sci. 2023, 326:111492. Dai Qian, Song Jianghua. Research progress on plant miRNAs involved in abiotic stress responses. Molecular Plant Breeding, 2022: https: / / kns.cnki.net / kcms / detail / 46.1068.S.20221014.1940.022.html. Hu Junpeng, Wang Wenjiang, Li Tingting. Effects of high temperature stress on crop growth and research progress on high temperature tolerance technology. Journal of Northwest Agriculture, 2025: 34(6):973-979. Qin Cheng, Zhang Zhiming, Liu Hongjun, Gao Jian, Rong Tingzhao, Pan Guangtang. Research progress on miRNAs regulating plant floral development. Journal of Agricultural Biotechnology, 2011: 19(5): 938-952. Song Zihe, Zhen Yan. Research progress on miRNAs related to plant drought and salt stress responses. Journal of Nanjing Forestry University (Natural Science Edition), 2024: 48(4): 1-11. Yan HY, Li CX, Li YB. Effects of high temperature on maize growth and progress in screening of high-temperature-tolerant maize in China. Acta Botanica Sinica, 2024: 59 (6): 1007-1023. Zhou WJ, Zhang WH, Jia W, Xu ZC, Huang WX. Advances in the research of plant miRNAs in response to abiotic stress. Acta Botanica Sinica, 2024: 59 (5): 810-833.

Claims

1. ZmMIR319A Application of genes in regulating heat tolerance of corn; characterized in that, described ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mature miRNA319 sequence encoded by it is shown in SEQ ID NO.2; ZmMIR319A Also included are nucleotide sequences in which one or more nucleotides are substituted but which encode the same mature sequence as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that Knockout in corn ZmMIR319A Leading to increased sensitivity of corn to high temperature environment, overexpression ZmMIR319A This results in a decrease in the plant's sensitivity to high temperature stress.

3. A method for creating a high temperature resistant corn mutant, characterized in that: Improve the corn of claim 1 by genetic modification or hybridization, backcrossing, self-pollination or asexual reproduction. ZmMIR319A Gene expression was used to obtain high temperature resistant corn materials.

4. A method for creating a high-temperature sensitive mutant of corn, characterized in that: CRISPR / Cas9 gene editing technology or RNA interference technology ZmMIR319A Knockout or knockdown of genes to reduce corn ZmMIR319A Gene expression was used to obtain high-temperature sensitive corn materials.

5. The method according to claim 4, characterized in that: The CRISPR / Cas9 vector target designed for the maize ZmMIR319A gene using the CRISPR / Cas9 gene editing technology is MT1, and its DNA sequence is shown in SEQ ID NO.

3.

6. The method according to claim 5 ZmMIR319A Mutant gene ZmMIR319A-KO#1、ZmMIR319A- KO#2 and ZmMIR319A-KO#3 ; It is characterized in that, Compared with the mature miRNA319 sequence of claim 1, ZmMIR319A-KO#1 The encoded mature sequence lacks 9bp bases at positions 1-9; the mature sequence encoded by ZmMIR319A-KO#2 lacks 3bp bases at positions 6-8; the mature sequence encoded by ZmMIR319A-KO#3 lacks the "C" base at position 6.

Images