Fluorescence in-situ hybridization probe group for rapidly distinguishing hexaploid oat chromosomes and application of fluorescence in-situ hybridization probe group

The use of fluorescent in situ hybridization probes to rapidly and accurately distinguish oat hexaploid chromosomes solves the problems of complexity and inaccuracy of traditional methods, thus enhancing the scientific research and practical value.

CN120796548APending Publication Date: 2025-10-17SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510995607.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-18
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately distinguish hexaploid chromosomes in oats, and traditional chromosome analysis methods are complex and imprecise.

Method used

A fluorescent in situ hybridization probe set, including probes oligo-356 and oligo-898, modified with FAM and TAMRA fluorescent groups respectively, was used for fluorescent in situ hybridization of oat chromosomes. By binding to the chromosomes through specific nucleotide sequences, different fluorescent signals were displayed.

Benefits of technology

It enables rapid and accurate differentiation of chromosomes in hexaploid oats, supporting the identification of chromosome structural variations, kinship identification, genetic mapping, and variety improvement, thereby enhancing its scientific research and practical value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796548A_ABST
    Figure CN120796548A_ABST
Patent Text Reader

Abstract

The invention discloses a fluorescence in-situ hybridization probe group for rapidly distinguishing hexaploid oat chromosomes and application thereof, and belongs to the technical field of molecular biology. The fluorescent in-situ hybridization probe group provided by the invention comprises a probe oligo-356 and a probe oligo-898, wherein the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 1; the nucleotide sequence of the probe oligo-356 is as shown in SEQ ID NO. 2; the provided fluorescence in-situ hybridization probe group can quickly and accurately identify different chromosomes of hexaploid oat through a fluorescence in-situ hybridization method, and has important scientific and practical values for hexaploid oat chromosome structure variation identification, oat genetic relationship identification, oat genetic map construction and oat variety improvement.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes and application thereof. BACKGROUND

[0002] Oat (Avena sativa L.) is an annual herbaceous plant of the family Poaceae. Among more than 4000 oat species in the world, the fat content of more than 90% of the oat is 5-9%, which is 4-5 times of rice and wheat flour, and is the highest among all cereals. 80% of the fat is unsaturated fatty acid, mainly monounsaturated fatty acid, linoleic acid and linolenic acid, among which the content of linoleic acid accounts for 38.1-52% of the fat content. The protein content of oat is also very high, which is 1.6-2.3 times of rice and wheat flour, and is the highest among all cereals. Oat contains 18 kinds of amino acids, 8 of which are essential amino acids for human body. The content of the 8 essential amino acids is not only high but also reasonable, which is close to the nutrition model recommended by FAO / WHO, and the utilization rate of human body is high. In addition, oat also contains rich vitamins (including vitamin B1, B2, E, niacin and folic acid) and minerals, and the content of selenium is also very high, which is 3.72 times of wheat, 7.9 times of corn and 34.8 times of rice. Therefore, oat has obvious effects of reducing low-density cholesterol and blood lipids, and also has certain effects of increasing serum high-density cholesterol, and has wide application in the pharmaceutical industry. Oat contains glucan which has good moisturizing effect and is often used as a component of cosmetics. Oat is also a fiber-rich food base, and the types of processable foods are various.

[0003] In the genus Avena, there are about 30 species in the world, including AA and CC diploid, AABB and CCDD tetraploid and AACCDD hexaploid. Due to the large and complex genome of oat, it is difficult to accurately distinguish each chromosome by traditional chromosome analysis method. Fluorescent in situ hybridization (FISH) is a technology of adding fluorescent modification to known sequences, and then combining with species chromosomes through base complementary pairing principle to show different fluorescent signals, which is often used to identify chromosome pairing behavior, chromosome structure variation and interspecific relationship.

[0004] Therefore, it has important scientific and practical value to develop a FISH probe set which can rapidly and accurately distinguish the chromosomes of common cultivated oat. SUMMARY

[0005] The application aims to provide a fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes and application thereof, so as to provide a set of probes that can be used for fluorescent in situ hybridization and can quickly and accurately distinguish different chromosomes of hexaploid oats.

[0006] To achieve the above-mentioned purpose, the application provides a fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes, wherein the fluorescent in situ hybridization probe set is a probe oligo-356 and a probe oligo-898; the nucleotide sequence of the probe oligo-356 is shown in SEQ ID NO. 1; and the nucleotide sequence of the probe oligo-898 is shown in SEQ ID NO. 2.

[0007] Preferably, the fluorescent in situ hybridization probe set is modified with a fluorescent group; the probe oligo-356 is modified with a FAM group; and the probe oligo-898 is modified with a TAMRA.

[0008] The application of the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes in oat chromosome distinction.

[0009] The application of the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes in oat genetic map construction.

[0010] The application of the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes in chromosome structure variation identification.

[0011] The application of the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes in oat species relationship identification.

[0012] The application of the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes in oat variety improvement.

[0013] A method for quickly distinguishing hexaploid oat chromosomes, which applies the fluorescent in situ hybridization probe set for quickly distinguishing hexaploid oat chromosomes, and comprises the following steps:

[0014] S1, taking an oat root tip in acetic acid for fixation, then cleaning with distilled water, absorbing water with a sterile filter paper, placing on a glass slide, adding enzyme solution, and constant temperature water bath;

[0015] S2, after water bath, performing ultraviolet crosslinking, then adding probe hybridization solution dropwise, covering with a cover glass, then denaturing, incubating in turn, then cleaning, drying, adding 4', 6-diamidino-2-phenylindole dropwise, and observing under a fluorescence microscope.

[0016] Preferably, in S1, the root tip is exposed to N2O gas for 2h before being fixed in acetic acid; the fixing time in acetic acid is >=5min; the enzymatic solution is a sodium citrate solution of cellulase and pectinase; and the water bath condition is a constant temperature water bath at 37℃.

[0017] Preferably, in S2, the probe hybridization solution is a solution of TE and 2xSSC of the probes oligo-356 and oligo-898, the volume ratio of TE and 2xSSC being 1:1; the denaturation is denaturation at 75℃; the incubation is at 37℃; and the washing is with distilled water.

[0018] Therefore, the present application provides a fluorescent in situ hybridization probe set for rapidly distinguishing the chromosomes of hexaploid oats and an application thereof, and the specific technical effects are as follows:

[0019] (1) The fluorescent in situ hybridization probe set provided by the present application comprises the probes oligo-356 and oligo-898, the nucleotide sequence of the probe oligo-356 is shown in SEQ ID NO. 1; and the nucleotide sequence of the probe oligo-898 is shown in SEQ ID NO. 2.

[0020] (2) The fluorescent in situ hybridization probe set provided by the present application can rapidly and accurately identify different chromosomes of hexaploid oats through the fluorescent in situ hybridization method, and has important scientific and practical values for the identification of structural variations of hexaploid oat chromosomes, the identification of the genetic relationship of oats, the construction of an oat genetic map and the improvement of oat varieties.

[0021] The technical solutions of the present application will be further described in detail below with the aid of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the description of the embodiments of the present application will be briefly introduced below, and obviously, the drawings in the following description can be used to obtain other drawings without creative labor by those skilled in the art.

[0023] Figure 1 is a FISH labeling diagram of the repeat sequence probe oligo-356 in sativa ssp. nuda in Example 2 of the present application;

[0024] Figure 2 is a FISH labeling diagram of the repeat sequence probe oligo-898 in sativa ssp. nuda in Example 2 of the present application;

[0025] Figure 3is the FISH mapping chart of repeat sequence probes oligo-356 and oligo-898 in sativa ssp. nuda in Example 2 of the present application;

[0026] Figure 4 is the statistical result of chromosome identification of fluorescent in situ hybridization probes oligo-356 and oligo-898 in 21 hexaploid oat A genomes in Example 2 of the present application;

[0027] Figure 5 is the statistical result of chromosome identification of fluorescent in situ hybridization probes oligo-356 and oligo-898 in 21 hexaploid oat C genomes in Example 2 of the present application;

[0028] Figure 6 is the statistical result of chromosome identification of fluorescent in situ hybridization probes oligo-356 and oligo-898 in 21 hexaploid oat D genomes in Example 2 of the present application. DETAILED DESCRIPTION

[0029] The technical solutions of the present application are further described below through the accompanying drawings and examples.

[0030] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are clearly and completely described below through the accompanying drawings and examples. The following detailed description is the description of examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0031] The instrument equipment and reagent materials used in the examples are obtained through commercial channels; the method steps not specifically described in the examples are conventional technical means in the art.

[0032] The reagent composition information used in the examples is as follows:

[0033] The enzyme solution is composed of buffer and enzyme, the buffer is a solution composed of 50 mL double distilled water, 0.5707 g trisodium citrate (dihydrate) and 0.4324 g citric acid; the enzyme is added in an amount of 0.04 g cellulase (cellwlase, No. Y-012) and 0.02 g pectase (poly galactwromuse, 200115-02) per 1 mL buffer;

[0034] Buffer: 1x TE Buffer (10 mM Tris-HCL, 1 mM EDTA, pH=8.0) and 2x SSC (1000 mL double distilled water, Trisodium Citrate (dihydrate) 8.823 g, NaCl 17.532 g) mixed in a volume ratio of 1:1.

[0035] Example 1

[0036] The designed fluorescent in situ hybridization probe set for distinguishing the six-ploid carrier oat chromosomes included two repeat sequence probes, oligo-356 and oligo-898. The nucleotide sequence of oligo-356 was shown in SEQ ID NO. 1, which was 59 bp long and added with a FAM fluorescent label at the 5' end. The nucleotide sequence of oligo-898 was shown in SEQ ID NO. 2, which was also 59 bp long and added with a TAMRA fluorescent label at the 5' end of the complementary sequence.

[0037] SEQ ID NO. 1:

[0038] GATCGTCTACCCCCCTAGACGTTCCTCTGACAGGGGTAGCCCGGCGTAGC

[0039] TCTCTCTTG

[0040] SEQ ID NO. 2:

[0041] GCAATACTCATGAAAATGGCCATAAAACGCAAAAACGACGAGTTTTTGGTC

[0042] ATAACTCT

[0043] The sequence information of the probes oligo-356 and oligo-898 was sent to a company for synthesis of the corresponding oligonucleotide probe sequence. Each tube of primer was added with 36.1 μL of buffer to prepare a 100 μM storage solution and stored in a 4°C refrigerator.

[0044] Example 2

[0045] The working solution of the fluorescent in situ hybridization probes oligo-356 and oligo-898 prepared in Example 1 was used to distinguish the chromosomes of 21 six-ploid oat materials from different countries and regions of the world. The species name, seed bank number and source of the 21 six-ploid oat materials from different countries and regions of the world were shown in Table 1.

[0046] Table 1 Information of 21 six-ploid oat materials

[0047]

[0048]

[0049] The specific operation steps of chromosome differentiation are as follows:

[0050] (1) Root tip mitotic metaphase chromosome preparation.

[0051] ① Respectively take 21 parts of the seeds of the cultivated oats and soak them at 4°C for 24h, and then germinate under the photoperiod (light / dark / temperature 22h / 2h / 16°C) for 16h. Take the root tips with a length of 1-2cm, expose them to 1.0MPa N2O gas for 2h, fix them in glacial acetic acid for 5min, and finally store them in 70% ethanol (v / v).

[0052] ② Preparation of slides. When preparing the slides, place the prepared enzyme solution on ice, take out the root tips stored in 70% ethanol in ①, wash them twice with distilled water, absorb the water with sterile filter paper, place the root tips on the slides to cut the apical meristem (2mm white part), load them into centrifuge tubes containing 10μL of enzyme solution, mark the material name on the centrifuge tube, and finally place the centrifuge tube on a foam plate in a 37°C water bath for constant temperature water bath for 60min; after the time, centrifuge once (6000r, 2min, 26°C); use a 10μL pipette to suck out the enzyme solution (without damaging the root tips), and then use a 100μL pipette to add 20μL of distilled water to wash the root tips; after sucking out the distilled water, add 20μL of 75% alcohol for cleaning; after sucking out the 75% alcohol, add 75% alcohol again, and use a dissecting needle to crush the root tips; centrifuge once in a centrifuge, discard the supernatant, and add 36μL of glacial acetic acid to the slides; write 4 repeated slides for each material, and mark the material name and date on the slides; add 8.5μL of the root tip and enzyme mixture to each slide; after drying, collect the slides.

[0053] (2) Fluorescence in situ hybridization (this step is strictly protected from light, 10μL system per slide), the specific steps are as follows:

[0054] ① Take out the prepared new slides in step (1) and place them in the ultraviolet crosslinking instrument for ultraviolet crosslinking.

[0055] ② Adjust the denaturing oven to 75°C for preheating.

[0056] ③ Prepare the probe hybridization solution: 8μL of buffer and 2μL of probe group (1μL of oligo-356 working solution and 1μL of oligo-898 working solution), and then centrifuge.

[0057] ④ Add 10μL of probe hybridization solution to each ultraviolet crosslinked slide, then cover the coverslips (ensure that there is no air bubble between the slide and the coverslip), and place the covered slides in the preheated denaturing oven for denaturation for 5min.

[0058] 5. Put the slides into incubation box, incubate at 37℃ for 3h or more, then wash off the coverslips with 2xSSC, and then wash once with distilled water. Dry the slides in the dark.

[0059] 6. Observe the results under fluorescence microscope after dropping 20μL of 4', 6-diamidino-2-phenylindole (DAPI) on the slides, and then cover with clean coverslips.

[0060] 7. Recover the slides: wash the slides with 2xSSC for 5min, 75% alcohol for 5min, and 100% alcohol for 5min, and then expose to light for 24h.

[0061] The FISH labeling pattern of repeat sequence probe oligo-356 in A. sativa ssp. nuda is shown in Fig. 1; the FISH labeling pattern of repeat sequence probe oligo-898 is shown in Fig. 2; and the FISH labeling pattern of repeat sequence probes oligo-356 and oligo-898 is shown in Fig. 3. Figure 1 The FISH labeling pattern of repeat sequence probe oligo-356 in A. sativa ssp. nuda is shown in Fig. 1; the FISH labeling pattern of repeat sequence probe oligo-898 is shown in Fig. 2; and the FISH labeling pattern of repeat sequence probes oligo-356 and oligo-898 is shown in Fig. 3. Figure 2 The FISH labeling pattern of repeat sequence probe oligo-356 in A. sativa ssp. nuda is shown in Fig. 1; the FISH labeling pattern of repeat sequence probe oligo-898 is shown in Fig. 2; and the FISH labeling pattern of repeat sequence probes oligo-356 and oligo-898 is shown in Fig. 3. Figure 3

[0062] The signal pattern of 21 hexaploid oat samples is shown in Table 2 and Fig. 4. Figures 4-6 The signal pattern of 21 hexaploid oat samples is shown in Table 2 and Fig. 4.

[0063] Table 2 Signal pattern of cultivated oat

[0064]

[0065]

[0066] Therefore, the fluorescent in situ hybridization probe set provided by the present application comprises probe oligo-356 and probe oligo-898, the nucleotide sequence of probe oligo-356 is shown in SEQ ID NO. 1; the nucleotide sequence of probe oligo-356 is shown in SEQ ID NO. 2; the fluorescent in situ hybridization probe set provided by the present application can quickly and accurately identify different chromosomes of hexaploid oat through fluorescent in situ hybridization method, and has important scientific and practical value for identification of hexaploid oat chromosome structure variation, identification of Avena genetic relationship, construction of oat genetic map, and improvement of oat varieties.

[0067] ​It should be pointed out finally that the above examples are only used to illustrate the technical solutions of the present application but not to limit it, and although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can still be modified or replaced equivalently, and these modifications or equivalent replacements should not make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A fluorescent in situ hybridization probe set for rapid differentiation of hexaploid oat chromosomes, characterized by: The fluorescent in situ hybridization probe set includes probe oligo-356 and probe oligo-898; the nucleotide sequence of probe oligo-356 is shown in SEQ ID NO.1; the nucleotide sequence of probe oligo-356 is shown in SEQ ID NO.

2.

2. The fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes according to claim 1, characterized in that: The fluorescence in situ hybridization probe set is modified with a fluorescent group; the probe oligo-356 is modified with a FAM group; and the probe oligo-898 is modified with a TAMRA group.

3. Use of the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes as claimed in claim 1 or 2 in distinguishing oat chromosomes.

4. Use of the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes as claimed in claim 1 or 2 in constructing an oat genetic map.

5. Use of the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes as claimed in claim 1 or 2 in identifying chromosome structural variation.

6. Use of the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes as claimed in claim 1 or 2 in identifying the phylogenetic relationship of Avena species.

7. Use of the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes as claimed in claim 1 or 2 in oat variety improvement.

8. A method for rapidly distinguishing hexaploid oat chromosomes, characterized in that: The method of using the fluorescent in situ hybridization probe set for rapidly distinguishing hexaploid oat chromosomes according to claim 1 or 2 comprises the following steps: S1. Fix the oat root tip in acetic acid, then wash with distilled water, dry with sterile filter paper, place on a glass slide, add enzymatic solution, and place in a constant temperature water bath; S2. After the water bath, perform UV crosslinking, then add probe hybridization solution, cover with a coverslip and denature and incubate in sequence, then wash and dry, add 4',6-diamidino-2-phenylindole and observe under a fluorescence microscope.

9. The method for rapidly distinguishing hexaploid oat chromosomes according to claim 8, characterized in that: The root tips of S1 were exposed to N2O gas for 2 h before fixation in acetic acid; the fixation time in acetic acid was ≥5 min; the enzymatic hydrolysate was a sodium citrate solution of cellulase and pectinase; and the water bath condition was a constant temperature water bath at 37°C.

10. The method for rapidly distinguishing hexaploid oat chromosomes according to claim 8, characterized in that: The probe hybridization solution in S2 is a solution of probe oligo-356 and oligo-898 in TE and 2×SSC, with the volume of TE and 2×SSC being 1:1; denaturation is performed at 75°C; incubation is performed at 37°C; and washing is performed with distilled water.