Microinjection method for grouper

By using a newly developed glass capillary microinjection needle and injection mold, combined with the injection method of Cas9 protein and target gene sgRNA, the problems of difficult fixation of grouper fertilized eggs and low gene editing efficiency have been solved, achieving efficient editing of grouper genes and promoting the development of grouper breeding.

CN120818418APending Publication Date: 2025-10-21YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI +2

Patent Information

Application Number
CN202510965870.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-14
Publication Date
2025-10-21

AI Technical Summary

Technical Problem

The fertilized eggs of grouper are large in diameter, with hard and elastic eggshells, making them difficult to fix. Existing technologies make it difficult to achieve efficient gene editing, which affects the efficiency of grouper farming.

Method used

A glass capillary microinjection needle was prepared by calcination using a needle puller. Combined with an injection mold and specific parameters, gene editing was performed on grouper fertilized eggs. The injection was carried out using a mixed solution of Cas9 protein and target gene sgRNA.

Benefits of technology

This study achieved exogenous gene transfer and precise editing of endogenous genes in grouper, improving the success rate and efficiency of gene editing and providing strong support for in-depth research on gene function and the cultivation of superior aquaculture varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818418A_ABST
    Figure CN120818418A_ABST
Patent Text Reader

Abstract

The invention provides a grouper microinjection method, and belongs to the technical field of aquaculture. According to the method, grouper eggs are injected by utilizing a grouper microinjection needle, the microinjection needle is prepared by calcining a glass capillary tube by utilizing a needle pulling instrument, and the parameters of the needle pulling instrument are set as P = 500mW, HET = 720ms, PULL = 60, VEL = 20mu m / s and TIME = 250ms; the outer diameter of the glass capillary tube is 1.0 mm, the inner diameter of the glass capillary tube is 0.75 mm, and the length of the glass capillary tube is 10 cm. The method for injecting the grouper eggs with the micro-injection needle is simple and easy to operate, exogenous gene transfer and endogenous gene accurate editing of the grouper can be realized by adopting the method disclosed by the invention, the target gene editing efficiency is high, and powerful support is provided for deeply researching gene functions of the grouper and cultivating excellent culture varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of aquaculture, and in particular relates to a grouper microinjection method. Background Art

[0002] Grouper is a general term for fish belonging to the genus Epinephelus, order Perciformes, suborder Perciformes, and family Serranidae. They are high in protein, rich in nutritional value, and possess high economic value. In recent years, grouper aquaculture has rapidly developed, with farmed species including brown-spotted grouper, leopard gill perch, clearwater grouper, yellowfin grouper, and red nine-spined perch. As an important marine aquaculture species, groupers exhibit sex reversal. Upon hatching, the gonads of groupers first develop into mature ovaries. Under appropriate endogenous factors and environmental conditions, the ovaries gradually degenerate, the testes mature, and sex reversal occurs, resulting in male sex reversal. Due to the long maturation period for males, the number of male broodstock capable of consistently producing gametes is scarce, significantly hindering production efficiency. Therefore, research on the genes and molecular mechanisms of sex determination in grouper is crucial to uncovering the mechanisms of sex reversal, developing rapidly maturing male groupers, and promoting sex-controlled breeding in grouper. However, due to the lack of effective gene editing technology, current research on grouper is still mainly concentrated in the fields of breeding and gene expression, while there is still a gap in research on grouper gene function, molecular design breeding and other directions. This has put forward the demand for the development of grouper fertilized egg microinjection technology.

[0003] Gene editing breeding involves modifying specific targets in an organism's genome through gene editing technology, efficiently and precisely altering the DNA sequence of a target gene, thereby changing its genetic information and epigenetic characteristics, and producing new varieties with desired genetic traits. Compared to traditional breeding methods, gene editing breeding offers greater precision and a shorter timeframe. Recent achievements in fish gene editing breeding have been significant, with breakthroughs in freshwater species such as the amblycephalic bream, crucian carp, and grass carp. However, a comprehensive gene editing system for marine fish remains undeveloped, with only microinjection gene editing established for the semi-smooth tongue sole. Therefore, establishing a comprehensive gene editing system for grouper is both urgent and crucial.

[0004] Compared with freshwater fish fertilized eggs, grouper fertilized eggs are about 7 to 8 mm in diameter, with hard and elastic egg shells and floating eggs, making them difficult to fix. It is even more difficult for the microinjection needle to pierce the egg membrane without causing serious mechanical damage to the fertilized eggs, which greatly increases the difficulty of microinjection of grouper fertilized eggs.

[0005] Therefore, providing a method for microinjection of grouper to achieve exogenous gene transfer and precise editing of endogenous genes in grouper can provide support for in-depth research on its gene function and the cultivation of excellent aquaculture varieties. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a grouper microinjection needle. The method of injecting grouper eggs using the microinjection needle is simple to operate, and the genes of grouper can be edited by microinjection, with high target gene editing efficiency.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] A grouper microinjection needle is provided. The microinjection needle is prepared by calcining a glass capillary using a needle puller. Parameters of the needle puller are set as P=500mW, HET=720ms, PULL=60, VEL=20μm / s, and TIME=250ms. The glass capillary has an outer diameter of 1.0mm, an inner diameter of 0.75mm, and a length of 10cm.

[0009] Another object of the present invention is to provide a grouper microinjection method, comprising the following steps: after the grouper eggs are fertilized, the fertilized eggs are placed in an injection mold, and the fertilized eggs are injected into the animal pole using the microinjection needle; the grouper egg fertilization is artificial insemination, and the artificial insemination steps include: mixing male grouper semen, unfertilized grouper eggs and seawater in a ratio of (0.5-1) mL: (2-5) g: 1500 mL, and standing for 5-10 minutes; the seawater is sterilized seawater, and the temperature of the seawater is 20-22°C.

[0010] Preferably, microinjection is performed on grouper fertilized eggs at the 1-cell to 8-cell stages.

[0011] The preferred method for preparing the injection mold includes: preparing an agarose solution, inverting the template of the injection mold on the surface of the solution before the solution solidifies, and removing the template after the solution solidifies to obtain the injection mold; the template includes a base plate and a plurality of ridges, and the ridges are fixed to the base plate in parallel and at equal intervals; the ridges have a width of 0.72 mm and a height of 0.8 mm.

[0012] Preferably, the grouper includes brown-spotted grouper, leopard gill perch, clearwater grouper, yellowfin grouper and red nine-spined grouper.

[0013] Another object of the present invention is to provide the use of the grouper microinjection needle or the method in grouper gene editing.

[0014] Preferably, the gene editing step includes: mixing the Cas9 protein with the target gene sgRNA, and injecting it into the animal pole of the grouper fertilized egg by microinjection.

[0015] Preferably, the target genes include Foxl2 gene and Cyp19a1 gene.

[0016] Preferably, the nucleotide sequence of the sgRNA of the Foxl2 gene is shown as mG*mG*mU*-SEQ ID NO.3-*mU*mU*mU; the nucleotide sequence of the sgRNA of the Cyp19a1 gene is shown as mG*mG*mU*-SEQ ID NO.4-*mU*mU*mU.

[0017] Preferably, the Cas9 protein and the target gene sgRNA are mixed at equal concentrations.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides a grouper microinjection needle. The method of injecting grouper eggs using the microinjection needle is simple and easy to operate. The method of the present invention can realize the exogenous gene transfer and endogenous gene precise editing of grouper, and the target gene editing efficiency is high, providing strong support for in-depth research on its gene function and the cultivation of excellent aquaculture varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a template of an injection mold; wherein: 1. bottom plate; 2. ridge; 3. through hole;

[0021] Figure 2 For injection molds;

[0022] Figure 3 This is the application of the grouper microinjection method in gene editing in Example 1; wherein A is a brown-spotted grouper fry four days after hatching; B is the sequence peak diagram of the wild type Foxl2; C is the sequence peak diagram of the wild type Cyp19a1 gene; D is the sequence peak diagram of the mutant Foxl2; E is the sequence peak diagram of the mutant Cyp19a1 gene; F is the mutation type analysis of the Foxl2 gene; G is the mutation type analysis of the Cyp19a1 gene. DETAILED DESCRIPTION

[0023] The invention provides a grouper microinjection needle. The microinjection needle is prepared by calcining a glass capillary using a needle pulling instrument. Parameters of the needle pulling instrument are set as follows: P (power) = 500 mW, HET (heating exposure time) = 720 ms, PULL (pull force) = 60, VEL (tensile velocity) = 20 μm / s, and TIME (maintenance time after tension is applied) = 250 ms. The glass capillary has an outer diameter of 1.0 mm, an inner diameter of 0.75 mm, and a length of 10 cm.

[0024] In the present invention, the preferred glass capillary is model B100-75-10, made of borosilicate, with an outer diameter of 1.0 mm, an inner diameter of 0.75 mm, and a length of 10 cm. The glass capillary is preferably calcined using a needle puller. In a specific embodiment of the present invention, the needle puller used is a SUTTER P-97 programmable horizontal microelectrode puller. The fiber injection needles obtained by calcining the needle puller under set parameters are shorter and thicker, making it easier to penetrate grouper fertilized eggs, improving the injection success rate and reducing the problem of fertilized eggs sticking to the needle tip.

[0025] The present invention also provides a grouper microinjection method, comprising the following steps: after the grouper eggs are fertilized, the fertilized eggs are placed in an injection mold, and a microinjection needle is used to inject into the animal pole of the fertilized eggs; the microinjection needle is prepared by calcining a glass capillary using a needle puller, and the parameters of the needle puller are set as P (power) = 500mW, HET (heating exposure time) = 720ms, PULL (pull) = 60, VEL (tension speed) = 20μm / s, and TIME (maintenance time after the tension is applied) = 250ms.

[0026] In the present invention, the grouper preferably includes brown-spotted grouper, leopard gill perch, clearwater grouper, yellowfin grouper and red nine-spined perch; the grouper fertilized eggs are preferably obtained by artificial insemination, and the artificial insemination step preferably includes: mixing male grouper semen, unfertilized grouper eggs and seawater preferably in a ratio of (0.5-1) mL: (2-5) g: 1500 mL, more preferably in a ratio of (0.6-0.8) mL: (3-4) g: 1500 mL; after mixing, preferably standing for 5-10 minutes; the seawater is sterilized seawater, and the temperature of the seawater is preferably 20-22° C., more preferably 21° C.; and microinjection is preferably performed at the 1-cell stage to the 8-cell stage of the grouper fertilized eggs. The present invention performs artificial insemination in sterilized seawater at 20-22°C, which can prolong the developmental cell stage of grouper fertilized eggs without affecting the hatching rate, and is conducive to achieving microinjection at the 1-cell stage to the 8-cell stage of grouper fertilized eggs, thereby effectively improving the success rate of gene editing.

[0027] In the present invention, the method for preparing the injection mold preferably comprises: preparing an agarose solution, preferably mixing 0.75 g of agarose powder with 50 mL of water and then heating until completely dissolved; before the agarose solution solidifies, placing the template of the injection mold on the surface of the solution, preferably avoiding the generation of bubbles between the template and the solution to prevent interference with microinjection; after the solution solidifies, removing the template to obtain the injection mold. The template of the present invention is as follows Figure 1As shown, it includes a base plate 1 and several ridges 2, which are fixed to the base plate 1 in parallel and at equal intervals. The base plate 1 is preferably circular, preferably with a diameter of 5 cm and a thickness of 2 mm. Two through holes with a diameter of 1.5 mm are preferably symmetrically opened at both ends of the base plate 1, 1 mm from the edge of the base plate 1. The length direction of the ridges 2 is preferably parallel to the connecting line of the two through holes. The ridges 2 are preferably of equal length, width, and height. The ridges 2 are preferably 3.2 cm long, 0.72 mm wide, and 0.8 mm high. The ridges 2 are located in the center of the base plate 1, with the direction in which the ridges 2 are parallel to each other as its width direction. In the width direction of the ridges 2, the spacing between two adjacent ridges 2 is preferably 4.28 mm. The template of the present invention is preferably made of high-temperature resistant material by 3D printing.

[0028] The present invention also provides an application of the method in grouper gene editing; the gene editing step preferably includes: mixing the Cas9 protein with the target gene sgRNA, and then injecting it into the animal pole of the grouper fertilized egg by microinjection.

[0029]

[0030] In the present invention, the nucleotide sequence of the sgRNA of the Foxl2 gene is as shown in mG*mG*mU*-SEQ ID NO.3-*mU*mU*mU: mG*mG*mU*GGCCACUUACCAAAACCCGGGUUUU AGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU; the nucleotide sequence of the sgRNA of the Cyp19a1 gene is as shown in mG*mG*mU*-SEQ ID NO.4-*mU*mU*mU: mG*mG*mU*GGAACGGGCGAUGACUCCUGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CU*mU*mU*mU. Wherein, mN represents 2-methoxy modified nucleotides, and * represents phosphorothioate modification.

[0031] In the present invention, it is preferred that the Cas9 protein and the target gene sgRNA are mixed at an equal concentration ratio, the concentration of the Cas9 protein is preferably 10 to 30 μM, and the concentration of the target gene sgRNA is preferably 10 to 30 μM; after the Cas9 protein and the target gene sgRNA are mixed, they are preferably injected at an amount of 1 to 5 nL / egg.

[0032] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1

[0034] A method for microinjection of grouper, comprising the following steps:

[0035] Preparation of microinjection needles: Glass capillaries (B100-75-10) were calcined using a needle puller. The needle puller was a SUTTER P-97 programmable horizontal microelectrode puller. The needle puller parameters were set as P (power) = 500 mW, HET (heating exposure time) = 720 ms, PULL (pull force) = 60, VEL (tension velocity) = 20 μm / s, and TIME (maintaining time after tension application) = 250 ms. The glass capillaries had an outer diameter of 1.0 mm, an inner diameter of 0.75 mm, and a length of 10 cm. They were made of borosilicate.

[0036] Preparation of injection mold: template such as Figure 1As shown, it includes a base plate 1 and several ridges 2, which are fixed on the base plate 1 in parallel and at equal intervals; the base plate 1 is circular, with a diameter of 5 cm and a thickness of 2.05 mm; two through holes with a diameter of 1.5 mm are symmetrically opened at the two ends of the base plate 1 at a distance of 1 mm from the edge of the base plate 1, and the length direction of the ridge 2 is parallel to the connecting line of the two through holes; the ridges 2 are ridges of equal length, width and height: the length is 3.2 cm, the width is 0.72 mm and the height is 0.8 mm; the distance between two adjacent ridges 2 is 4.28 mm; 0.75 g of agarose powder is mixed with 50 mL of water and heated until completely dissolved to obtain an agarose solution, the agarose solution is poured into a culture dish, and the template is inverted on the surface of the solution before the solution begins to solidify (to avoid bubbles between the template and the solution), and after the solution is completely solidified, the template is peeled off with tweezers to obtain a mold (as shown in FIG. Figure 2 shown).

[0037] Grouper fertilized eggs: Mix male grouper semen, unfertilized grouper eggs and sterilized seawater (21°C) in a ratio of 0.6mL:4g:1500mL and let it stand for 6 minutes to obtain grouper fertilized eggs.

[0038] Microinjection of grouper fertilized eggs:

[0039] Use a 3 mL extended Pasteur pipette to take grouper fertilized eggs floating in the surface water, transfer the fertilized eggs to the injection mold, and use a 1 mL sterile syringe (bend the needle tip with external force to avoid puncturing the egg membrane) to move the eggs into the mold and fix them. Suck out the seawater until the fertilized eggs fixed in the mold are just completely immersed in the seawater.

[0040] Adjust the needle holder's field of view under the microscope until the tip of the microinjection needle is in the center of the field of view. Use the microinjection needle to inject the solution into the animal pole of the grouper fertilized egg (1-cell stage to 8-cell stage) under a high-power microscope.

[0041] The injected grouper fertilized eggs were transferred to a 2L beaker containing 1.5L sterilized seawater and incubated in a constant temperature incubator at 26°C. The sterilized seawater was replaced every 6 hours before the fry emerged from the water, for a total of three water changes. Dead eggs that sank to the bottom of the water were removed each time.

[0042] 20 to 22 hours after microinjection, the fertilized eggs that have emerged from the membrane are placed in a 42×30×23 cm storage box filled with 20 L of sterile seawater. Continuous oxygenation is required until the fry emerge from the membrane.

[0043] Example 2

[0044] Example 1 Application of grouper microinjection method in gene editing.

[0045] The Foxl2 and Cyp19a1 genes of Epinephelus fuscoguttatus were selected as target genes for sgRNA design. The designed sgRNA was synthesized using ITD technology. The synthesized RNA sequence is as follows:

[0046] Foxl2-sgRNA-1(mG*mG*mU*-SEQ ID NO.3-*mU*mU*mU):mG*mG*m

[0047] U*GGCCACUUACCAAAACCCGGGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCU*mU*mU*mU;

[0048] Foxl2-sgRNA-2(mG*mG*mU*-SEQ ID NO.5-*mU*mU*mU): mG*mG*mU*GGUGGUGUCGUGGAUCAUUAGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCU*mU*mU*mU;

[0049] Cyp19a1-sgRNA-1(mG*mG*mU*-SEQ ID NO.4-*mU*mU*mU): mG*mG*mU*GGAACGGGCGAUGACUCCUGGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCU*mU*mU*mU;

[0050] Cyp19a1-sgRNA-2 (mG*mG*mU*-SEQ ID NO.6-*mU*mU*mU): mG*mG*mU*GGAUGACAUGGUGGCAGACCGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCU*mU*mU*mU;

[0051] mN represents 2-methoxy-modified nucleotides, and * represents phosphorothioate modification.

[0052] Four sgRNAs were mixed with Cas9 proteins to obtain four RNPs, which were then injected into fertilized eggs of brown-spotted grouper: 20 μM sgRNA and 20 μM Cas9 protein were mixed and allowed to stand for 5 minutes to form stable RNPs, which were then injected into fertilized eggs of brown-spotted grouper using the method of Example 1 at an injection volume of 3 nL / egg; four groups of treated brown-spotted grouper fertilized eggs were obtained. Figure 3 ), 10 fry were randomly selected from each group and mixed evenly, and genomic DNA was extracted.

[0053] PCR amplification was performed using primers EFfoxl2YS (SEQ ID NO.7): CGCAGTTGGAGGGCAGAT and EFfoxl2YA (SEQ ID NO.8): GATACTGTTCTGCCAACCTTTCTT to detect the Foxl2 gene; PCR amplification was performed using primers EFCyp19a1YS (SEQ ID NO.9): TTGTTTACC TTTCTCCTCCTCTGTT and EFCyp19a1YA (SEQ ID NO.10): GCTTCAAACTA CTGACCCTACCTG to detect the Cyp19a1 gene.

[0054] The PCR reaction system was as follows: 12.5 μL 2X Master Mix (Qingke, Nanjing, China), 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), and sterile double-distilled water to 25 μL.

[0055] The PCR reaction conditions were: 95°C for 5 min; 94°C for 15 s, 60°C for 15 s, 72°C for 30 s, 33 cycles; 72°C for 5 min.

[0056] The PCR product was divided into two parts, one of which was sent for sequencing (sequencing company was Qingke Bio). The results showed that the target gene was edited at the Foxl2-sgRNA-1 and Cyp19a1-sgRNA-1 sites ( Figure 1 B to E); no target gene editing was detected at the Foxl2-sgRNA-2 and Cyp19a1-sgRNA-2 sites.

[0057] Another PCR amplification product was connected to the T vector, and 20 positive clones were randomly selected for sequencing (sequencing company: Qingke Bio). The sequencing results showed that the gene editing efficiency of the Foxl2-sgRNA-1 site was 30%, and the gene editing efficiency of the Cyp19a1-sgRNA1 site was 15%.

[0058] At the same time, according to the TA cloning sequencing results, analysis found that 3 out of 20 positive clones at the Foxl2-sgRNA-1 site mutated, with a mutation rate of 15%, and there were three types of mutations at the Foxl2-sgRNA-1 site; 3 out of 20 positive clones at the Cyp19a1-sgRNA-1 site mutated, with a mutation rate of 15%, and there were two types of mutations at the Cyp19a1-sgRNA-1 site ( Figure 3 F, G in ).

[0059] Another 20 fry were collected to extract genomic DNA, and the editing region was PCR expanded using primers EFCyp19a1YS / EFfoxl2YA. The expanded PCR products were sequenced (sequencing company: Qingke Bio). The results showed that 10 of the 20 tested fry were edited.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A grouper microinjection needle, characterized in that: The microinjection needle is a glass capillary prepared by calcining using a needle puller, and the parameters of the needle puller are set as P=500mW, HET=720ms, PULL=60, VEL=20μm / s, TIME=250ms; the outer diameter of the glass capillary is 1.0mm, the inner diameter is 0.75mm, and the length is 10cm.

2. A method for microinjection of grouper, characterized in that: The steps include: After the grouper eggs are fertilized, the fertilized eggs are placed in an injection mold, and the microinjection needle according to claim 1 is used to inject into the animal pole of the fertilized eggs; The artificial insemination of grouper eggs comprises the following steps: mixing male grouper semen, unfertilized grouper eggs and seawater in a ratio of (0.5-1) mL: (2-5) g: 1500 mL, and standing for 5-10 minutes; the seawater is sterilized seawater, and the temperature of the seawater is 20-22° C.

3. The method according to claim 2, characterized in that Microinjection was performed on grouper fertilized eggs at the 1-cell to 8-cell stage.

4. The method according to claim 2, characterized in that The preparation method of the injection mold comprises: preparing an agarose solution, placing the template of the injection mold upside down on the surface of the solution before the solution solidifies, and removing the template after the solution solidifies to obtain the injection mold; The template includes a base plate and a plurality of ridges, and the ridges are fixed on the base plate in parallel and at equal intervals; the ridges have a width of 0.72 mm and a height of 0.8 mm.

5. The method according to claim 2, characterized in that The groupers include brown-spotted grouper, leopard gill grouper, clearwater grouper, yellowfin grouper and red nine-spined grouper.

6. Use of the grouper microinjection needle according to claim 1 or the method according to any one of claims 2 to 5 in grouper gene editing.

7. The use according to claim 6, characterized in that The gene editing steps include: mixing Cas9 protein with the target gene sgRNA, and then injecting it into the animal pole of the grouper fertilized egg by microinjection.

8. The use according to claim 7, characterized in that The target genes include Fox12 gene and Cyp19a1 gene.

9. The use according to claim 8, characterized in that The nucleotide sequence of the sgRNA of the Foxl2 gene is shown as mG*mG*mU*-SEQ ID NO.3-*mU*mU*mU; the nucleotide sequence of the sgRNA of the Cyp19a1 gene is shown as mG*mG*mU*-SEQ ID NO.4-*mU*mU*mU.

10. The use according to claim 7, characterized in that Cas9 protein and target gene sgRNA were mixed at equal concentration ratios.

Citation Information

Patent Citations

  • Fish breeding method for improving CRISPR-Cas9 gene editing and passage efficiency through fish roe preserving fluid

    CN106191124A

  • Microinjection method and application of snakehead

    CN115927481A

  • Method for establishing zebra fish gnai2a gene mutant model

    CN117535347A

  • Siniperca chuatsi fry egg sac microinjection method

    CN117660543A

  • Method for promoting sexual maturation of fish

    WO2023243725A1

Cited By

  • Indoor cultivation method and application of gene editing grouper fries

    CN121153626A