Yarrowia lipolytica recombinant strain and application thereof in production of mevalonic acid

By genetically modifying Yarrowia lipolytica and optimizing the mevalonate pathway, the high cost and low yield problems of traditional chemical synthesis of mevalonate were solved, and the efficient production of mevalonate and related derivatives was achieved.

CN120818449APending Publication Date: 2025-10-21TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410435110.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-11
Publication Date
2025-10-21

AI Technical Summary

Technical Problem

Traditional chemical synthesis of mevalonic acid has problems such as difficulty in obtaining raw materials, high cost, and difficulty in separation and purification. Existing biosynthesis methods have limited mevalonic acid production in Yarrowia lipolytica and need to be further improved.

Method used

By genetically modifying Yarrowia lipolytica, including weakening ERG12 gene expression, overexpressing HMG-CoA reductase and HMG-CoA synthetase genes, knocking out IDH1, IDH2 and CEX1 genes, the mevalonate pathway was optimized, the supply of acetyl-CoA was increased and metabolic overflow was reduced.

Benefits of technology

It significantly improves the yield and carbon conversion rate of mevalonic acid, and is suitable for the production of acetyl-CoA derivatives such as mevalonic acid, terpenoids and fatty acids, solving the problems of high cost and low yield of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004786964050000011
    Figure HDA0004786964050000011
  • Figure HDA0004786964050000012
    Figure HDA0004786964050000012
  • Figure HDA0004786964050000013
    Figure HDA0004786964050000013
Patent Text Reader

Abstract

The invention discloses yarrowia lipolytica recombinant bacteria and application thereof in production of mevalonic acid. According to the method, firstly, a mevalonic acid pathway of yarrowia lipolytica is analyzed, expression of mevalonic acid kinase genes is weakened through promoter engineering, and cells successfully accumulate mevalonic acid under the condition that biomass is not affected; the expression of key genes HMG-CoA reductase and HMG-CoA synthetase is reinforced through promoter replacement, so that the yield of mevalonic acid is further increased; the isocitrate dehydrogenase gene is knocked out to block TCA circulation, and the concentration of cytoplasm acetyl coenzyme A can be effectively increased, so that more precursors are provided for synthesis of mevalonic acid; by knocking out a citric acid transporter gene, extracellular transport of citric acid is blocked, metabolic overflow of yarrowia lipolytica is eliminated, and the yield of mevalonic acid and the carbon conversion rate are increased. Experiments prove that the recombinant bacteria obtained by carrying out the genetic operation in the yarrowia lipolytica can produce mevalonic acid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant Yarrowia lipolytica bacterium and application thereof in producing mevalonic acid. Background Art

[0002] Mevalonic acid is an intermediate metabolite in the mevalonate pathway (MVA) and is used in the synthesis of cholesterol, steroid hormones, bile acid, ubiquinone, and galactol. Furthermore, mevalonic acid can be converted through phosphorylation and isomerization to terpenoid precursors, namely isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). These two compounds can then condense to form geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), and geranylgeranyl pyrophosphate (GGPP). These three compounds, catalyzed by terpene synthases, can further form a diverse range of monoterpenes, sesquiterpenes, diterpenes, triterpenes, and tetraterpenes, which are widely used in the food, cosmetics, and pharmaceutical industries. In addition to its use in the synthesis of terpenoid precursors, mevalonic acid itself has significant application potential. It can be esterified to form β-methyl-δ-valerolactone, which is used in material synthesis.

[0003] Traditional mevalonic acid synthesis relies on chemical synthesis, using 4-chloro-2-butanone as the raw material and undergoing multiple reactions to ultimately produce mevalonic acid lactone. However, chemical synthesis of mevalonic acid suffers from difficulties, high costs, and low yields due to the difficulty in obtaining the raw materials and the varying optical rotations of the synthesized mevalonic acids. Microbial fermentation, on the other hand, allows for the use of inexpensive substrates as carbon sources, and the synthesized product has a single optical rotation, making it easier to separate and purify. Therefore, biological synthesis of mevalonic acid holds broad application prospects.

[0004] Mevalonate biosynthesis begins with acetyl-CoA. First, two molecules of acetyl-CoA are converted to acetoacetyl-CoA by the action of acetyl-CoA acyltransferase (acetoacetyl-CoA thiolase). Then, one molecule of acetoacetyl-CoA and one molecule of acetyl-CoA are converted to HMG-CoA by the action of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase. Finally, HMG-CoA is converted to mevalonate by HMG-CoA reductase.

[0005] Currently, research on the synthesis of mevalonate is primarily focused on prokaryotes, such as Escherichia coli and Halomonas bluephagenesis. In 2004, Japanese scientists achieved mevalonate production in Escherichia coli by introducing HMG-CoA synthase (mvaS) and HMG-CoA reductase (mvaE) from Enterococcus faecalis (Tabata K, Hashimoto S. Production of mevalonate by a metabolically-engineered Escherichia coli. Biotechnol Lett. 2004, 26(19):1487-91.). In 2014, Xiong et al. selected the mvaS-mvaE pathway from Lactobacillus casei and, through expanded culture, achieved a mevalonic acid production of 88 g / L and a glucose conversion rate of 0.26 g / g (Xiong M, Schneiderman DK, Bates FS, Hillmyer MA, Zhang K. Scalable production of mechanically tunable block polymers from sugar. PNAS. 2014, 111(23): 8357-62.). By combining the glycolysis pathway, the pentose phosphate pathway and the "bifidosis" pathway, a team from Shandong University constructed a carbon-saving pathway - the EP-bifido pathway - in Escherichia coli, thereby increasing the yield of glucose to acetyl-CoA (Wang Q, Xu J, Sun Z, Luan Y, Li Y, Wang J, Liang Q, Qi Q. Engineering an in vivo EP-bifido pathway in Escherichia coli for high-yield acetyl-CoA generation with low CO2 emission. Metab Eng. 2019, 51: 79-87.).Combined with a bifunctional biosensor, the glycolysis flux was dynamically regulated to achieve a mevalonate production of 111.3 g / L (Zhu Y, Li Y, Xu Y, Zhang J, Ma L, Qi Q, Wang Q. Development of bifunctional biosensors for sensing and dynamic control of glycolysis flux in metabolic engineering. Metab Eng. 2021, 68: 142-151.). Recently, Zhang et al. simultaneously introduced mvaS-mvaE from E. faecalis and L. casei into Halomonas blue phagenesis, using glucose and acetate as mixed carbon sources. Under open fed-batch fermentation conditions, the strain achieved a mevalonate production of 121 g / L (Zhang J, Yuan Y, Wang Z, Chen T. Metabolic engineering of Halomonas blue phagenesis for high-level mevalonate production from glucose and acetate mixture. Metab Eng. 2023, 79: 203-213.).

[0006] Yarrowia lipolytica is an unconventional oleaginous yeast. Some strains have been approved by the FDA and are generally considered safe, making it a suitable host for the production of food additives, pharmaceuticals, and cosmetics. Its genome has been sequenced and annotated, and its metabolic pathways have been extensively studied. Genetic manipulation tools have also been rapidly developed. Furthermore, Yarrowia lipolytica has an active tricarboxylic acid cycle and pentose phosphate pathway, allowing it to utilize a variety of inexpensive, renewable substrates as carbon sources, providing an ample supply of acetyl-CoA, NADPH, and ATP for cell growth. It is considered a promising metabolic engineering host for the production of oil chemicals, terpenoids, organic acids, and sugar alcohols. Summary of the Invention

[0007] The present invention first analyzes the mevalonate pathway of Yarrowia lipolytica itself, genetically modifies Yarrowia lipolytica to obtain a method for constructing a recombinant strain of Yarrowia lipolytica with improved mevalonate production, thereby completing the present invention.

[0008] The present invention provides a recombinant Yarrowia lipolytica strain, which is modified in one or more of the following ways in a starting Yarrowia lipolytica strain: weakening the expression of its endogenous ERG12 gene, or overexpressing HMG-CoA reductase and HMG-CoA synthetase genes, or knocking out the isocitrate dehydrogenase genes IDH1 and / or IDH2 in the starting strain.

[0009] Optionally, the citrate transporter gene CEX1 is further knocked out in the starting bacteria, or its expression is weakened.

[0010] Specifically, the expression of the ERG12 gene is weakened by replacing the promoter of the ERG12 gene itself with a promoter weaker than the promoter of the endogenous ERG12 gene itself, such as the P3 promoter.

[0011] In a specific embodiment, the expression of the HMG-CoA reductase and HMG-CoA synthetase genes in the starting bacteria is enhanced by replacing the promoter; or by introducing an overexpression vector containing the HMG-CoA reductase and HMG-CoA synthetase genes.

[0012] Preferably, the isocitrate dehydrogenase genes IDH1 and IDH2 are knocked out in the starting bacteria, or their expression is weakened, and the citrate transporter gene CEX1 is further knocked out in the starting bacteria, or its expression is weakened.

[0013] In addition, preferably, the expression of the endogenous ERG12 gene is weakened in the starting strain of Yarrowia lipolytica, and the HMG-CoA reductase and HMG-CoA synthetase genes are overexpressed.

[0014] More preferably, the isocitrate dehydrogenase genes IDH1 and IDH2 and the citrate transporter gene CEX1 in the starting strain of Yarrowia lipolytica are further knocked out.

[0015] The present invention also provides use of the recombinant Yarrowia lipolytica in producing acetyl-CoA or acetyl-CoA derivatives.

[0016] Specifically, the acetyl-CoA derivatives include mevalonic acid, fatty acids, and terpenoids.

[0017] The present invention also provides a method for producing acetyl-CoA or an acetyl-CoA derivative, comprising culturing the recombinant Yarrowia lipolytica to produce acetyl-CoA or an acetyl-CoA derivative, and collecting the acetyl-CoA or an acetyl-CoA derivative. Glucose is used as a carbon source during the culturing process, and a feed medium is used during the culturing process to maintain a glucose concentration in the fermentor below 5 g / L, with feed being added until the fermentation is completed.

[0018] Through analysis and research, the present invention found that replacing the Yarrowia lipolytica promoter with a weak promoter can weaken the expression of the ERG12 gene, thereby allowing the strain to accumulate mevalonate. Simultaneously strengthening the expression of HMGR and ERG12, key genes in the mevalonate pathway, can significantly increase mevalonate production. Deleting the isocitrate dehydrogenase genes IDH1 and IDH2 in a mevalonate-producing engineered strain can effectively increase the supply of cytoplasmic acetyl-CoA, thereby increasing mevalonate production. Simultaneously deleting the IDH1 and IDH2 genes has a certain cumulative effect on increasing mevalonate production. Deleting the citrate efflux protein gene CEX1 does not affect the strain's mevalonate production in shake flasks, but significantly reduces citric acid accumulation during fed-batch fermentation and increases mevalonate production and carbon conversion rate. In particular, the knockout of IDH1, IDH2, and CEX1 is universally applicable to increasing the supply of acetyl-CoA in Yarrowia lipolytica and solving the problem of metabolic overflow. It is also applicable to the production of other acetyl-CoA derivatives, such as terpenoids, fatty acids, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Mevalonate production in strains expressing attenuated ERG12 and enhanced key genes.

[0020] Figure 2 Mevalonate production in IDH1 and IDH2 knockout strains.

[0021] Figure 3 Mevalonate production in the CEX1 knockout strain.

[0022] Figure 4 Changes in mevalonate production and citric acid accumulation during fed-batch fermentation of the CEX1 gene knockout strain. DETAILED DESCRIPTION

[0023] The present invention is described below with reference to specific examples in order to better understand the present invention, but the present invention is not limited thereto.

[0024] Example 1. Construction of DNA fragments and gRNA plasmids

[0025] The PCR amplification system and amplification procedure used in the present invention are as follows:

[0026] PCR amplification system: PrimSTAR HS DNA polymerase (TAKARA) was used to prepare the amplification system. The amplification system was as follows: 10 μL of 5× PS Buffer, 4 μL of dNTP Mix, 1 μL each of primers F and R, 1 μL of DNA template, 0.5 μL of HS polymerase (2.5 U / μL), and distilled water was added to the total volume of 50 μL.

[0027] PCR amplification program: 98°C denaturation for 1 minute (1 cycle); 98°C denaturation for 10 seconds, 55°C annealing for 5 seconds, and 72°C extension for x minutes (30 cycles); and 72°C extension for 10 minutes (1 cycle). PrimeSTAR HS DNA polymerase has an amplification rate of 1 kb / min, so x depends on the fragment length.

[0028] (1) Construction of candidate promoter integration fragments

[0029] Marker gene P EXP1 -HphMX-T CYC The expression cassette is an artificially synthesized sequence. The HphMX sequence is the same as GenBank: HQ412578.1 (Range 585-1613), the promoter P EXP1 The sequence is the same as GenBank: KU378203.1 (Range 382-1382), with terminator T CYC The sequence is the same as GenBank: HQ412578.1 (Range 1614-1878).

[0030] By screening the transcriptome data, three candidate promoters were obtained, and their sequences are as follows:

[0031] P1 (SEQ ID NO: 1):

[0032] TGCTAGTCGAGGAAGTCGAGGAAGTCGAGGAAGTCGAGGAAGTCGAGGAAGACAAGATTATCTGATCTAAAAGAAACTTGGAGGCCAAACCAAGCTCCTTATAACTCCAGATATGATTCGAGACATGCAGAGCGGGATCAAAATACAGTAACACTTTTGCCCACCTTATATCTCCGTTCCCGCAATTTCAAC GGGCATAAAGATGCGCGGGACCTACAGAGCTATCGAAATATCACCCAAATATACCAAAATAGTATACGTTCCCTAACCCGACAGTCCTCAACCTGCGTAGTGCACAACCACGATTCCTCTACTAACTGGTGTGTCATGGCTTACCAATTGCAGGTTTTATGCACGGTGTATGTAGATACGCGGCTAAACA.

[0033] P2 (SEQ ID NO: 2):

[0034] ATAGATATAGATTGAGATACTGACTGAGATTGTAGTGTAGGACAGGACCCTGGGATGGTACAAGTCTTTCTGGGGGAAGGTAACGCGACTAAACGACAATGGGTGTTTCTCAATTGTATATATAACTGATATGTAGTGCTTTCAGTAGGTTTCTTCCTGTTTTCAGTTGTTTGGATTGTTTTGATATCCCCTCTCTGTCATTACAGTAGTTATTCAATGAGTGTTTGCTTTGTTTTATATTTTTCACCTAAGTATAAATCGAGTAAACCCCCTTTTTTTTTAACTAAATACTTACATCCAGACCACTCTACGATAAAGTTCACCCATCCACCTGCATATCATGGATATTTTATTTAGCCCATCATCTCATCTTTCACCTCAAGC。

[0035] P3(SEQ ID NO:3):

[0036] .

[0037] The genome of Yarrowia lipolytica strain W29 was used as a template for PCR to amplify candidate promoter fragments P1, P2, and P3. The upstream (GenBank: CP028449.1, Range 2080344-2082356) and downstream homology arms (GenBank: CP028449.1, Range 2082357-2084352) sequences of the ERG12 gene promoter were also amplified. EXP1 -HphMX-T CYC Overlap PCR was performed using primers ERG12-UP-F and ERG12-DW-R to fuse the candidate promoters P1, P2, P3 with the upstream and downstream homology arms and the resistance gene expression cassette, respectively, to obtain the integration fragments ERG12-UP-P of different candidate promoters. EXP1 -HphMX-T CYC -P1-ERG12-DW, ERG12-UP-P EXP1 -HphMX-T CYC -P2-ERG12-DW, ERG12-UP-P EXP1-HphMX-T CYC -P3-ERG12-DW。

[0038] The primers used are as follows:

[0039] ERG12-UP-F: TGAAGTGGGGATTTAAATGCGGCCGCGGCCTGGATGGTGTAGCTGG

[0040] ERG12-UP-R: CTATACGAAGTTATGGTGTCGTGGTCGGTGG

[0041] ERG12-DW-F: GTTATGGTACCATGGACTACATCATTTCGGCGC

[0042] ERG12-DW-R: CATTTTATTTAAATTTGCGGCCGCCTCCTTCCGTCCGACTTGTGC

[0043] P1-F: ATAGCATACATTATACGAAGTTATCCTTTGTTGCCATTGCTAGTCGAGGAAGTC

[0044] P1-R: GCCGAAATGATGTAGTCCATTGTTTAGCCGCGTATCTACATACACCGT

[0045] P2-F: ATAGCATACATTATACGAAGTTATATAGATATAGATTGAGATACTGACTGAGA

[0046] P2-R: GCCGAAATGATGTAGTCCATGCTTGAGGTGAAAGATGAGATG

[0047] P3-F: ATAGCATACATTATACGAAGTTATAGGGACTCTACTAGAGAACG

[0048] P3-R: GCCGAAATGATGTAGTCCATGTTGGTGGTGTCGGGGCA

[0049] HphMX-F: CCACGACACCATAACTTCGTATAGCATACATTATACGAAGTTATCGAGCGTCCC

[0050] HphMX-R: ATAACTTCGTATAATGTATGCTATACGAAGTTATAAGGAG。

[0051] (2) Construction of promoter integration fragments replacing key genes HMGR and ERG13

[0052] The genome of Yarrowia lipolytica strain W29 was used as a template for PCR to amplify the promoter P TEFin (GenBank: CP028450.1, Range 1226844-1227373), the upstream (GenBank: CP028452.1, Range 567417-569362) and downstream homology arm (GenBank: CP028452.1, Range 569581-571602) sequences of the HMGR gene promoter, and the upstream (GenBank: CP028453.1, Range 3777981-3779934) and downstream homology arm (GenBank: CP028453.1, Range 3780132-3781469) sequences of the ERG13 gene promoter were amplified. Overlap PCR was performed using primers HMGR-UP-F, HMGR-DW-R and ERG13-UP-F, ERG13-DW-R, respectively, to insert the promoter P TEFin The upstream and downstream homologous arms were fused to obtain the integration fragment HMGR-UP-P for replacing the key gene HMGR and ERG13 promoter itself. TEFin -HMGR-DW and ERG13-UP-P TEFin -ERG13-DW. The primers used are as follows:

[0053] HMGR-UP-F:CGCGACAGGTGGATCGAATC

[0054] HMGR-UP-R: CGCCGCCAACCCGGTCTCGATTTCGTGGCCTTCGTGGTC

[0055] HMGR-DW-F: GCAGTACTAACCGCAGCTACAAGCAGCTATTGGAAAGATTGTGG

[0056] HMGR-DW-R:GATGGCCTTGCAACCTCGC

[0057] ERG13-UP-F:CCTCGGCATTTTGACTCACAAGTTC

[0058] ERG13-UP-R: CAAATACGCCGCCAACCCGGTCTCGAGTGGTGACATGAACAAGGC

[0059] ERG13-DW-F:CACTTTTTGCAGTACTAACCGCAGTCGCAACCCCAGAACGTTGG

[0060] ERG13-DW-R: CTGCTTGATCTCGTACTTTCGTCG

[0061] P TEFin -F:GAGACCGGGTTGGCGGCG

[0062] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG.

[0063] (3)Int1-UP-P TEFin -HMGR-T PEX20 -Int1-DW and Int2-UP-P TEFin -ERG13-T PEX20 -Construction of Int2-DW integration fragment

[0064] The genome of Yarrowia lipolytica strain YLMVA06 was used as a template for PCR to amplify P TEFin -HMGR and T PEX20 The fragment (GenBank: CP028452.1, Range 816666-816978) was amplified to amplify the upstream (GenBank: CP028450.1, Range 1815612-1816086) and downstream homology arms (GenBank: CP028450.1, Range 1815065-1815579) sequences of the integration site Int1. Overlap PCR was performed using primers Int1-F and Int1-R, respectively, to fuse the HMGR expression cassette, terminator, and upstream and downstream homology arms to obtain the integration fragment Int1-UP-P TEFin -HMGR-T PEX20 -Int1-DW.

[0065] At the same time, PCR was performed using the genome of Yarrowia lipolytica strain YLMVA06 as a template to amplify P TEFin -ERG13 and T PEX20The fragment (GenBank: CP028452.1, Range 816666-816978) was amplified to amplify the upstream (GenBank: CP028450.1, Range 548795-549254) and downstream homology arms (GenBank: CP028450.1, Range 548249-548750) sequences of the integration site Int2. Overlap PCR was performed using primers Int2-F and Int2-R, respectively, to fuse the ERG13 expression cassette, terminator, and upstream and downstream homology arms to obtain the integration fragment Int2-UP-P TEFin -ERG13-T PEX20 -Int2-DW.

[0066] The primers used are as follows:

[0067] P TEFin -F:GAGACCGGGTTGGCGGCG

[0068] HMGR-R: CACTCACTTCCCCATCCACACTTCTATGACCGTATGCAAATATTCGAACC

[0069] ERG13-R: CACTCACTTCCCCATCCACACTTCTACTGCTTGATCTCGTACTTTCGTC

[0070] T PEX20 -F:AAGTGTGGATGGGGAAGTGAGTG

[0071] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0072] Int1-UP-F:GATTGAAACGCCTGACAAAAACGC

[0073] Int1-UP-R: CAAATACGCCGCCAACCCGGTCTCATACCTCCGAGTGTGCAGCC

[0074] Int1-DW-F: TATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTTTCCATCTAAGACCTACATTTGTC

[0075] Int1-DW-R:AATTCGACGACCTGAACACTCGG

[0076] Int2-UP-F:AATTATTGCACAGGACACACACAAGGTTTC

[0077] Int2-UP-R:CAAATACGCCGCCAACCCGGTCTCGCCATAGCACTATTGTAGAGTGGCC

[0078] Int2-DW-F: CGTATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTTACAGTGTCTATCAACGGGGC

[0079] Int2-DW-R:AAAAAAACTGTAGTAGTGTGGTGATGGAGTC.

[0080] (4)Int3-UP-P GPD -ACL1-T PEX20 -Int3-DW and Int4-UP-P EXP1 -ACL2-T PEX20 -Construction of Int4-DW integration fragment

[0081] The genome of Yarrowia lipolytica strain W29 was used as a template for PCR to amplify P GPD (GenBank:CP028450.1, Range 807220-808152), P EXP1 (GenBank: CP028450.1, Range 1637803-1638803), ACL1 (GenBank: CP028452.1, Range 4134793-4136684), ACL2 (GenBank: CP028451.1, Range 3183312-3184805) and T PEX20 The fragment (GenBank: CP028452.1, Range 816666-816978) was amplified to amplify the upstream (GenBank: CP028452.1, Range 2868676-2869150) and downstream homology arms (GenBank: CP028452.1, Range 2868103-2868622) sequences of the integration site Int3 and the upstream (GenBank: CP028452.1, Range 1721682-1722148) and downstream homology arms (GenBank: CP028452.1, Range 1721135-1721634) sequences of the integration site Int4. Overlap PCR was performed using primers Int3-F and Int3-R, respectively, to amplify the P GPD , ACL1, TPEX20 Fuse with the upstream and downstream homology arms to obtain the integrated fragment Int3-UP-P GPD -ACL1-T PEX20 -Int3-DW. At the same time, overlapping PCR was performed using primers Int4-F and Int4-R to convert P EXP1 , ACL2, T PEX20 Fuse with the upstream and downstream homology arms to obtain the integrated fragment Int4-UP-P EXP1 -ACL2-T PEX20 -Int4-DW.

[0082] The primers used are as follows:

[0083] P GPD -F:GACGCAGTAGGATGTCCTGC

[0084] P GPD -R:GGGAGATGTTCTCGTTGGCAGACATTGTTGATGTGTGTTTAATTCAAGAATGAATATAG

[0085] ACL1-F: ATGTCTGCCAACGAGAACATCTCC

[0086] ACL1-R: CACTCACTTCCCCATCCACACTTCTATGATCGAGTCTTGGCCTTGGAAAC

[0087] T PEX20 -F:AAGTGTGGATGGGGAAGTGAGTG

[0088] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0089] P EXP1 -F:AAGGAGTTTGGCGCCCGTTTTTTC

[0090] P EXP1 -R: TGCTGTAGATATGTCTTGTGTGTAAGGGG

[0091] ACL2-F: CCCCTTACACACAAGACATATCTACAGCAATGTCAGCGAAATCCATTCACGAGG

[0092] ACL2-R: CACTCACTTCCCCATCCACACTTTTAAACTCCGAGAGGAGTGGAAGC

[0093] Int3-UP-F: TTAACACTGGACCGTACTGCCCAG

[0094] Int3-UP-R: GTGCAGGACATCCTACTGCGTCAACAGGGAACATCGACTCTGAGAC

[0095] Int3-DW-F: CGTATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTTCCCCTCCCCACGGTGATG

[0096] Int3-DW-R: GCGGAGGAGCAATAGACATACGATTTG

[0097] Int4-UP-F: GTTAGAAGCAATTGGAGAAGAAACGTTCAG

[0098] Int4-UP-R: GAAAAAACGGGCGCCAAACTCCTTTTGTGTCGAAATACAACAGCCAGTCC

[0099] Int4-DW-F: CGTATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTAAGCACTATCCTCTGCTGCG

[0100] Int4-DW-R: TTGATATGGTGTAACAATGATAAACCAAGGCC。

[0101] (5) Construction of IDH1 and IDH2 knockout fragments

[0102] Using the genome of Yarrowia lipolytica strain W29 as a template, the upstream sequence IDH1-UP (CP028452.1, Range 598630-599151) and the downstream sequence IDH1-DW (GenBank: CP028452.1, Range 596501-597039) of the IDH1 gene ORF region were amplified. Subsequently, overlapping PCR was performed using primers IDH1-UP-F and IDH1-DW-R to fuse IDH1-UP and IDH1-DW to obtain the homologous repair fragment Δidh1 required for knocking out IDH1. Similarly, PCR was performed using the genome of Yarrowia lipolytica strain W29 as a template to amplify the upstream sequence IDH2-UP (GenBank: CP028451.1, Range 791463-791993) and the downstream sequence IDH2-DW (GenBank: CP028451.1, Range 793707-794266) of the IDH2 gene ORF region. Overlapping PCR was performed using primers IDH2-UP-F and IDH2-DW-R to fuse IDH2-UP and IDH2-DW to obtain the fragment Δidh2 for knocking out IDH2. The primers used are as follows:

[0103] IDH1-UP-F:GTTCCGGTCGACCTCCACC

[0104] IDH1-UP-R:CTGGAGCTTGTTGATAACAGCCATGTGTGGATGTGGATATGTTTTCGATTAG

[0105] IDH1-DW-F:CATGGCTGTTATCAACAAGCTCCAG

[0106] IDH1-DW-R: CAACGCACCTTCTTATGCACTC

[0107] IDH2-UP-F:CTTCCACCGCCTTTCCTGTC

[0108] IDH2-UP-R: CTTGAGTCGCTTGATAATCTGCTCAGTGTGATTTCTTTGGGGGTTCCAC

[0109] IDH2-DW-F: CTGAGCAGATTATCAAGCGACTCAAG

[0110] IDH2-DW-R:CAAGGACAGTACATACGTTCACAGC.

[0111] (6)Int5-UP-PTEFin -AnACLa-T LIP2 -Int5-DW and Int6-UP-P TEFin -AnACLb-T LIP2 -Construction of Int6-DW integration fragment

[0112] The citrate lyase gene from A. nidulans was artificially synthesized and optimized according to the codon preference of Yarrowia lipolytica. The sequence is as follows:

[0113] AnACLa:

[0114]

[0115] AnACLb:

[0116]

[0117] The genome of Yarrowia lipolytica strain W29 was used as a template for PCR to amplify the promoter P TEFin (GenBank: CP028450.1, Range 1226844-1227373), terminator T LIP2 The fragment (GenBank: CP028448.1, Range 2089124-2090060), the upstream (GenBank: CP028452.1, Range 1837511-1838024) and downstream homology arms (GenBank: CP028452.1, Range 1838090-1838558) sequences of the integration site Int5, and the upstream (GenBank: CP028453.1, Range 3917440-3918034) and downstream homology arms (GenBank: CP028453.1, Range: 3915506-3916075) sequences of the integration site Int6 were used as templates. AnACLa and AnACLb were amplified using the synthesized sequences as templates. Overlap PCR was performed using primers Int5-F and Int5-R, respectively, to amplify P TEFin 、AnACLa、T LIP2 Fuse with the upstream and downstream homology arms to obtain the integrated fragment Int5-UP-P TEFin -AnACLa-T LIP2 -Int5-DW. At the same time, overlapping PCR was performed using primers Int6-F and Int6-R to TEFin 、AnACLb、T LIP2 Fuse with the upstream and downstream homology arms to obtain the integrated fragment Int6-UP-P TEFin -AnACLb-T LIP2 -Int6-DW.

[0118] The primers used are as follows:

[0119] P TEFin -F:GAGACCGGGTTGGCGGCG

[0120] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0121] AnACLa-F:CCAGCACTTTTTGCAGTACTAACCGCAGTCCGCTAAGTCCATCTTCGAGGC

[0122] AnACLa-R:GAGGTTGATTCCGAACAGAAGTTAGGCGGTGCCGAACTCC

[0123] P LIP2 -F:CTTCTGTTCGGAATCAACCTCAAGG

[0124] P LIP2 -R:CAGATGCATTCTTGGGCGGTC

[0125] AnACLb-F:CAGCACTTTTTGCAGTACTAACCGCAGCCTGCTGCTCCTCTCGTCTC

[0126] AnACLb-R:CCTTGAGGTTGATTCCGAACAGAAGTTAGACGTTGACCTCAACTCGACC

[0127] Int5-UP-F:TAACTTTTTTCGTGACTCTGTTCCCCAC

[0128] Int5-UP-R:CGCCGCCAACCCGGTCTCTGTTTGATGTCTTGAGTTTGAGGTCATTTC

[0129] Int5-DW-F:GACCGCCCAAGAATGCATCTGAGTGGCCTTCTGGCACAGAAATGACCACAC

[0130] Int5-DW-R:GTGAAGGAAATGCCTAAAACCTGAATTG

[0131] Int6-UP-F:CTTGAGCGCCACGGTACATTCC

[0132] Int6-UP-R:CGCCGCCAACCCGGTCTCTGTTGGATTGGAGGATTGGATAGTGG

[0133] Int6-DW-F:GACCGCCCAAGAATGCATCTGGGCAATTAACAGATAGTTTGCCGGTG

[0134] Int6-DW-R:CGGTTAAATCTCCGCCTCACTGC。

[0135] (7)CEX1 is the source of life

[0136] Using the genome of Yarrowia lipolytica strain W29 as a template, the upstream sequence CEX1-UP (GenBank: CP028451.1, Range 2525041-2525508) and the downstream sequence CEX1-DW (GenBank: CP028451.1, Range 2527531-2528011) of the CEX1 gene ORF region were amplified. Subsequently, overlapping PCR was performed using primers CEX1-UP-F and CEX1-DW-R to fuse CEX1-UP and CEX1-DW to obtain the homology repair fragment Δcex1 required for knocking out CEX1. The primers used are as follows:

[0137] CEX1-UP-F:CAAGTCGACTTTGGTTAAAGCTCC

[0138] CEX1-UP-R:GTCTCTATTCTTTGTGTGGAGAAGACG

[0139] CEX1-DW-F:CGTCTTCTCCACACAAAGAATAGAGACTTATTTATTAGCTAACTGCGACCTTC

[0140] CEX1-DW-R: GAAACAGCCCCAGTATTGCC.

[0141] (8) Construction of gRNA plasmid

[0142] The construction method of the gRNA plasmid is detailed in the invention patent "A method for oversupplying cytoplasmic acetyl-CoA in yeast and its application", application number 202310058275.X. This invention only lists the names of the gRNA plasmids used and the target sequences they contain, as follows:

[0143] Plasmid name Target sequence gRNA-HMGR ACGAAGGCCACGAAATCAAG gRNA-ERG13 TGCACGGTGTGACGTCGGAG gRNA-IDH1 TCTCAAGAACAACCGACACA gRNA-IDH2 CATCAAGCTGATCACCCGAG gRNA-CEX1 GTATTGGCCAGAGATGACAG gRNA1 GCTCATCGGAAAGAACTCCT gRNA2 AATAGTGCTATGGCTTTGGG gRNA3 GAGAGGGACAGGATACACCG gRNA4 ACAAGCATACAGCCCTCGGG gRNA5 CCTTGAATCAGTCGATGGTC gRNA6 GTATTGGCCAGAGATGACAG

[0144] Example 2: Construction of a recombinant strain producing mevalonic acid

[0145] 1. The culture medium and formula involved in the present invention are as follows:

[0146] YPD medium, each L volume of YPD medium contains: 20 g peptone, 10 g yeast extract, 20 g glucose, 20 g agar powder (added to YPD solid medium).

[0147] YPD plates containing hygromycin B. Each L of YPD medium containing kanamycin contains: 20 g peptone, 10 g yeast extract, 20 g glucose, 20 g agar powder, and 350 mg hygromycin B.

[0148] YPD plates containing nourseothricin, each L volume of YPD medium containing kanamycin contains: 20g peptone, 10g yeast extract, 20g glucose, 20g agar powder, 250mg nourseothricin.

[0149] Delft broth, per liter, contains: 20 g glucose, 7.5 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 14.4 g potassium dihydrogen phosphate, 2 ml trace metal salt stock solution (3.0 g ferric sulfate heptahydrate, 4.5 g zinc sulfate heptahydrate, 4.5 g calcium chloride dihydrate, 0.84 g manganese chloride dihydrate, 0.3 g cobalt chloride hexahydrate, 0.3 g copper sulfate pentahydrate, 0.4 g sodium molybdate dihydrate, 1.0 g boric acid, 0.1 g potassium iodide, 19.0 g ethylenediaminetetraacetic acid disodium salt per liter), 1 ml vitamin stock solution (0.05 g D-biotin, 1.0 g D-pantothenic acid, 1.0 g vitamin B1, 1.0 g pyridoxine, 1.0 g niacin, 0.2 g 4-aminobenzoic acid, 25.0 g inositol per liter), and 40 mg uracil.

[0150] Feed medium, each L of liquid culture medium contains: 700 g glucose, 5 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 3 g potassium dihydrogen phosphate, 10 ml trace metal salt stock solution, 5 ml vitamin stock solution, and 200 mg uracil.

[0151] 2. Preparation and transformation of yeast competent cells:

[0152] Streak the starting colony onto a YPD plate and incubate at 30°C for 24 hours. Elute the colony from the plate with sterile water, transfer to a sterile centrifuge tube, centrifuge at 3000g for 5 minutes, collect the cells, and discard the water. Resuspend the cells in sterile water, centrifuge again as above, and discard the water. Suspend the cells in 1 mL of sterile water, determine the cell density, and take the OD value. 600nm =3.0 suspension into sterile centrifuge tubes and aliquot to obtain competent cells.

[0153] Take the competent cells, centrifuge at 3000g for 15 seconds, discard the supernatant, add gRNA plasmid and / or corresponding gene fragments, then add 80μL PEG (60%, w / v), 5μL 2.0mol / L lithium acetate (pH=6.0), 5μL 2.0 mol / L dithiothreitol, and 10μL salmon sperm DNA (sigma) (2mg / mL) in sequence, shake vigorously until the cells are completely mixed, place in a 39℃ water bath, and warm for 60 minutes; centrifuge at 3000g for 15 seconds, remove the transformation mixture; add 500μL YPD liquid medium, and culture at 30℃ on a shaker for 2 hours; centrifuge at 3000g for 15 seconds, remove the medium; aspirate 100μL sterile water into the reaction tube, gently suspend the precipitate and apply it to the corresponding screening plate.

[0154] (1) Construction of recombinant strains YLMVA01, YLMVA02, and YLMVA03

[0155] Using Yarrowia lipolytica W29 as the starting strain, competent cells were prepared and the integration fragments of different candidate promoters ERG12-UP-P were added. EXP1 -HphMX-T CYC -P1-ERG12-DW, ERG12-UP-P EXP1 -HphMX-T CYC -P2-ERG12-DW, ERG12-UP-P EXP1 -HphMX-T CYC -P3-ERG12-DW was transformed and plated on YPD plates containing hygromycin B to screen positive clones. The obtained strains were named YLMVA01, YLMVA02, and YLMVA03 and preserved.

[0156] (2) Construction of recombinant strains YLMVA04, YLMVA05, and YLMVA06

[0157] W29 and recombinant strain YLMVA03 were used as starting strains to make competent cells, and plasmid gRNA-HMGR and fragment HMGR-UP-P were added. TEFin -HMGR-DW was then transformed, and the transformed cells were plated onto YPD plates containing nourseothricin to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strains were identified, they were named YLMVA04 and YLMVA05 and preserved.

[0158] The recombinant strain YLMVA05 was used as the starting strain to make competent cells, and plasmid gRNA-ERG13 and fragment ERG13-UP-P were added. TEFin -ERG13-DW was transformed, and the transformed cells were spread on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named YLMVA06 and preserved.

[0159] (3) Construction of recombinant strains YLMVA07, YLMVA08, and YLMVA09

[0160] The recombinant strain YLMVA06 was used as the starting strain to make competent cells, and plasmid gRNA-1 and fragment Int1-UP-P were added. TEFin -HMGR-T PEX20-Int1-DW was transformed, and the transformed cells were spread on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named YLMVA06-1.

[0161] The recombinant strain YLMVA06-1 was used as the starting strain to make competent cells, and plasmid gRNA-2 and fragment Int2-UP-P were added. TEFin -ERG13-T PEX20 -Int2-DW was transformed, and the transformed cells were spread on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named YLMVA06-2.

[0162] The recombinant strain YLMVA06-2 was used as the starting strain to make competent cells, and plasmid gRNA-3 and fragment Int3-UP-P were added. GPD -ACL1-T PEX20 -Int3-DW was transformed, and the transformed cells were spread on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named YLMVA06-3.

[0163] The recombinant strain YLMVA06-3 was used as the starting strain to make competent cells, and plasmid gRNA-4 and fragment Int4-UP-P were added. EXP1 -ACL2-T PEX20 -Int4-DW was then transformed, and the transformed cells were plated onto YPD plates containing nourseothricin to screen for positive clones. Positive clones were then selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named MVA-CK1 and preserved.

[0164] The mevalonic acid engineered strain MVA-CK1 was used as the starting strain to prepare competent cells, which were transformed after adding plasmid gRNA-IDH1 and fragment Δidh1. The transformed cells were spread on YPD plates containing nourseothricin to screen for positive clones, and then the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid deletion. After the plasmid deletion was completed and the correct strain was identified, it was named YLMVA07 and preserved.

[0165] The mevalonic acid engineered strain MVA-CK1 and the recombinant strain YLMVA07 were used as the starting strains to prepare competent cells, and the plasmid gRNA-IDH2 and fragment Δidh2 were added for transformation. The transformed cells were spread on YPD plates containing nourseothricin to screen positive clones, and then the positive clones were selected and transferred to YPD liquid culture medium without resistance to plasmid loss. After the plasmid loss was completed and the correct strains were identified, they were named YLMVA08 and YLMVA09 and preserved.

[0166] (4) Construction of recombinant strain YLMVA10

[0167] The recombinant strain MVA-CK1 was used as the starting strain to make competent cells, and plasmid gRNA-5 and fragment Int5-UP-P were added. TEFin -AnACLa-T LIP2 -Int5-DW was transformed, and the transformed cells were plated on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. The plasmid loss was completed and the correct strain was identified. The correct recombinant strain was used as the starting strain to make competent cells, and plasmid gRNA-6 and fragment Int6-UP-P were added. TEFin -AnACLb-T LIP2 -Int6-DW was transformed, and the transformed cells were spread on YPD plates containing nourseothricin to screen positive clones. Then, the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid loss. After plasmid loss was completed and the correct strain was identified, it was named MVA-CK2 and preserved.

[0168] The mevalonic acid engineered strain MVA-CK2 was used as the starting strain to prepare competent cells, which were transformed after adding plasmid gRNA-CEX1 and fragment Δcex1. The transformed cells were spread on YPD plates containing nourseothricin to screen for positive clones, and then the positive clones were selected and transferred to YPD liquid medium without resistance to plasmid deletion. After the plasmid deletion was completed and the correct strain was identified, it was named YLMVA10 and preserved.

[0169] Example 3: Application of recombinant strains in the production of mevalonic acid

[0170] (1) Recombinant bacteria culture and product extraction

[0171] Production of mevalonic acid by shake flask fermentation: The above recombinant strains were activated in Delft liquid medium, and seed solution was prepared in Delft liquid medium (30°C, 250 rpm, 36 h). The appropriate inoculum size was inoculated into a 100 mL Erlenmeyer flask containing 20 mL of Delft liquid medium, and the initial OD after transfer was 0. 600nm=0.1, 30°C, 250 rpm, and culture for 72 h, then take 1 mL of the fermentation liquid for later use.

[0172] Production of mevalonic acid by fed-batch fermentation in a fermenter: strains MVA-CK2 and YLMVA10 were activated in Delft liquid medium, and a primary seed solution was prepared in Delft liquid medium (30°C, 250 rpm, 36 h). The appropriate inoculum volume was transferred to a 500 mL Erlenmeyer flask containing 100 mL Delft liquid medium, and the initial OD after transfer was 2.34. 600nm = 0.1, 30°C, 250 rpm for 24 hours to prepare a secondary seed solution. The cells were then collected by centrifugation, resuspended in sterile water, and inoculated into a fermentor. When the glucose in the initial culture medium was depleted, feed medium was added to maintain the glucose concentration in the fermentor below 5 g / L. This was continued until the fermentation was complete. During this time, samples were taken at appropriate time points, and an appropriate amount of fermentation broth was reserved for future use.

[0173] (2) Qualitative and quantitative analysis of mevalonic acid production by bacteria

[0174] The retained fermentation broth was diluted appropriately and centrifuged at 14,000 g for 10 minutes. The supernatant was collected and filtered through a 0.22 μm filter membrane before analysis by HPLC. HPLC conditions: mobile phase 5 mM H₂SO₄, flow rate 0.6 mL / min; column temperature 63.0°C, RID optics temperature 35°C; injection volume 5 μL, dwell time 25 minutes, post-run 0 minutes. Column: Aminex HPX-87H column (7.8 × 300 mm, 1250140, Bio-Rad).

[0175] The standard substance (sigma) of mevalonic acid was used for qualitative and quantitative analysis, and the peak time of the standard substance was 18.2 min. The fermentation broth collected in step (1) had a peak at the corresponding time, indicating that the fermentation broth collected in step (1) contained mevalonic acid.

[0176] The results are as follows Figure 1 、 Figure 2 and Figure 3As shown, in shake flasks, the mevalonic acid production of each strain after 3 days of fermentation was as follows: W29 was 0.0207 g / L, YLMVA01 was 0.0213 g / L, YLMVA02 was 0.0206 g / L, YLMVA03 was 0.117 g / L, YLMVA04 was 0.505 g / L, YLMVA05 was 1.748 g / L, YLMVA06 was 3.155 g / L, MVA-CK1 was 4.478 g / L, YLMVA07 was 4.852 g / L, YLMVA08 was 4.898 g / L, YLMVA09 was 4.947 g / L, MVA-CK2 was 4.713 g / L, and the production of YLMVA10 was 4.726 g / L.

[0177] Strains MVA-CK2 and YLMVA10 were subjected to fed-batch fermentation in a fermenter. Under the same culture conditions for 216 hours, the mevalonic acid production of strain MVA-CK2 was 75.192 g / L and the citric acid accumulation was 57.843 g / L, while the mevalonic acid production of strain YLMVA10 was 89.176 g / L and the citric acid accumulation was 2.440 g / L.

[0178] This example demonstrates that replacing the promoter of the ERG12 gene itself with the P3 promoter in Yarrowia lipolytica can weaken the expression of the ERG12 gene, thereby allowing the strain to accumulate mevalonate, while strengthening the expression of key genes HMGR and ERG13 in the mevalonate pathway, which can significantly increase the yield of mevalonate; knocking out the isocitrate dehydrogenase genes IDH1 and IDH2 in the mevalonate-producing engineered strain can effectively increase the supply of cytoplasmic acetyl-CoA, thereby increasing mevalonate production, and simultaneous knockout of the IDH1 and IDH2 genes has a certain cumulative effect on increasing mevalonate production; knocking out the citrate efflux protein gene CEX1 does not affect the mevalonate production of the strain in a shake flask, but significantly reduces the accumulation of citric acid during fed-batch fermentation, and increases the yield and carbon conversion rate of mevalonate. The recombinant strain construction strategy adopted in the present invention provides a new technical method and research basis for improving mevalonic acid production. In particular, the knockout of IDH1, IDH2 and CEX1 has universal applicability for increasing the supply of acetyl-CoA in Yarrowia lipolytica and solving the problem of metabolic overflow. It is also applicable to the production of other acetyl-CoA derivatives, such as terpenoids and fatty acids.

Claims

1. A recombinant Yarrowia lipolytica, characterized in that One or more of the following modifications are performed in the starting strain of Yarrowia lipolytica: weakening the expression of its endogenous ERG12 gene, or overexpressing the HMG-CoA reductase and HMG-CoA synthetase genes, or knocking out the isocitrate dehydrogenase genes IDH1 and / or IDH2 in the starting strain.

2. The recombinant Yarrowia lipolytica according to claim 1, wherein The citrate transporter gene CEX1 is further knocked out in the starting bacteria, or its expression is weakened.

3. The recombinant Yarrowia lipolytica according to claim 1, wherein The expression of the ERG12 gene is weakened by replacing the promoter of the ERG12 gene with a promoter weaker than the promoter of the endogenous ERG12 gene, such as the P3 promoter.

4. The recombinant Yarrowia lipolytica according to claim 1, wherein The expression of the HMG-CoA reductase and HMG-CoA synthetase genes in the starting bacteria is enhanced by replacing the promoter; or by introducing an overexpression vector containing the HMG-CoA reductase and HMG-CoA synthetase genes.

5. The recombinant Yarrowia lipolytica according to claim 2, wherein The isocitrate dehydrogenase genes IDH1 and IDH2 in the starting bacteria are knocked out, or their expression is weakened, and the citrate transporter gene CEX1 gene is further knocked out, or its expression is weakened, in the starting bacteria.

6. The recombinant Yarrowia lipolytica according to claim 2, wherein In the starting strain of Yarrowia lipolytica, the expression of its endogenous ERG12 gene was weakened, and the HMG-CoA reductase and HMG-CoA synthetase genes were overexpressed.

7. The recombinant Yarrowia lipolytica according to claim 6, wherein The isocitrate dehydrogenase genes IDH1 and IDH2 and the citrate transporter gene CEX1 in the starting strain of Yarrowia lipolytica were further knocked out.

8. Use of the recombinant Yarrowia lipolytica according to any one of claims 1 to 7 in the production of acetyl-CoA or acetyl-CoA derivatives.

9. The use according to claim 8, characterized in that The acetyl-CoA derivative product is selected from mevalonic acid, fatty acids or terpenoids.

10. A method for producing acetyl-CoA or acetyl-CoA derivatives, characterized in that: The method comprises the steps of culturing the recombinant Yarrowia lipolytica according to any one of claims 1 to 7 to produce acetyl-CoA or an acetyl-CoA derivative, and collecting the acetyl-CoA or the acetyl-CoA derivative; wherein glucose is used as a carbon source during the culture, and a feed medium is used during the culture process to maintain a glucose concentration in the fermentation tank less than 5 g / L, and feeding is performed until the end of fermentation.

Citation Information

Patent Citations

  • Method for excessively supplying cytoplasm acetyl coenzyme A in yeast and application of method

    CN115895927A