Promoter and screening method and application thereof

Abstract

The invention provides a promoter and a screening method and application thereof. The promoter is obtained through a screening method based on a lacZ gene. Specifically, the method comprises the following steps: respectively carrying out library establishment and preliminary screening on plasmids which contain beta-galactosidase genes (lacZ or lacZ alpha genes) and have inactivated promoters, and then carrying out secondary screening on the basis of a chromogenic reaction and enzyme activity determination between a chromogenic substrate and beta-galactosidase, so as to obtain the promoter with required strength. According to the technical scheme, the screening process is simplified, the screening efficiency is improved, and a new thought and a new tool are provided for research and application of the promoter.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a promoter and a screening method and application thereof, and more specifically relates to a method for screening a promoter based on the lacZ gene, the obtained promoter and application thereof. Background Art

[0002] Promoters are key regions of DNA sequences where RNA polymerase recognizes, binds, and initiates transcription. They play a central role in regulating gene expression. Therefore, the selection and optimization of promoters are crucial for regulating gene expression. However, current promoter screening processes face numerous challenges, limiting their application in gene regulation.

[0003] β-galactosidase, a key enzyme in biological research and genetic engineering, exhibits exceptional substrate specificity, catalyzing a wide range of substrates and producing a distinct color reaction, enabling researchers to visually observe and monitor its activity. Consequently, it is widely used as a reporter gene. For example, in the presence of an artificial substrate, X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside), active β-galactosidase cleaves it into galactose and the dark blue substance 5-bromo-4-indigo, resulting in a blue bacterial colony. By plating a bacterial strain on a plate containing X-gal and culturing under appropriate conditions, researchers can preliminarily determine the expression level of β-galactosidase based on the color development of the colonies the following day, providing important reference information for subsequent research and analysis.

[0004] In addition to X-gal, β-galactosidase activity can also be detected by breaking down o-nitrophenol β-D-galactoside (ONPG). When ONPG meets β-galactosidase, a series of chemical reactions occur, ultimately generating a bright yellow product—O-nitrophenol (also known as o-nitrophenol). This color reaction is not only intuitive but also allows for precise quantitative analysis using instruments such as microplate readers. These instruments can provide more accurate enzyme expression data, allowing for better judgment of gene expression.

[0005] When performing high-throughput testing of β-galactosidase, the repeatability and consistency of the results have long been a problem that has plagued researchers. Patent application CN116286923A discloses a screening method for ribosome binding sequences. It first uses a blue-white color development for primary screening, and then performs enzyme activity determination in a test tube to quantitatively screen out promoter sequences of the required strength. However, this method has low throughput and low screening efficiency. In addition, before determining the enzyme activity, in order to maintain a consistent OD value of the strain, this method requires diluting the test solution, which is prone to errors and therefore has the problem of low accuracy.

[0006] In metabolic engineering, precise regulation of gene expression is essential to achieve higher conversion rates. In high-yielding strains, increasing the expression of rate-limiting enzymes typically significantly improves yield and conversion. This necessitates the selection of strong promoters to achieve high expression. In some cases, excessive enzyme expression can adversely affect strain growth, ultimately leading to a decrease in yield or conversion. This necessitates the search for promoters with moderate strengths. Therefore, precise adaptation of genes within metabolic pathways is crucial. To achieve this, promoters of varying strengths are used based on the specific situation. This requires methods to create a sufficiently abundant promoter population and quantify its expression strength. Therefore, a high-throughput, efficient, and accurate promoter screening method is needed to identify promoters of specific strengths for gene expression regulation in strains such as Escherichia coli, thereby improving the conversion rate or yield of the target product. Summary of the Invention

[0007] This invention provides a method for screening promoters based on plasmids containing either the α fragment or the complete β-galactosidase gene, which is silent due to the lack of an effective promoter. By constructing a promoter region library, promoters of varying strengths can be obtained to activate expression of the reporter gene β-galactosidase. Phenotypic screening allows selection of strains containing promoters of appropriate strengths. Enzyme activity measurements are then performed to determine specific parameters, providing strong support for subsequent research and development.

[0008] Among them, during the enzyme activity determination process, based on the color development mechanism of β-galactosidase decomposing ONPG or β-galactosidase decomposing X-gal, the present invention designs a reaction method suitable for a 96-well plate system, which not only simplifies the operation steps, but also can accurately quantify the enzyme activity and effectively complete high-throughput rescreening, ensuring the accuracy and reliability of the results.

[0009] The screening method of the present invention is high-throughput, and the activity of the reporter gene (β-galactosidase) is measured by color development reaction on a plate and a well plate, thereby achieving efficient primary screening and secondary screening. Specifically:

[0010] ① Obtain effective promoters by blue-white screening and complete the initial screening by color development;

[0011] ② The initially screened strains were subjected to batch activity determination using a colorimetric plate method.

[0012] Furthermore, the present invention provides a simple promoter library construction method. While maintaining the conserved sequence of a selected promoter, multiple bases are selected from the remaining sequence for primer design (in the corresponding primers, the base positions to be mutated are designed as degenerate bases). By using primer pairs containing degenerate sequences, inverse PCR is performed on a lacZ-based screening plasmid, effectively completing the library construction process. This method is simple to operate and can be used to control the strength of common promoters to achieve the desired strength.

[0013] The present invention identified six promoters, OH20-OH25, through high-throughput screening. The strength of these six promoters was verified using a traditional β-galactosidase activity assay. The results from the traditional assay were highly consistent with those from the screening method of the present invention, demonstrating the high reliability of the high-throughput assay employed in this invention. This technical solution not only simplifies the screening process and improves screening efficiency, but also provides new insights and tools for promoter research and application.

[0014] Specifically, the present invention provides the following technical solutions:

[0015] In one aspect, the present invention provides a plasmid for screening promoters, wherein the plasmid comprises a β-galactosidase gene, the promoter of the β-galactosidase gene is inactivated, and the β-galactosidase gene is a lacZ or lacZα gene.

[0016] The above-mentioned lacZα gene encodes the α fragment of β-galactosidase, and the lacZ gene encodes β-galactosidase.

[0017] In some embodiments, the plasmid further comprises a resistance gene.

[0018] In some embodiments, the resistance genes include but are not limited to ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, spectinomycin resistance gene, tetracycline resistance gene, streptomycin resistance gene, hygromycin resistance gene, gentamicin resistance gene and erythromycin resistance gene.

[0019] In some embodiments, the resistance gene is selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a spectinomycin resistance gene, a tetracycline resistance gene, a streptomycin resistance gene, a hygromycin resistance gene, a gentamicin resistance gene, and an erythromycin resistance gene.

[0020] In some embodiments, the inactivation of the promoter is the deletion, addition, or substitution of base pairs in a partial sequence of the promoter, and the most common ones are the addition, deletion, and substitution of bases in the conserved region of the promoter.

[0021] In the genome, this usually requires the use of gene editing tools; on the plasmid, the promoter can be inactivated by simply amplifying the plasmid using primers through PCR and then replicating it using a chassis strain.

[0022] In another aspect, the present invention provides a method for constructing a promoter library, the method comprising:

[0023] a. Designing reverse PCR primers for the original sequence of the promoter to be screened, wherein the primers contain a degenerate sequence of multiple bases;

[0024] b. Perform inverse PCR using the plasmid for screening promoters as described above as a template to obtain a library of promoters to be screened.

[0025] In some embodiments, the primer is a degenerate sequence containing 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases, preferably a degenerate sequence containing 18 bases.

[0026] In some embodiments, the bases of the degenerate sequence are not bases in the conserved sequence of the promoter.

[0027] In some embodiments, when the plasmid used to screen the promoter is a plasmid containing the complete β-galactosidase gene (i.e., the lacZ gene), the promoter to be screened is preferably a non-lactose-inducible promoter. This is because lactose-inducible promoters require the addition of lactose or IPTG when used, which will cause background interference in the expression of lacZ in the strain itself, resulting in inaccurate detection results of the expression intensity of the screened promoter. Furthermore, when the promoter to be screened is a lactose-inducible promoter, the strain's own lacZ gene can also be knocked out by gene editing to prevent its expression, thereby eliminating or reducing the above-mentioned background interference.

[0028] In some embodiments, the promoter to be screened is promoter pM1-37, whose nucleotide sequence is shown in SEQ ID NO:9.

[0029] In another aspect, the present invention provides a high-throughput promoter screening method comprising the following steps:

[0030] S1. Primary screening: strains containing target promoters were preliminarily screened from the library of promoters to be screened obtained as described above based on the degree of color development by blue-white screening;

[0031] S2. Rescreening: The strains screened initially are cultured in deep-well plates. After the culture is completed, part of the bacterial liquid is transferred to a transparent well plate, and a colorimetric substrate of β-galactosidase is added for reaction. The strength of the promoter is judged based on the depth of the color. The strains containing the promoter of the required strength are sequenced to obtain the promoter of the target strength.

[0032] In some embodiments, the chromogenic substrate is ONPG or X-gal;

[0033] When the chromogenic substrate is ONPG, step S2 is specifically as follows:

[0034] S21, transferring part of the bacterial solution after the culture to a transparent well plate, and then adding the substrate ONPG for reaction;

[0035] S22, adding sodium carbonate solution to the wells of the transparent well plate to terminate the reaction;

[0036] S23. Determine the strength of the promoter based on the depth of the yellow color. Sequence the strain containing the promoter of the required strength to obtain the promoter of the desired strength.

[0037] When the chromogenic substrate is X-gal, step S2 is specifically as follows:

[0038] Transfer part of the bacterial liquid after the culture is completed to a transparent well plate, and then add the substrate X-gal to react; after the reaction is completed, judge the strength of the promoter based on the depth of the blue color that appears, and sequence the strain containing the promoter of the required strength to obtain the promoter of the target strength.

[0039] In some embodiments, the method further includes placing the transparent well plate in a microplate reader to detect the absorbance value of each well to reflect the enzyme activity level of the colony; screening the target colony according to the absorbance value of each well, and obtaining the sequence of the target promoter by sequencing.

[0040] In some embodiments, step S1, primary screening, comprises: transforming the library of promoters to be screened (i.e., the PCR product obtained in the aforementioned step b) into a strain, and then adding X-gal to perform screening and culturing on the strain. If the plasmid used is a plasmid comprising the lacZα gene (i.e., the p-PS1 plasmid of the present invention), the strain must contain the lacZω gene, and IPTG must also be added during the screening and culturing to induce lacZω expression in the strain genome. lacZω binds to lacZα expressed on the p-PS1 plasmid to produce active β-galactosidase, which catalyzes X-gal color development (the darker the blue, the higher the promoter strength, and the lighter the blue, the lower the intensity).

[0041] In some embodiments, in step S2, rescreening, the strains initially screened are cultured in deep-well plates until they reach the plateau phase and then the culture is terminated.

[0042] In another aspect, the present invention provides a promoter obtained by the above method.

[0043] In some embodiments, the sequence of the promoter is as shown in SEQ ID NO: 18-23, and the first 50 bases of the promoter are a common conserved sequence, and the last 12 bases are a common ribosome binding site.

[0044] In another aspect, the present invention provides use of the promoter described above in engineering strain construction, metabolite synthesis, gene expression regulation, or biosensor construction.

[0045] In some embodiments, the biosensor is a quorum sensing system, specifically a LuxI / LuxR quorum sensing system.

[0046] In some embodiments, the engineered strain is Escherichia coli.

[0047] In some embodiments, the E. coli is DH5α, BL21 or Top10.

[0048] definition

[0049] Degenerate sequences: Degenerate sequences are a common technique in molecular biology and genetic engineering, particularly in primer synthesis and PCR (polymerase chain reaction) amplification. This technique allows for the introduction of multiple bases at specific positions in primers, enabling simultaneous targeting of multiple target sequences. During primer synthesis, researchers intentionally use degenerate bases at certain positions in primers, rather than single A, T, C, or G, to facilitate operations such as screening and library construction. These degenerate bases can represent combinations of bases, for example, R represents A or G, Y represents C or T, K represents G or T, M represents A or C, S represents G or C, B represents C, G, or T, V represents A, C, or G, D represents A, G, or T, H represents A, C, or T, and N represents any of A, T, C, or G. This design allows primers to bind to multiple variants of the target sequence, enabling the amplification of multiple similar sequences. This is particularly useful when dealing with gene families, homologous sequences, or when there are sequence polymorphisms, because multiple related sequences can be amplified at one time rather than designing multiple primers separately. In the present invention, a degenerate sequence refers to a base sequence that uses degenerate bases at certain positions in the primers.

[0050] Reverse PCR: It uses reverse complementary primers to amplify fragments of unknown sequences outside the two primers, usually using a plasmid as a template; the upper and lower primers designed have a portion of sequence that can be paired with the plasmid template for amplification, and the forward and reverse primers bind to two sites on the plasmid template respectively. After PCR amplification, the product obtained is basically consistent with the template, with only a portion of specific sequence retained at both ends. These sequences at both ends have homology and can be repaired in strains such as DH5α and spliced ​​into a complete plasmid. The style of the primers is as follows: Figure 3shown.

[0051] Relative activity: The relative activity of the present invention is obtained by the color development degree of the microplate reader, the dilution multiple of the strain and the OD value of the strain, and is calculated as follows: microplate reader degree (absorbance) / OD value of the strain / dilution multiple.

[0052] Plateau phase: When factors such as nutrient depletion, accumulation of toxic metabolites, or competition for space limit microbial growth, the microbial population reaches a stable plateau, entering the plateau phase. Once microorganisms enter this phase, their cell reproduction rate equals their cell death rate, and the microbial population no longer increases significantly.

[0053] IPTG: It is an activity-inducing substance for β-galactosidase, commonly used in blue-white spot screening and IPTG-induced protein expression in bacteria.

[0054] pM1-37 promoter: commonly used constitutive promoter.

[0055] Chassis strain: The initial microorganism, such as the strain used for promoter library construction in the present invention.

[0056] Engineered strains: New microorganisms processed using modern bioengineering technology, which have the characteristics of multifunctionality, high efficiency and strong adaptability.

[0057] lacZ gene: It is the structural gene of the lac operon in Escherichia coli, which expresses β-galactosidase, breaking down lactose into galactoside.

[0058] Escherichia coli W3110: This strain is a common chassis of E. coli and is often used for amino acid production.

[0059] Deep well plate: used for strain culture. The plate can hold more culture medium and can be fixed on a well plate shaker for culture. It is not light-transmissive and cannot be placed in an enzyme-labeled instrument for detection.

[0060] Ordinary well plate: Each well can hold 200uL of solution for reaction, is light-transmitting, and can also be placed in an enzyme-labeled instrument for detection.

[0061] Quorum sensing system: In the LuxI / LuxR quorum sensing system, in order to encourage the strain to begin expressing the target protein at a specific fermentation density, we need to precisely control the expression strength of esaR and esaI. This is usually achieved by using promoters of different strengths to express esaR and esaI. In practice, 3 to 6 promoters with different expression strengths (high, medium, and low) are usually required, and adaptation is performed in the engineered strain to find the optimal combination. This invention can efficiently test and screen promoters suitable for quorum sensing experiments.

[0062] Beneficial effects

[0063] The beneficial effects achieved by the present invention compared to the prior art are:

[0064] 1. The present invention reduces the size of the rescreening reaction system from a test tube to a well plate, thereby increasing the efficiency of rescreening. The rescreening is performed by enzyme activity assay, specifically measuring the activity of the reporter gene β-galactosidase. The expression intensity of the reporter gene represents the strength of the promoter, and the expression intensity of the reporter gene can be measured using a colorimetric reagent. Existing technologies, such as Zhang Ting, Yao Meishan, Ou Aifen, et al. Research on β-galactosidase activity detection method [J]. Journal of Guangzhou City Vocational College, 2021, 015(003): 79-83; Wigley WC, Stidham RD, Smith NM, et al. Protein solubility and folding monitored in vivo by structural complementation of agenetic marker protein. [J]. Nature Biotechnology, 2001, 19(2): 131-136. DOI: 10.1038 / 84389 all record screening using test tubes. Therefore, the present invention uses well plates for screening to achieve an improvement in the promoter screening method.

[0065] 2. The present invention can achieve high-throughput screening because the screening of the present invention is carried out in a well plate rather than in a test tube, which reduces errors. For example, in order to keep the OD of the strain consistent, the present invention inoculates the strain into a well plate, cultures it to the plateau phase, and then measures it. Due to the limited culture conditions in the well plate, the OD of the strain cultured to the plateau phase will tend to be consistent, and the OD deviation obtained by culture in this way is within 5%. In addition, the present invention changes from a test tube to a well plate, which reduces the reaction system and time, and changes from manual one-by-one detection by a spectrophotometer to batch detection by an enzyme marker. Finally, traditional promoter screening methods all mutate from a colorimetric state to a non-colorimetric state, such as the common blue-white screening. The present invention mutates from a non-colorimetric state to a colorimetric state, so the promoter of the required strength can be screened by the depth of the color (the darker the blue, the higher the promoter strength, and the lighter the blue, the lower the strength). BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Schematic diagram of the principle of blue-white screening.

[0067] In blue-white screening, the lacZ gene is typically divided into two parts: lacZα and lacZω, which encode the N-terminal fragment (i.e., the α fragment) and C-terminal fragment (i.e., the ω fragment) of β-galactosidase, respectively. In embodiments related to the p-pS1 plasmid of the present invention, the lacZα gene is located on the plasmid, and the lacZω gene is located on the genome of the chassis strain. When the promoter region of the plasmid is mutated to an active promoter, the N-terminus of β-galactosidase can be transcribed and translated. Under the action of an inducer, the lacZω gene on the genome of the chassis strain is also transcribed and translated, producing the C-terminus of β-galactosidase. After combination, active β-galactosidase is obtained. Furthermore, the culture medium commonly used in blue-white screening contains a substrate called X-gal. X-gal itself is colorless, but under the action of β-galactosidase, it is hydrolyzed into galactose and the dark blue product 5-bromo-4-indigo. This dark blue product will accumulate in the colonies, causing cells carrying the recombinant plasmid and successfully expressing β-galactosidase to form blue colonies, namely "blue spots".

[0068] Figure 2 This is a schematic diagram of the initial screening process for the promoter library construction of the present invention.

[0069] Figure 3 The primer design pattern for inverse PCR is shown. DETAILED DESCRIPTION

[0070] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the reagents and materials used are all commercially available unless otherwise specified.

[0072] In the following examples, DH5α is a product of masterbio (https: / / www.masterbio.shop / ), with the product number TSC-C14.

[0073] The pUC57 plasmid in the following examples is a product of miaolingbio (http: / / www.miaolingbio.com / ), with the product number P0087.

[0074] In the following examples, X-Gal, 96-deep-well plates, plate sealers, and 96-well ELISA plates are products of Shanghai Bioengineering Co., Ltd. (https: / / store.sangon.com / ), with product numbers B541006-0001, F600582-0001, F504418-0001, and F605032-0001.

[0075] In the following examples, the endonuclease Dpn I is a product of NEB (http: / / www.neb-china.com / ) with the product number R0176V.

[0076] The product purification kit and gel recovery kit in the following examples are products of Axygen, with product numbers AP-PCR-250 and AP-GX-250G, respectively.

[0077] The antibiotics and conventional reagents in the following examples are all products of Sangon Biotech (Shanghai) Co., Ltd. (https: / / www.sangon.com / ).

[0078] The kits used for one-step cloning and PCR in the following examples were products of Vazyme, with product numbers C112-01 and P505-d1, respectively.

[0079] The high-speed shaking table used in the following examples is the Esci-101H model produced by Anhui Shangkezhi Instrument Co., Ltd.

[0080] LB plate: 5 g / L sodium chloride, 5 g / L yeast extract, 10 g / L tryptone, and 20 g / L agar powder.

[0081] For the different characteristics of bacterial strains, the present invention respectively carries out library construction and primary screening by containing β-galactosidase α fragment (p-PS1 plasmid) and containing β-galactosidase complete gene plasmid (p-PS2).When selecting p-PS1 to carry out promoter library construction and primary screening in bacterial strain, it is necessary to contain lacZ ω in the genome of the bacterial strain, otherwise it is impossible to combine with the lacZ α carried by the p-PS1 plasmid to form active lacZ, and then carry out chromogenic reaction.When selecting p-PS2 to carry out promoter library construction and primary screening in bacterial strain, the bacterial strain is unrestricted, but preferably does not add IPTG in the process of activating reporter gene, to ensure the accuracy of the test result. It should be noted that lactose-inducible promoter needs to add lactose or IPTG when using, which can allow the lacZ expression of the bacterial strain itself, and background interference occurs, so the p-PS2 plasmid is not suitable for the screening of lactose-inducible promoter.

[0082] Example 1 Construction of screening plasmid p-PS1

[0083] The present invention constructs a screening plasmid p-PS1 based on pUC19. Through template selection, primer design and initial screening, the plasmid p-PS1 of the present invention contains the gene of the β-galactosidase α fragment, but its promoter is inactivated, so it is in a silent state.

[0084] The template used in this example is pUC19 plasmid, purchased from Miaoling Biotechnology with the product number P0368.

[0085] The upstream and downstream primers used were:

[0086] PS1-F:gttagctcactcattttgtgagcggataacaatttc(SEQ ID NO:1)

[0087] PS1-R: gttatccgctcacaaaatgagtgagctaactcaca (SEQ ID NO: 2)

[0088] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0089] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0090] This step amplifies the pUC19 plasmid backbone, including the replication origin, the lacZα gene, the ampicillin resistance gene, and other nonsense sequences. The amplified fragment will lose some promoter sequences after self-ligation in the host, silencing the lacZα gene and facilitating subsequent screening for promoter mutations.

[0091] After PCR amplification, the template is digested with Dpn I, the product is purified and recovered, and then transformed into the DH5α strain. Subsequently, the transformed bacterial solution is spread on LB plates containing Amp (50 ug / ml), IPTG (0.5 mM), and X-Gal (0.04 mg / ml). The next day, the colonies are distinguished based on their phenotype. Colonies that do not develop color are those containing the p-PS1 plasmid. The plasmid can be extracted from these colonies to obtain the p-PS1 plasmid. If the promoter is not inactivated, then under IPTG induction, LacZα on the plasmid will be expressed normally and will combine with lacZω in the genome to form an active galactosidase. A blue color will appear on the plate, so picking a colony that does not develop color at this time indicates that the promoter has been partially inactivated.

[0092] Example 2 Construction of screening plasmid p-PS2

[0093] For some engineered strains, especially those modified with genes related to gene synthesis or plasmid replication, the engineered strain can be used directly as a chassis for library construction. This allows for direct library construction and screening of promoters in the engineered strain, which can then be used to regulate gene expression in the engineered strain. This results in more consistent and accurate results. In this case, a plasmid, p-PS2, carrying the complete β-galactosidase gene is constructed, with its promoter inactivated, thus silencing the gene.

[0094] In order to construct the p-PS2 plasmid, the p-PS1 plasmid needs to be recombined.

[0095] 2.1. Use p-PS1 as a template for amplification to obtain the vector backbone of p-PS2.

[0096] The upstream and downstream primers used were

[0097] PS2-zt-F:ttaagccagccccgacac(SEQ ID NO:3)

[0098] PS2-zt-R:agctgtttcctgtgtgaaattgtt(SEQ ID NO:4)

[0099] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0100] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 2 minutes (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0101] After nucleic acid electrophoresis verification, a 2300 bp band was amplified. After the template was digested with DpnⅠ, it was recovered using a PCR purification kit and set aside.

[0102] 2.2. The genome of Escherichia coli W3110 (purchased from Beina Chuanglian Biotechnology Co., Ltd.) was used as a template for amplification to obtain a fragment of the complete lacZ gene.

[0103] The upstream and downstream primers used were:

[0104] PS2-pd-F:acacaggaaacagctatgaccatgattacggattcac(SEQ ID NO:5)

[0105] PS2-pd-R:tcggggctggcttaattatttttgacaccagaccaactgg(SEQ ID NO:6)

[0106] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0107] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 2 minutes (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0108] After nucleic acid electrophoresis verification, a 3075 bp band was amplified. After the template was digested with DpnⅠ, it was recovered using a PCR purification kit and set aside.

[0109] 2.3. The vector obtained in step 2.1 and the fragment obtained in step 2.2 were cloned using the C112 kit. The transformed bacterial solution was then spread on an LB plate containing Amp (50 μg / ml).

[0110] The next day, amplification is performed using bacterial P verification primers to verify that the vector and target fragment have been successfully connected. If the target fragment is successfully connected, the amplified sequence will be: partial vector sequence + fragment sequence + partial vector sequence; the length is 3406bp. If the connection is not complete, the amplified sequence will be: partial vector sequence + partial vector sequence, the length is 324bp. The length of the obtained fragment can be used to determine whether the selected colony contains a successfully connected plasmid. The strain containing the correct plasmid can then be cultured and the plasmid can be extracted to obtain the required p-PS2 plasmid.

[0111] The validation primers used were:

[0112] PS-yz-F:tattaccgcctttgagtgag(SEQ ID NO:7)

[0113] PS-yz-R:gcttgtctgtaagcggatgc(SEQ ID NO:8)

[0114] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0115] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 3 minutes (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0116] The colonies corresponding to the PCR product with a band of 3406 bp contain p-PS2. Plasmids are extracted from these colonies to obtain p-PS2 plasmids.

[0117] Example 3 Control Plasmid Initial Screening

[0118] In order to facilitate the initial and secondary screening of the promoters obtained from the library, a plasmid containing the M1-37 promoter is required as a control plasmid. The construction steps of the control plasmid are as follows:

[0119] The primers are:

[0120] pDZ-F:

[0121] AACGTTGATATAATTGAGCCACTGGCTCGTAATTTATTGTTTAAA CCAGGAAACAGCT(SEQ IDNO:24)

[0122] p-JK-R:

[0123] GGCTCAATTATATCAACGTTGTTATCTCTTGTCAACACCGCCAGAGATAAAGTCGGGAAACCTGTCGTGC (SEQ ID NO: 11)

[0124] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template (plasmid p-PS1) 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0125] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0126] The PCR product was purified and recovered, then transformed into the DH5α strain and plated onto LB plates containing Amp (50 μg / ml), IPTG (0.5 mM), and X-Gal (0.04 mg / ml). The phenotype of the colonies was recorded the next day for differentiation. Colored colonies indicate successful mutations, i.e., strains harboring the M1-37 promoter control plasmid, which contains the β-galactosidase α fragment gene and the pM1-37 promoter. This strain serves as a control group for initial and secondary screening of pM1-37 promoter mutants with relatively high, medium, and low strengths.

[0127] Example 4: Initial screening of library construction in DH5α strain using p-PS1 plasmid

[0128] In the existing practice of promoter library construction and screening, common commercial base bacteria, such as DH5α, BL21 and Top10, are mainly relied on. These base bacteria have shown significant promoter strength in screening, which can basically represent the effect of most engineered strains. In particular, the p-PS1 plasmid constructed by the present invention has unique applicability for base bacteria containing the lacZω genome, such as DH5α strains. This is because the lacZα carried by the p-PS1 plasmid is derived from the commercial vector pUC19, which needs to synergize with the lacZω of the strain to form active lacZ (galactosidase) to activate its catalytic activity, thereby achieving efficient promoter screening.

[0129] The library can be constructed by performing inverse PCR on plasmid p-PS1 using primers containing degenerate sequences.

[0130] In the present invention, the commonly used promoter pM1-37 was taken as an example, and a library was constructed by mutating some bases based on the pM1-37 promoter.

[0131] The complete sequence of pM1-37 is as follows. The underlined base sequence is the conserved sequence of the promoter, and the wavy sequence is the ribosome binding site (RBS sequence):

[0132] TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATT GAGCCACTGGCTCGTAATTTATTGTTTAAACCAGGAAACAGCT(SEQ ID NO:9)

[0133] To ensure that most of the promoters obtained from the library remain valid and to ensure screening efficiency, the present invention maintains the conserved sequence of the promoter unchanged. Furthermore, given that the present invention is a high-throughput screening, the present invention selects a wider range of mutated bases to obtain more possibilities. Therefore, the present invention selects 18 bases for mutation, while the existing technology is limited by screening efficiency and often selects bases 4-8 for mutation. The upstream and downstream primers used are:

[0134] p-JK-F:

[0135] AACGTTGATATAATTGAGCCNNNNNNNNNNNNNNNNGTTTA AACCAGGAAACAGCT(SEQ IDNO:10)

[0136] p-JK-R:

[0137] GGCTCAATTATATCAACGTTGTTATCTCTTGTCAACACCGCCAGAGATAAAGTCGGGAAACCTGTCGTGC (SEQ ID NO: 11)

[0138] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template (plasmid p-PS1) 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and distilled water to 50 μl.

[0139] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0140] After purification and recovery of the PCR product, transform it into the DH5α strain and plate it onto LB plates containing Amp (50 μg / ml), IPTG (0.5 mM), and X-Gal (0.04 mg / ml). The next day, isolate the colonies based on their phenotype. Colonies that develop color are considered to have successfully mutated and contain a valid promoter plasmid. Select desired colonies based on the degree of color development for rescreening.

[0141] Example 5: Preliminary screening of library construction in engineered strains using p-PS2 plasmids

[0142] The p-PS2 plasmid contains a complete β-galactosidase gene. After library construction, its reporter gene, β-galactosidase, is activated and expressed. Notably, no additional IPTG is required to activate the reporter gene. Given that the β-galactosidase in the chassis strain genome requires IPTG for induction, if IPTG is not added, the β-galactosidase in the chassis strain genome is not expressed. Therefore, the detected enzyme activity is that of the β-galactosidase expressed on the plasmid. This effectively avoids interference from the β-galactosidase in the chassis strain genome, thereby ensuring the accuracy of the test results and accurately detecting only the β-galactosidase expressed on the plasmid.

[0143] The library can be constructed by performing inverse PCR on plasmid p-PS2 using primers containing degenerate sequences.

[0144] The upstream and downstream primers used were:

[0145] p-JK-F:

[0146] AACGTTGATATAATTGAGCCNNNNNNNNNNNNNNNNCAGGA AACAGCTATGACCAT(SEQ IDNO:10)

[0147] p-JK-R:

[0148] GGCTCAATTATATCAACGTTGTTATCTCTTGTCAACACCGCCAGAGATAAAGTCGGGAAACCTGTCGTGC (SEQ ID NO: 11)

[0149] The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each dNTP) 1 μl, DNA template (plasmid p-PS2) 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA polymerase (2.5 U / μl) 1 μl, and dilute to 50 μl with distilled water.

[0150] Amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 1 minute (35 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0151] After purification and recovery, the PCR product was transformed into an inositol-producing strain (Cultural Accession Number: CCTCC NO: M20221796, described in CN 116286923 A). The strain was then plated onto LB plates containing Amp (50 μg / ml) and X-Gal (0.04 mg / ml). The next day, colonies were identified based on their phenotype. Colonies that developed color were considered to have successfully mutated and contained a valid promoter plasmid. Select desired colonies based on the degree of color development for rescreening.

[0152] Example 6: Multiple screening by β-galactosidase activity assay

[0153] The existing blue-white screening method is to mutate from a colored state to a non-colored state, while the present invention is to mutate from a non-colored state to a colored state. Therefore, the existing technology cannot judge the intensity by color to screen the promoter, while the present invention can screen out promoters with high or low intensity by the depth of color, which greatly improves the screening efficiency and brings great convenience to the screening of promoters.

[0154] β-galactosidase can catalyze a variety of substrates and produce a distinct color reaction, allowing researchers to visually observe and monitor its activity. Therefore, it is widely used as a reporter gene. Commonly used chromogenic substrates for β-galactosidase are X-gal and ONPG. Active β-galactosidase can cleave the substrate X-gal into galactose and the dark blue substance 5-bromo-4-indigo, causing the colonies to appear blue. Therefore, the culture medium of a strain expressing β-galactosidase is mixed with the substrate X-gal, and the expression strength of the promoter can be determined by the shade of blue in the reaction solution (the darker the blue, the higher the promoter strength, and the lighter the yellow, the lower the strength). Active β-galactosidase can also generate o-nitrophenol (a yellow product) by decomposing ONPG. Therefore, the culture medium of a strain expressing β-galactosidase is mixed with the substrate ONPG, and the expression strength of the promoter can be determined by the shade of yellow in the reaction solution (the darker the yellow, the higher the promoter strength, and the lighter the yellow, the lower the strength). Therefore, X-gal or ONPG can be used as a chromogenic substrate for rescreening.

[0155] When ONPG is used as a chromogenic substrate, perform a double screening of promoters with the required strength.

[0156] Prepare the solutions to be used:

[0157] 1. Preparation of phosphate buffer: First, weigh 3.8 g of potassium dihydrogen phosphate, 16.4 g of dipotassium hydrogen phosphate trihydrate, 0.25 g of magnesium sulfate heptahydrate, and 18.6 mg of EDTA dihydrate. Dissolve these compounds in 900 ml of water. Then, adjust the pH to 7.30 ± 0.05 using 1 mol / L hydrochloric acid or sodium hydroxide solution. Finally, dilute the solution to 1000 ml with deionized water and shake thoroughly.

[0158] 2. Preparation of ONPG substrate solution: Dissolve 250.0 mg of o-nitrophenyl-β-D-galactoside (ONPG) in approximately 80 ml of phosphate buffered saline. Then, dilute the solution to 100 ml with phosphate buffered saline and shake thoroughly. Note: The ONPG substrate solution must be prepared within 2 hours of each use.

[0159] 3. Preparation of Sodium Carbonate Solution: First, dissolve 50g of sodium carbonate and 37.2g of EDTA dihydrate in approximately 900ml of deionized water. Then, dilute the solution to 1000ml with deionized water and shake thoroughly. The sodium carbonate solution stops the enzyme reaction, thus controlling the reaction time.

[0160] 4. Preparation of o-nitrophenol standard stock solution: Weigh 139.0 mg of o-nitrophenol and dissolve it in 10 ml of 96% ethanol. Then, dilute the solution to 1000 ml with deionized water and shake thoroughly.

[0161] Based on the expression requirements of key enzymes in metabolic engineering and the verification of expression strength, the original pM1-37 promoter is a moderate-strength promoter. Therefore, in this example, the color development of each colony was visually observed and compared with the control group: those with a darker color than the control group were initially identified as high-strength pM1-37 promoter mutants; those with a color close to the control group were initially identified as moderate-strength pM1-37 promoter mutants; and those with a lighter color in the control group were initially identified as low-strength pM1-37 promoter mutants.

[0162] Taking the strains initially screened in Example 3 as an example, promoters of target strength were obtained through secondary screening.

[0163] 6.1. Screening of promoters with higher expression intensity

[0164] In this study, the inventors focused on finding promoters with stronger expression. To achieve this goal, they paid special attention to colonies with darker colors, as these usually represent higher expression levels.

[0165] First, the colonies that are darker than the control bacteria in the initial screening are picked out one by one and inoculated into a 96-deep-well plate pre-filled with 1 ml of LB medium. The purpose of this is to ensure that the colonies grow under optimal conditions. The 96-deep-well plate is then placed in a high-speed shaking incubator at a temperature of 37°C and a speed of 700 rpm for 16 hours. During this period, the colonies of each strain will grow fully, so that the density and optical density (OD value) of the colonies gradually converge. Under experimental conditions, the OD600 of the cultured strain is 0.36±0.15.

[0166] After the incubation period, we precisely pipetted 32 μl of bacterial culture from the 96-deep-well plate and transferred it to another clear 96-well plate. This facilitated subsequent optical density measurements and facilitated observation of bacterial growth. We then added 156 μl of ONPG substrate solution to each well to ensure optimal reaction with the bacterial colonies.

[0167] Next, the 96-well plate is incubated at 37°C for 10 minutes. During this brief period, a series of biochemical reactions occur between the bacterial colonies and the substrate. These reactions help us understand the enzymatic activity of the bacterial colonies.

[0168] After the reaction is complete, quickly add 62 μl of sodium carbonate mixture to each well. The role of sodium carbonate is to neutralize any acidic substances that may be produced and maintain the stability of the reaction environment.

[0169] Finally, the 96-well plate was placed in a microplate reader and the detection wavelength was set to 420 nm. At this wavelength, differences in absorbance directly reflect the enzyme activity of the colonies. This series of steps accurately quantifies the enzyme activity of each colony. Six promoters with high activity were identified through comparison. Their relative activities are shown in Table 1.

[0170] Table 1: Relative activities of six highly active promoters

[0171]

[0172]

[0173] The original promoter pM1-37 was determined using the same method and the result was 0.38.

[0174] The strength of the enzyme activity reflects the strength of the promoter, so the plasmids in these strains with higher activity were sequenced.

[0175] The corresponding plasmids were sequenced to obtain the sequences of these promoters at the degenerate primers, as shown in Table 2.

[0176] Table 2: Sequences of 6 highly active promoters at degenerate primers

[0177]

[0178] Table 3: Full sequences of 6 promoters with high activity

[0179]

[0180]

[0181] According to the aforementioned primary screening criteria for promoters with low and medium expression strengths and referring to the secondary screening steps of "6.1. Screening promoters with higher expression strengths", promoters with moderate and weak expression strengths can also be screened.

[0182] 6.2. Screening of promoters with moderate expression strength

[0183] Colonies with color development close to that of the control bacteria were selected one by one and rescreened according to step 6.1. After comparison, 6 promoters with moderate activity were obtained. Their relative activities are shown in Table 4.

[0184] Table 4: Relative activities of six moderately active promoters

[0185]

[0186]

[0187] 6.3. Screening promoters with lower expression intensity

[0188] Colonies with color development close to that of the control bacteria were selected one by one and rescreened according to step 6.1. After comparison, four promoters with lower activity were obtained. Their relative activities are shown in Table 5.

[0189] Table 5: Relative activities of four less active promoters

[0190] strain Relative activity L-1 0.356 L-2 0.350 L-3 0.350 L-4 0.350

[0191] When X-gal is used as a chromogenic substrate, promoter rescreening is performed: this rescreening method is the same as the 96-deep-well plate culture step for the initial screening of colonies using ONPG as a chromogenic substrate. After the culture is completed, 32ul of bacterial solution is accurately aspirated from the 96-deep-well plate, transferred to another transparent 96-well plate, and then 156μl of X-gal substrate solution (X-gal concentration is 640mg / L) is added to each well. The 96-well plate is placed at a constant temperature of 37°C and reacted for 1.5h. After the reaction is completed, the 96-well plate is placed in a microplate reader and the detection wavelength is set to 630nm. Similarly, at this wavelength, the difference in absorbance directly reflects the enzyme activity level of the colony. Through this series of steps, the enzyme activity value of each colony can be accurately quantified.

[0192] Example 7 Detection of the Relevance of the Promoters Obtained in the Present Invention

[0193] The promoter in CN116286923A has been confirmed by fermentation. The present invention is an improvement on the method of CN116286923A. To avoid duplicate work, a promoter library was reconstructed in the present invention. 192 samples were tested. According to the promoter strength grading method described in Example 6, three grades of promoters with high, medium, and low expression intensities were initially screened out. The enzyme activity intensities of these 192 samples in the rescreening step were sorted. In this example, three samples with the largest values and strong initial screening observation results were selected as H-1, H-2, and H-3; three samples with the smallest values and weak initial screening observation results were selected as L-1, L-2, and L-3; three samples with values slightly smaller than the control group and medium initial screening observation results were selected as M-1, M-2, and M-3. The relative activity data measured in the rescreening are shown in the following table. The relative intensity of the control group is 0.510. Then, the method of CN116286923A was used for retesting. The correlation between the promoter activity measured by the method of the present invention and that measured by the method of CN116286923A is very good (due to differences in the system and dilution factor, the relative activities are different). [[ID=!

[0194] Table 6: Relative Promoter Activities Measured by the Method of the Present Invention and by the Method of CN116286923A

[0195]

[0196] The Pearson correlation coefficient r of the data obtained by the two measurement methods is 0.96, which satisfies 0.5 < r < 1, indicating a positive correlation and a strong correlation. It can be seen that the promoter screening method of the present invention has high throughput, high screening efficiency, and high accuracy.

[0197] The specific embodiments described above further elaborate on the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A plasmid for screening promoters, characterized in that: The plasmid comprises a beta-galactosidase gene, a promoter of the beta-galactosidase gene is inactivated, and the beta-galactosidase gene is a lacZ or lacZα gene.

2. The plasmid according to claim 1, characterized in that The plasmid further comprises a resistance gene, optionally, the resistance gene is selected from the group consisting of ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, spectinomycin resistance gene, tetracycline resistance gene, streptomycin resistance gene, hygromycin resistance gene, gentamicin resistance gene and erythromycin resistance gene.

3. The plasmid according to claim 1 or 2, characterized in that The inactivation of the promoter is deletion, addition, or replacement of the promoter sequence.

4. A method for constructing a promoter library, characterized in that: The method comprises: a. Designing reverse PCR primers for the original sequence of the promoter to be screened, wherein the primers contain a degenerate sequence of multiple bases; b. Perform inverse PCR using the plasmid according to any one of claims 1 to 3 as a template to obtain a library of promoters to be screened.

5. The method according to claim 4, characterized in that The primers are degenerate sequences containing 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases, preferably a degenerate sequence containing 18 bases. Optionally, the bases of the degenerate sequence are outside the conserved sequence of the promoter to be screened.

6. A high-throughput promoter screening method, characterized in that: The method comprises the following steps: S1. Preliminary screening: Preliminary screening of strains containing target promoters from the promoter library obtained by the method according to any one of claims 4-5 based on the degree of color development by blue-white screening; S2, rescreening: culture the strains screened initially using deep-well plates; After the culture is completed, part of the bacterial liquid is transferred to a transparent well plate and a colorimetric substrate of β-galactosidase is added for reaction. The promoter strength is judged by the color depth. The strain containing the promoter of the required strength is sequenced to obtain the promoter of the desired strength. Optionally, the culture of the initially screened strain is terminated after reaching the plateau phase; Optionally, the chromogenic substrate is ONPG or X-gal; Optionally, when the chromogenic substrate is ONPG, step S2 is specifically: S21, transferring part of the bacterial solution after the culture to a transparent well plate, and then adding the substrate ONPG for reaction; S22, adding sodium carbonate solution to the wells of the transparent well plate to terminate the reaction; S23. Determine the strength of the promoter based on the depth of the yellow color. Sequence the strain containing the promoter of the desired strength to obtain the promoter of the desired strength. Optionally, when the color-developing substrate is X-gal, step S2 specifically comprises: transferring part of the bacterial solution after the culture is completed to a transparent well plate, and then adding the substrate X-gal to react; after the reaction is completed, the promoter strength is judged according to the depth of the blue color, and the strain containing the promoter of the required strength is sequenced to obtain the promoter of the desired strength.

7. The method according to claim 6, characterized in that Step S1 comprises: transforming the library of promoters to be screened into a strain, and then adding X-gal to screen and culture the strain; if the plasmid used is a plasmid including the lacZα gene, the strain must contain the lacZω gene, and IPTG must also be added during the screening culture.

8. The method according to claim 6, characterized in that The method further comprises placing the transparent well plate in a microplate reader, detecting the absorbance value of each well to reflect the enzyme activity level of the colony; screening the target colony according to the absorbance value of each well, and obtaining the sequence of the target promoter by sequencing.

9. A promoter, characterized in that It is obtained or obtainable by the method according to any one of claims 6 to 8, optionally, the sequence of the promoter is shown in SEQ ID NO: 18-23, and the first 50 bases of the promoter are a common conserved sequence, and the last 12 bases are a common ribosome binding site.

10. Use of the promoter according to claim 9 in engineering strain construction, metabolite synthesis, gene expression regulation, or biosensor construction.

Images