System and method for screening Cas9 protein mutants

Abstract

The invention provides a system and a method for screening Cas protein mutants capable of identifying different PAM sequences, and belongs to the technical field of bioengineering. The system comprises a Cas protein mutant screening vector and an sgRNA expression vector, the Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon and a first resistance screening tag expression cassette; the sgRNA expression vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette and an sgRNA expression cassette. According to the system and the method, aiming at the problem that the efficiency of identifying PAM sequences except NGG by wild type spCas9 protein is low, an active Cas9 mutant capable of identifying PAM sites except NGG is screened out, and the application field and the editing efficiency of a CRISPR gene editing system can be greatly expanded.

Description

TECHNICAL FIELD

[0001] The application provides a system and method for screening Cas9 protein mutants capable of recognizing different PAM sequences, and belongs to the technical field of bioengineering. BACKGROUND

[0002] The programmability of the CRISPR-Cas system enables it to generate double-stranded DNA breaks at specific sites, thereby rapidly applying to genome editing. After Cas9 binds with a crRNA-tracrRNA complex or an sgRNA sequence, an active nuclease is formed. In order to accurately guide Cas9 nuclease to a specific position of a target genome, the 20 nucleotide sequence at the 5' end of the sgRNA can be modified, and this guide sequence is responsible for specific base pairing with the target region of DNA. In addition, the recognition of the target region also requires a short protospacer adjacent motif (PAM) on the non-target strand of DNA as an auxiliary. The recognition of PAM leads to local unwinding of the target DNA, and the guide sgRNA pairs with the target DNA from the PAM proximal end of the target site, triggering the conformational change of Cas9, resulting in the activation of the nuclease domain.

[0003] The CRISPR / Cas9-based gene editing system is a powerful gene manipulation tool, but its recognition and cutting of DNA depend on the PAM sequence, resulting in a limited targeting range of the genome target site with PAM sequences on both sides. SpCas9 is the most widely used genome editing nuclease at present, and it has a high recognition efficiency for PAM sites of the NGG type, but a very low recognition efficiency for PAM sites of ATT, ACG, etc. Although theoretically an average of every 8 nucleotides can find a suitable NGG target site, due to the high A / T content of some genome regions, it is difficult for SpCas9 to achieve targeted editing.

[0004] Expanding the recognizable PAM sites can further expand the efficiency and application scenarios of the gene editing system. Therefore, constructing a Cas9 protein screening system capable of recognizing different PAM sites and screening Cas9 protein mutants capable of recognizing different PAM sites can greatly expand the application scenarios of CRISPR genome editing. SUMMARY

[0005] In view of the shortcoming that the wild-type spCas9 protein can only recognize the NGG PAM sequence, the application provides a system and method for screening Cas9 protein mutants capable of recognizing different PAM sequences. The system utilizes the cleavage ability of Cas protein and the recombination ability of the strain to screen active Cas9 mutants capable of recognizing PAM sites other than NGG. The system and method can be applied to the screening of Cas9 protein in the CRISPR gene editing system. By using the method, Cas9 mutants capable of recognizing PAM sites other than NGG can be obtained, thereby expanding the application field and editing efficiency of the CRISPR gene editing system. In order to achieve the above purpose, the application provides the following technical solutions:

[0006] One of the technical solutions provided by the application is a Cas protein mutant screening system, which comprises a Cas protein mutant screening vector and an sgRNA expression vector.

[0007] The Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon, and a first resistance screening tag expression cassette; and the sgRNA expression vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette, and an sgRNA expression frame.

[0008] Further, the Cas protein coding gene on the Cas protein mutant screening vector can be the coding gene of a wild-type Cas9 (spCas9), or the coding gene of a variant of spCas9, such as spG, spRY, superFI-Cas9, etc. Preferably, the Cas protein coding gene is spCas9 as shown in SEQ ID NO. 1.

[0009] Further, the plasmid replicon on the Cas protein mutant screening vector is used to regulate the replication of the Cas protein mutant screening vector in cells. Any replicon having the above function can be used in the application, including but not limited to pBR322, pUC, p15A, pColEI, pColA, pSC101, etc. In the application, the p15A replicon as shown in SEQ ID NO. 2 is preferred.

[0010] Further, the first resistance screening tag expression cassette on the Cas protein mutant screening vector comprises a first resistance screening tag. The first resistance screening tag can be any resistance gene, including but not limited to ampicillin, spectinomycin, chloramphenicol, kanamycin, tetracycline, etc. In the application, the chloramphenicol resistance gene is preferred. The first resistance screening tag expression cassette further comprises elements such as a promoter and a terminator for expressing the first resistance screening tag.

[0011] Preferably, a Cas protein mutant screening vector pvCas-pre containing a p15A replicon, a spCas9 coding gene shown in SEQ ID NO. 1 and a chloramphenicol resistance (CmR) coding gene is constructed, and the nucleotide sequence is shown in SEQ ID NO. 3;

[0012] Further, on the sgRNA expression vector, the replicon is used to regulate the replication of the sgRNA expression vector in cells, and any replicon having the above functions can be used in the present application, including but not limited to pBR322, pUC, p15A, pColEI, pColA, pSC101 and the like; the replicon is compatible with the replicon in the Cas protein mutant screening vector; and in the present application, the pBR322 replicon shown in SEQ ID NO. 4 is preferred;

[0013] Further, on the sgRNA expression vector, the second resistance screening tag expression cassette contains a second resistance screening tag, and the third resistance screening tag expression cassette contains a third resistance screening tag, the second resistance screening tag and the third resistance screening tag are any two different resistance genes, and are different from the first resistance gene in the Cas protein mutant screening vector; the second resistance screening tag expression cassette further contains a promoter, a terminator and the like for expressing the second resistance screening tag; and the third resistance screening tag expression cassette further contains a promoter, a terminator and the like for expressing the third resistance screening tag;

[0014] Further, an insertion sequence is added to the third resistance screening tag to inactivate it, the insertion sequence comprising a 23bp exogenous sequence that can be recognized and a homologous sequence upstream of the insertion site of the third resistance screening tag; the insertion site refers to the insertion site of the 23bp exogenous sequence on the third resistance screening tag gene, which can be any site that can inactivate the third resistance screening tag gene after insertion; the 23bp exogenous sequence comprises a 20bp recognition sequence and a 3bp PAM, the 20bp recognition sequence can be any exogenous sequence that can be efficiently recognized by CRISPR / Cas9; the PAM is a protospacer adjacent motif, which is a conserved sequence adjacent to the 5' end or 3' end of the protospacer sequence, and the PAM can be arbitrarily set according to the target to be screened, and in the present application, the PAM sequence includes but is not limited to AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, ATA, ATC, ATG, ATT, CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CTA, CTC, CTG, CTT, GAA, GAC, GAG, GAT, GCA, GCC, GCG, GCT, GTA, GTC, GTG, GTT, TAA, TAC, TAG, TAT, TCA, TCC, TCG, TCT, TTA, TTC, TTG, TTT, and NGG (wherein N can be any one of A, T, C, G); in the present application, ATT is preferred;

[0015] Further, on the sgRNA expression vector, the sgRNA expression frame comprises an sgRNA backbone sequence, an N20 sequence, a promoter and a terminator for expressing sgRNA;

[0016] Further, the sgRNA backbone sequence can be any sgRNA backbone sequence in the art; in the present application, the sequence shown as SEQ ID NO. 5 is preferred: GTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG;

[0017] Further, the N20 sequence is identical to the 20bp recognition sequence inserted in the third resistance screening tag;

[0018] Further, on the sgRNA expression vector, the promoter and the terminator for expressing sgRNA can be any commonly used promoter and terminator in the art, including but not limited to J23119, J23110, J23101, J23100, J23102, T1, T2, Tf, TtrpA, etc., and in the present application, the promoter J23119 shown as SEQ ID NO. 6 and the terminator T1 shown as SEQ ID NO. 7 are preferred.

[0019] The second technical solution provided by the application is a method for constructing a Cas protein mutation library, which uses the Cas protein mutant screening vector in the first technical solution as a template, introduces random mutations to the Cas protein on the template by designing a mutation primer, and thereby constructs a Cas protein mutation library.

[0020] Further, the mutation primer comprises a homologous sequence of the Cas protein mutant screening vector, which is used to introduce the Cas protein mutant sequence on the screening vector by homologous recombination.

[0021] Further, the mutation primer used in the mutation region of the Cas protein is a degenerate primer, and the bases in the mutation region are set as N, which can be any one of A, T, C and G. The region that does not need to be mutated is the same as the DNA sequence of the wild-type Cas protein sequence.

[0022] Further, the mutation region of the Cas9 protein encoded by SEQ ID NO. 1 is divided into two regions, and at least one of the two regions is mutated to construct a mutation library.

[0023] Region 1 is the 1099th to 1148th amino acid part of the Cas9 protein encoded by SEQ ID NO. 1.

[0024] Region 2 is the 1291st to 1306th amino acid part of the Cas9 protein encoded by SEQ ID NO. 1.

[0025] The third technical solution provided by the application is a method for screening a Cas protein mutant, which comprises the following steps: transforming the Cas protein mutation library constructed in the second technical solution and the sgRNA skeleton expression vector constructed in the first technical solution into E. coli respectively, and culturing them on a screening medium containing a third resistance screening label. The Cas protein mutant sequence contained in the normally growing strain is a Cas protein mutant that can recognize the corresponding PAM and has activity. Preferably, the screening medium is an LB plate containing a third resistance screening label.

[0026] The fourth technical solution provided by the application is a Cas protein mutant screened by the method in the third technical solution.

[0027] Further, the Cas protein mutant includes but is not limited to the following sequences:

[0028]

[0029]

[0030] The fifth technical solution provided by the present invention is the application of the Cas protein mutant described in the fourth technical solution;

[0031] Furthermore, it is the application in the CRISPR / Cas9 gene editing system, and further, includes but is not limited to applications in base editing, single gene target editing, multi-gene target editing, such as lead editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, multi-gene transcriptional regulation, etc.

[0032] Beneficial effects:

[0033] To address the low efficiency of wild-type Cas9 proteins in recognizing PAM sites other than NGG, the present invention provides a system and method for screening Cas9 protein mutant sequences that can recognize a wider range of PAM sites. The system utilizes the cleavage ability of Cas proteins and the recombination capacity of bacterial strains to screen for Cas9 protein mutants that can recognize a wider range of PAM sites, including NGG. The system and method can be applied to screening Cas9 proteins in the CRISPR gene editing system. Using this method, Cas9 protein mutants that can recognize any PAM site can be obtained, expanding the application of CRISPR gene editing systems.

[0034] The Cas9 protein mutant sequences screened by the present invention were used to test their ability to recognize targets with PAM sequences as ATT. Compared with the wild type, the ATT recognition activity of the Cas9-M1 protein mutant was 155.86% higher than that of the wild type, and the ATT recognition activity of the Cas9-M2 protein mutant was 994.97% higher than that of the wild type, indicating that the system can realize the screening of Cas9 protein mutants that recognize specific PAM sequences. Description of the drawings:

[0035] Figure 1 Schematic diagram of the psgRNA-Kn-ATT vector.

[0036] Figure 2 Schematic diagram of the pvCas-pre vector.

[0037] Figure 3 Schematic diagram of the mutation region of Cas9 protein.

[0038] Figure 4 Cas9 protein mutant screening process.

[0039] Figure 5 Efficiency of Cas9 protein mutants in recognizing the ATT PAM sequence. Specific implementation method:

[0040] Before particular embodiments of the present application are described, it is to be understood that the application is not limited to the particular specific embodiments described below; it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting as to the scope of the present application.

[0041] Unless otherwise defined, all experimental methods, procedures, and techniques disclosed in the present application are carried out using conventional molecular biology, biochemistry, cell biology, recombinant DNA techniques, and related arts, which are well known in the art and are described in the current literature.

[0042] The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0043] The following examples are a detailed description and explanation of the technical solutions of the present application and do not limit the present application.

[0044] The CRISPR / Cas9 system comprises two important elements, Cas9 protein and sgRNA. After the Cas9 protein forms a complex with the sgRNA sequence, it will search for the PAM site of NGG on the genome and bind to the target. However, some specific genomic regions cannot find the PAM sequence of NGG, so that the genome cannot be modified. The Cas protein sequence that can recognize the PAM sequence as non-NGG can broaden the editing range of the CRISPR / Cas9 system, so that it can be edited at any site, the genome is modified, and is no longer limited by the specific PAM sequence, further expanding its application in the field of biotechnology.

[0045] The present application first provides a system and method for screening Cas9 protein mutants that can recognize different PAM sequences, wherein the system comprises a Cas protein mutant screening vector and an sgRNA expression vector.

[0046] 1. Cas protein mutant screening vector

[0047] The Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon, and a first resistance screening tag expression cassette.

[0048] Further, the Cas protein coding gene can be the coding gene of wild-type Cas9 (spCas9), or the coding gene of a spCas9 variant, such as spG, spRY, superFI-Cas9, etc.; preferably, the Cas protein coding gene is spCas9 as shown in SEQ ID NO. 1.

[0049] Further, the plasmid replicon is used to regulate the replication of the Cas protein mutant screening vector in cells, and any replicon with the above functions can be used in the present application, such as the commonly used pBR322, pUC, p15A, pColEI, pColA, pSC101 replicons, and the p15A replicon shown in SEQ ID NO. 2 is preferred in the present application;

[0050] Further, the first resistance screening tag expression cassette comprises a first resistance screening tag, which is used for screening in the construction process of the Cas protein mutant screening vector and screening of cells containing the vector, and can be any resistance gene, such as the commonly used ampicillin, spectinomycin, chloramphenicol, kanamycin, tetracycline, etc. In the present application, the chloramphenicol resistance gene is preferred; the first resistance screening tag expression cassette further comprises a promoter, terminator and other elements for expressing the first resistance screening tag;

[0051] Preferably, the Cas protein mutant screening vector pvCas-pre comprising the p15A replicon, the spCas9 coding gene shown in SEQ ID NO. 1 and the chloramphenicol resistance (CmR) coding gene is constructed, and the vector structure is shown in Figure 2 The nucleotide sequence is shown in SEQ ID NO. 3.

[0052] 2. sgRNA expression vector

[0053] The sgRNA expression vector comprises the following expression elements: a replication initiation site, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette, and an sgRNA expression frame;

[0054] Further, the replicon is used to regulate the replication of the sgRNA expression vector in cells, and any replicon with the above functions can be used in the present application, such as the commonly used pBR322, pUC, p15A, pColEI, pColA, pSC101 replicons, but it is necessary to ensure that the replicon and the Cas9 protein mutant screening vector can exist stably in a cell at the same time; the pBR322 replicon shown in SEQ ID NO. 4 is preferred in the present application;

[0055] Further, the second resistance screening tag expression cassette comprises a second resistance screening tag, and the third resistance screening tag expression cassette comprises a third resistance screening tag, the second and third resistance screening tags are any two different resistance genes, and are different from the first resistance gene in the Cas9 protein mutant screening vector; the second resistance screening tag expression cassette further comprises a promoter, a terminator and other elements for expressing the second resistance screening tag; the third resistance screening tag expression cassette further comprises a promoter, a terminator and other elements for expressing the third resistance screening tag;

[0056] The second resistance screening tag is used for screening in the process of constructing the sgRNA expression vector and screening the cells containing the vector finally.

[0057] The third resistance screening tag is inactivated by adding an insertion sequence, and is used for screening the Cas protein mutant sequence subsequently, the insertion sequence comprises a 23bp exogenous sequence which can be recognized and a homologous sequence upstream of an insertion site of the third resistance screening tag, the insertion site refers to the insertion site of the 23bp exogenous sequence on the third resistance screening tag gene, and the site can be any site which can inactivate the third resistance screening tag gene after insertion; the 23bp exogenous sequence comprises a 20bp recognition sequence and a 3bp PAM, the 20bp recognition sequence can be any exogenous sequence which can be recognized by the CRISPR / Cas9 efficiently, the PAM is a protospacer adjacent motif, which is a conserved sequence close to the 5' end or 3' end of the protospacer, and the PAM sequence can be set arbitrarily according to the target to be screened, and in the application, the PAM sequence includes but is not limited to AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, ATA, ATC, ATG, ATT, CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CTA, CTC, CTG, CTT, GAA, GAC, GAG, GAT, GCA, GCC, GCG, GCT, GTA, GTC, GTG, GTT, TAA, TAC, TAG, TAT, TCA, TCC, TCG, TCT, TTA, TTC, TTG, TTT and NGG (wherein N can be any one of A, T, C and G); in the application, ATT is preferred. If the Cas protein which can recognize the PAM sequence as ATT is screened, the 3bp PAM in the insertion sequence is set as ATT; if the Cas protein which can recognize the PAM sequence as NGG is screened, the 3bp PAM in the insertion sequence is set as NGG, and so on.

[0058] The sgRNA expression frame on the vector comprises an sgRNA backbone sequence, an N20 sequence, a promoter and a terminator for expressing sgRNA; the sgRNA backbone sequence can be any sgRNA backbone sequence in the art; in the present application, the sequence shown as SEQ ID NO. 5 (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTG) is preferred; the N20 sequence is consistent with the 20-bp recognition sequence inserted in the third resistance screening tag, so as to facilitate the complementary pairing of the RNA sequence formed after transcription with the 20-bp recognition sequence, thereby guiding the Cas9 protein to the target site.

[0059] The promoter and the terminator for expressing sgRNA can be any promoter and terminator commonly used in the art, such as J23119, J23110, J23101, J23100, J23102, T1, T2, Tf, TtrpA, etc.; in the present application, the promoter J23119 shown as SEQ ID NO. 6 and the terminator T1 shown as SEQ ID NO. 7 are preferred.

[0060] In some embodiments of the present application, the sequence of the region required to be mutated in the Cas protein is designed on a mutation primer, and the mutation primer is introduced into the Cas protein mutant screening vector by homologous recombination, thereby constructing a Cas protein mutant screening library. The mutation primer comprises a homologous sequence to the Cas protein mutant screening vector, which is used to introduce the Cas mutation site in the screening vector by homologous recombination. The mutation primer sets the bases in the region required to be mutated in the Cas protein as N, and the region not required to be mutated is the same as the DNA sequence of the wild type, such as the sequence of spCas9.

[0061] In some embodiments of the present application, the Cas9 protein required to be mutated (encoded by SEQ ID NO. 1) is divided into two regions (the region division is shown as Figure 3 At least one of the two regions is mutated, thereby constructing a Cas9 protein mutant library. Among them,

[0062] Region 1 is the 1099th to 1148th amino acid part of the Cas9 protein;

[0063] Region 2 is the 1291st to 1306th amino acid part of the Cas9 protein.

[0064] The application also provides a screening method of Cas protein mutants, which comprises the following steps: transforming the constructed Cas protein mutant library and the sgRNA expression vector into E. coli respectively, and culturing in a screening medium containing a third resistance screening label, and the Cas protein mutant contained in the normally growing strain is an active Cas protein.

[0065] The principle of the above screening method is as follows: the active Cas9 protein mutant recognizing the specified PAM sequence can form a complex with sgRNA, and is combined to the recognition site under the guidance of sgRNA, and forms a ternary complex with the DNA sequence to activate the Cas9 protein nuclease activity. An exogenous 23bp sequence (including a 20bp target sequence and a 3bp PAM sequence to be recognized) that can be recognized by the Cas9 and sgRNA complex is inserted into the third resistance gene sequence in advance and is part of the sgRNA expression vector. When the active Cas9 and sgRNA form a complex, the Cas9 protein will recognize and cut the above-mentioned 23bp target sequence, and further cause the DNA of the third resistance gene sequence to produce a double-strand break. The E. coli has an endogenous recBCD-dependent gene repair system, and when a DNA double-strand break is generated in the bacterial body, the third resistance gene with the broken sequence can be restored after homologous sequence repair. The Cas9 protein mutant that cannot recognize the specified PAM sequence cannot be combined to the target sequence under the guidance of sgRNA, and cannot produce a double-strand break, so the third resistance gene coding sequence cannot be repaired, and the function of the third resistance gene cannot be restored. On this basis, the strain containing the active Cas9 protein can grow in the culture medium containing the third resistance, and the strain containing the inactive Cas9 protein mutant or the Cas9 protein mutant that cannot recognize the specified PAM sequence cannot grow.

[0066] The application also provides the application of the Cas9 protein mutant screened by the above screening method, especially in the CRISPR / Cas9 gene editing system, including but not limited to base editing, single gene target editing, multi-gene target editing, such as pilot editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, multi-gene transcription regulation, etc.

[0067] The application will be further explained and described in combination with specific embodiments.

[0068] Table 1 Part of the primers and sequences involved in the embodiments of the application

[0069]

[0070]

[0071] The application will be further explained and illustrated by specific examples below.

[0072] Example 1: Construction of sgRNA expression vector

[0073] This example is used to construct sgRNA expression vector in Cas9 protein mutant screening system, and the specific method is as follows:

[0074] 1. The experimental reagents used are as follows:

[0075] ① The primers are synthesized by Suzhou Jw Biosciences Co., Ltd. according to the conventional method;

[0076] ② High-fidelity DNA polymerase is purchased from Vazyme Company;

[0077] ③ Vector recombination kit Clone is purchased from Vazyme Company;

[0078] ④ DNA recovery kit is purchased from MEGA Company;

[0079] ⑤ Competent preparation reagent is purchased from Thermo Fisher Company;

[0080] ⑥ DNA sequencing service is provided by Suzhou Jw Biosciences Co., Ltd.;

[0081] ⑦ The formula of SOC culture medium is: 2% Tryptone, 0.5% Yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 20 mM Glucose.

[0082] 2. The experimental strains used are as follows:

[0083] JM109 strain is used as a molecular cloning host and cultured using LB medium.

[0084] 3. The specific method for constructing sgRNA expression vector with PAM sequence of ATT is as follows:

[0085] (1) Take the vector pBR322-TIMER (addgene, #103056) as the template, use primer 1 and primer 2 to amplify the replicon pBR322 and the gene coding sequence of the antibiotic ampicillin (AmpR) by PCR, the total PCR reaction system is 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 1, 2 μL primer 2 and 1 μL template pBR322-TIMER. The PCR program is: 98℃ 1 min, 56℃ 15 s, 72℃ 50 s, set 35 cycles, and obtain the DNA fragment pBR322-AmpR-Fragment.

[0086] (2) Take the vector pUC57-Kan (addgene, #121347) as the template, use primer 3 and primer 4 to amplify the gene sequence of the antibiotic kanamycin (Kan) by PCR, the total PCR reaction system is 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 3, 2 μL primer 4 and 1 μL template pUC57-Kan. The PCR program is: 98℃ 1 min, 56℃ 15 s, 72℃ 20 s, set 35 cycles, and obtain the DNA fragment KanR-Fragment.

[0087] (3) Run the DNA fragments obtained in steps (1) and (2) on the gel, verify whether the bands are correct, and recover the correct bands using a DNA purification kit. Then, link pBR322-AmpR-Fragment and KanR-Fragment, the connection system is generally prepared in 10 μL, the specific ratio is 1.5 μL KanR-Fragment and 3.5 μL pBR322-AmpR-Fragment, 5 μL Gibson Master Mix, mix well and place in a 50℃ water bath for 30 min. Transform the ligation product into 100 μL of commercial E. coli JM109 competent cells, ice bath for 20 min, 42℃ heat shock for 45 s, immediately placed on ice for 2 min, then immediately add 700 μL of SOC medium, recover at 37℃, 200 rpm on a shaker for 45 min. After centrifugation at 4000 rpm for 2 min, remove 500 μL of supernatant, evenly spread the remaining bacterial solution on an ampicillin-resistant plate, and incubate at 37℃ overnight. Pick single colonies, extract the vector and perform sequencing verification, and if the verification is correct, the expression vector psgRNA-K containing the replicon pBR322, the antibiotic ampicillin (AmpR) and the antibiotic kanamycin (Kan) gene sequence is successfully constructed.

[0088] (4) Introduce a 23 bp exogenous sequence which can be recognized and a homologous sequence upstream of the insertion site into the kan coding sequence (wherein the 23 bp exogenous sequence comprises a 20 bp N20 sequence (CCATCTAGCGATACACACCG) + a 3 bp ATT PAM sequence; the insertion site refers to the insertion site of the 23 bp exogenous sequence on the kan gene, which can be any site that can inactivate the kan gene after insertion; the homologous sequence upstream of the insertion site is not limited in length, as long as it can cause homologous recombination), the specific steps are as follows:

[0089] PCR amplification was performed using primer 5 and primer 6 with the vector psgRNA-K as a template, and the total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 5, 2 μL primer 6 and 1 μL template psgRNA-K. The PCR program was: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 10 s, 35 cycles were set, and a DNA fragment psgRNA-K-Fragment was obtained.

[0090] (5) The DNA fragment obtained in step (4) was subjected to gel electrophoresis to verify whether the band was correct, and the correct band was recovered using a DNA purification kit. Then the purified DNA fragment was transformed into 100 μL of commercial E. coli JM109 competent cells, ice bathed for 20 min, 42℃ heat shocked for 45 s, immediately placed on ice for 2 min, then immediately added with 700 μL of SOC medium, and recovered at 37℃, 200 rpm on a shaker for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant was removed, and the remaining bacterial solution was evenly spread on an ampicillin-resistant plate, and incubated at 37℃ overnight. The psgRNA-K-Fragment can be self-circularized in the cell due to the presence of homologous sequences at both ends, a single colony was picked from the plate, and the vector was extracted for sequencing verification, and if correct, the expression vector psgRNA-Kn was successfully constructed.

[0091] (6) PCR amplification was performed using primer 7 and primer 8 with the vector psgRNA-Kn as a template to introduce the upstream promoter J23119 and the T1 terminator of the sgRNA expression frame. The total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 7, 2 μL primer 8 and 1 μL template psgRNA-Kn. The PCR program was: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 10 s, 35 cycles were set, and a DNA fragment psgRNA-Kn-PT-Fragment was obtained.

[0092] (7) The DNA fragment obtained in step (6) is run on a gel to verify whether the band is correct, and the correct band is recovered using a DNA purification kit. The purified DNA fragment is then transformed into 100 μL of commercial E. coli JM109 competent cells, which are incubated on ice for 20 min, heated at 42°C for 45 s, immediately placed on ice for 2 min, and then immediately added with 700 μL of SOC medium, which is recovered at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant is removed, and the remaining bacterial solution is evenly coated on an ampicillin-resistant plate, which is incubated at 37°C overnight. A single colony is picked, and the vector is extracted for sequencing verification. If correct, the expression vector psgRNA-Kn-PT is successfully constructed, which contains a pBR322 replicon, an Amp resistance gene, an inactivated kan gene, and a promoter and terminator for expressing an sgRNA sequence.

[0093] (8) The primers 9 and 10 are used to perform PCR amplification on the vector psgRNA-Kn-PT as a template to introduce a wild-type sgRNA sequence expression frame (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGTCCATCTAGCGATACACCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGT). The total PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 9, 2 μL of primer 10, and 1 μL of template psgRNA-Kn-PT. The PCR program is as follows: 98°C for 1 min, 56°C for 15 s, 72°C for 1 min and 10 s, with 35 cycles set, to obtain a DNA fragment psgRNA-Kn-ATT-Fragment.

[0094] (9) The DNA fragment obtained in step (8) is run on a gel to verify whether the band is correct, and the correct band is recovered using a DNA purification kit. The purified DNA fragment is then transformed into 100 μL of commercial E. coli JM109 competent cells, which are incubated on ice for 20 min, heated at 42°C for 45 s, immediately placed on ice for 2 min, and then immediately added with 700 μL of SOC medium, which is recovered at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant is removed, and the remaining bacterial solution is evenly spread on an ampicillin-resistant plate, which is incubated at 37°C overnight. A single colony is picked, and the vector is extracted for sequencing verification. If correct, the expression vector psgRNA-Kn-ATT is successfully constructed, which contains a pBR322 replicon, an Amp resistance gene, a deactivated kan gene (in which a 20 bp N20 sequence + 3 bp ATT PAM is inserted), a target with a PAM sequence of ATT, and a wild-type sgRNA expression frame (structure as shown in Figure 1

[0095] Example 2: Construction of Cas protein mutant screening vector pvCas-pre

[0096] In this example, the pAC-crRNA-CmR plasmid (addgene, #158711) is used as a vector, and the Cas9 protein coding gene (SEQ ID NO: 1) is ligated to the vector to construct the Cas9 expression vector pvCas-pre (SEQ ID NO: 3), which contains a plasmid replicon (p15A replicon, SEQ ID NO: 2), a resistance screening marker (CmR) coding gene, and a Cas9 protein coding sequence. The specific method for constructing the expression vector pvCas-pre is as follows:

[0097] (1) The Cas9 protein coding gene sequence is amplified by PCR using primer 11 and primer 12, with the pCas9cur vector (from addgene) as the template. The total PCR reaction system is 50 μL, including 25 μL of primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 11, 2 μL of primer 12, and 1 μL of template pCas9cur plasmid. The PCR program is as follows: 98°C for 1 min, 56°C for 15 s, 72°C for 50 s, with 35 cycles set. The DNA fragment Cas9-Fragment containing the Cas9 protein coding sequence is obtained.

[0098] ​(2) Using primer 13 and primer 14 as primers, p15A replicon and CmR resistance gene were obtained by PCR amplification with pAC-crRNA-CmR vector as a template. The total system of PCR reaction was 50 μL, including 25 μL of primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 13, 2 μL of primer 14 and 1 μL of template pAC-crRNA-Cm. The PCR program was as follows: 98 ℃ for 1 min, 56 ℃ for 15 s, 72 ℃ for 30 s, 35 cycles were set, and a DNA fragment Fragment-p15A containing p15A replicon and CmR resistance gene was obtained.

[0099] (3) The DNA fragments obtained in steps (1) and (2) were run on a gel, and whether the bands were correct was verified. The correct bands were recovered using a DNA purification kit.

[0100] Then Cas9-Fragment and Fragment-p15A were connected. The connection system was generally prepared into 10 μL, and the specific proportion was 1.5 μL of fragment Cas9-Fragment and 3.5 μL of fragment Fragment-p15A, 5 μL of Gibson Master Mix, mixed and placed in a 50 ℃ water bath for 30 min. The connection product was transformed into 100 μL of commercialized E. coli JM109 competent cells, ice-bathed for 20 min, 42 ℃ heat-shocked for 45 s, immediately placed on ice for 2 min, then immediately added with 700 μL of SOC medium, and recovered at 37 ℃, 200 rpm on a shaker for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant was removed, and the remaining bacterial liquid was evenly coated on a plate containing chloramphenicol. The plate was placed at 37 ℃ and incubated overnight. Single colonies were picked and the vector was extracted for sequencing verification. If the Cas9 protein sequence was not mutated, the correct Cas gene expression vector pvCas-pre (the vector structure is shown in Figure 2 , and the nucleotide sequence is shown as SEQ ID NO. 3) was obtained.

[0101] Example 3: Construction of Cas9 protein mutation library

[0102] This example is mainly used to illustrate the method for constructing a Cas9 protein mutation library.

[0103] In this example, two regions of the Cas9 protein encoded by SEQ ID NO. 1 (region division is shown in Figure 3 ) were respectively mutated, so as to construct a mutation library. Among them,

[0104] Region 1 is the 1099-1148 amino acid part of the Cas9 protein;

[0105] Region 2 is the 1291-1306 amino acid part of the Cas9 protein.

[0106] (1) Based on the wild-type spCas9, a degenerate primer was designed, which included two parts: a sequence that can be homologously recombined with the expression vector pvCas-pre, and a Cas9 protein sequence with random mutations introduced at different sites. Each nucleic acid site has a mutation type N, including A / T / C / G four nucleotide mutations. The upstream primer is combined with the vector through the homologous sequence, and the mutation sequence introduced after the homologous sequence. The region that needs to be mutated is set to N, and the region that does not need to be mutated is the same as the DNA sequence of the original sequence template. The downstream primer is combined with the vector through the homologous sequence, and the region that needs to be mutated is set to N, and the region that does not need to be mutated is the same as the DNA sequence of the original sequence template.

[0107] Specifically, using the vector pvCas-pre as a template, region 1 was randomly mutated using degenerate primer 1 and degenerate primer 2, and region 2 was randomly mutated using degenerate primer 3 and degenerate primer 4. Two systems were constructed for PCR amplification, and two Cas9 protein sequence mutation libraries were obtained, respectively. The total system of PCR reaction is 50 μL, including 25 μL of primestar high-fidelity enzyme, 20 μL of dd H2O, 2 μL of degenerate primer 1 / 3, 2 μL of degenerate primer 2 / 4 and 1 μL of template pvCas-pre. The PCR program is: 98℃ 1min, 56℃ 15s, 72℃ 1min 10s, set 35 cycles, and the following DNA fragment amplification product is obtained:

[0108] Cas9 protein sequence with mutations in region 1: Cas9-L1-Fragment;

[0109] Cas9 protein sequence with mutations in region 2: Cas9-L2-Fragment;

[0110] (2) The DNA fragments obtained in step (1) were recovered using a DNA purification kit. Then the purified DNA fragments were transformed into 100 μL of commercialized competent cells of Escherichia coli JM109, ice bath for 20 min, 42℃ heat shock for 45 s, immediately placed on ice for 2 min, then immediately added with 700 μL of SOC medium, and incubated at 37℃, 200 rpm on a shaker for 45 min. Then the bacterial solution was transferred to fresh LB medium containing CmR antibiotic, and the vector was extracted after 6 hours of culture, and the following mutation library was obtained:

[0111] Cas9 protein mutation library with mutations in region 1: pCas9-L1;

[0112] Cas9 protein mutation library with mutation in region 2: pCas9-L2.

[0113] Example 4: Screening of Cas9 protein mutants capable of recognizing PAM sequence as ATT

[0114] This example is mainly used to illustrate the method for screening Cas9 protein mutants capable of recognizing PAM sequence as ATT.

[0115] In this example, the constitutively expressed Cas9 protein mutant library pCas9-L1 and pCas9-L2 are transformed into E. coli, respectively, together with a vector containing sgRNA and having a PAM sequence with low recognition activity of ATT. The sgRNA can guide the active Cas9 protein mutant to bind to the recognition site with PAM sequence of ATT to form a ternary complex with DNA to activate the nuclease activity of the Cas9 mutant. A 23 bp exogenous sequence with PAM sequence of ATT, which can be recognized by the Cas9-sgRNA complex, is inserted in advance in the Kan resistance gene sequence and serves as part of the sgRNA expression vector. When the active Cas9 forms a complex with sgRNA and can recognize the ATT sequence, it will recognize the DNA target under the guidance of sgRNA and form a ternary complex to cut the above-mentioned 23 bp target sequence, thereby causing a double-strand break in the DNA of the Kan gene sequence. The endogenous gene repair system in E. coli is activated and performs homologous repair in the bacterial body. After the homologous sequence repair in the designed homologous region (i.e., the homologous sequence upstream of the insertion site introduced in the kan coding sequence), the above-mentioned broken kan gene is repaired, thereby restoring the strain's resistance to kanamycin. Cas9 proteins without activity and unable to recognize PAM sequence of ATT cannot bind to the target sequence to produce a double-strand break, and thus cannot repair the kan gene coding sequence. On this basis, the recovered bacterial liquid is spread on a Kan resistance screening plate, and the strain containing the active Cas9 protein mutant capable of recognizing PAM sequence of ATT can grow on the screening plate.

[0116] According to the above principle, the Cas9 protein mutant library obtained in Example 3 is screened in this example, and the specific screening process is as follows:

[0117] (1) Transform the vector psgRNA-Kn-ATT containing the inactivated kan gene and the PAM targeting site containing the ATT sequence into the competent cells of the MG1655 strain, ice bath for 20 min, 42°C heat shock for 45 s, immediately placed on ice for 2 min, then immediately add 700 μL of SOC medium, recover at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, remove 500 μL of supernatant, evenly spread the remaining bacterial solution on the corresponding ampicillin-resistant plate, and incubate at 37°C overnight.

[0118] (2) After 14 hours, the transformants containing psgRNA-Kn-ATT were obtained on the resistant plate. The MG1655 transformants containing the psgRNA-Kn-ATT vector were inoculated in LB liquid medium and cultured for 12-16 hours. Then the seed liquid was transferred to fresh LB medium at a ratio of 1:100. According to the operation manual of the competent cell preparation kit (Shenguo, DP103), the competent cells were prepared. After the preparation of the competent cells was completed, the Cas9 protein mutant vector library was transformed into the MG1655 competent cells containing the psgRNA-Kn-ATT vector, 1 ml of LB or SOC medium was added, and it was recovered at 37°C for 2 h. Then it was spread on the LB plate containing chloramphenicol and kanamycin resistance and incubated at 37°C overnight.

[0119] (3) Single colonies were selected on the LB plate containing chloramphenicol and kanamycin resistance, and colony PCR was performed using primer 15 and primer 16. The total reaction system was 20 μL, including Taq enzyme (Vazyme, P131-01), 20 μL ddH2O, 2 μL primer 15, 2 μL primer 16 and 1 μL diluted bacterial solution. The PCR program was: 95°C for 3 min, 95°C for 15 s, 56°C for 15 s, 72°C for 20 s, and 30 cycles were set. Then the colony PCR product was sent to Suzhou Vazyme Biotech Co., Ltd. for DNA sequencing, and the results were compared with the wild type Cas9 protein sequence to obtain mutants that can recognize the ATT PAM site. Sequencing alignment obtained 2 Cas9 proteins that can recognize ATT PAM:

[0120]

[0121]

[0122] Example 5: Comparison of recognition efficiency of ATT by Cas9 protein mutants and wild type Cas9

[0123] In this example, in order to obtain the comparison data of recognition efficiency of ATT by wild type and mutant Cas9, we replace the kan screening system with a fluorescence reporter system, which is more conducive to rapid and high-throughput screening, that is, replace the kan gene in the construction process of the expression vector psgRNA-Kn-ATT in Example 1 with the egfp gene. First, insert the 23bp target sequence with PAM sequence of ATT and its upstream homologous sequence into the egfp gene, so that the egfp gene expression is inactivated. If the Cas9 protein can recognize the ATT PAM sequence, a double-strand break can be generated. Through the homologous repair system in the cell, the designed homologous sequence is repaired, so that the eGFP protein restores expression and is detected to fluorescence. By comparing the fluorescence results of the two groups of experiments of wild type and mutant Cas9, the gene editing efficiency of wild type and mutant Cas9 can be analyzed, so as to reflect the recognition efficiency of wild type and mutant Cas9 to ATT PAM site. Using the Cas9 protein mutants (Cas9-M1, Cas9-M2) screened in Example 4, the wild type Cas9 protein targets the target with PAM sequence of ATT after interacting with sgRNA. If the Cas9 mutant can recognize and target the sequence, a double-strand break can be generated, and the eGFP can be recovered through homologous sequence repair. Then analyze by flow cytometry to detect the recovery rate to characterize the recognition activity of Cas9 protein to PAM sequence of ATT. The specific verification process is as follows:

[0124] (1) Constructing ATT recognition efficiency characterization vector

[0125] ① Use primer 17 and primer 18 to amplify psgRNA-Kn-ATT as a template. The total PCR reaction system is 50μL, including 25μL primestar high-fidelity enzyme, 20μL ddH2O, 2μL primer 17, 2μL primer 18 and 1μL template psgRNA-Kn-ATT plasmid. The PCR program is: 98℃ 1min, 56℃ 15s, 72℃ 40s, set 35 cycles, get DNA fragment sgRNA-Amp-Fragment.

[0126] ② Using the vector pUC-BB-eGFP (Addgene, #32548) as a template, PCR amplified the eGFP gene sequence using primers 19 and 20. The total PCR reaction volume was 50 μL, including 25 μL of Primestar high-fidelity enzyme, 20 μL of ddH2O, 2 μL of primer 19, 2 μL of primer 20, and 1 μL of template pUC57-BB-eGFP. The PCR program was as follows: 98°C for 1 min, 56°C for 15 s, and 72°C for 20 s, for 35 cycles to obtain the eGFP fragment.

[0127] ③ Run the DNA fragments obtained in step ① and step ② on a gel to verify whether the bands are correct and use a DNA purification kit to recover the correct bands. Then connect the sgRNA-Amp-Fragment and eGFP-Fragment. The connection system is generally prepared in 10μL, with a specific ratio of 1.5μL eGFP-Fragment and 3.5μL sgRNA-Amp-Fragment, 5μL Gibson Master Mix, mix well and place in a 50°C water bath for 30 minutes. Transform the ligation product into 100 μL of commercial Escherichia coli JM109 competent cells, place on ice for 20 minutes, heat shock at 42°C for 45 seconds, immediately place on ice for 2 minutes, then immediately add 700 μL of SOC medium and recover in a shaker at 37°C and 200 rpm for 45 minutes. After centrifugation at 4000 rpm for 2 minutes, remove 500 μL of supernatant and evenly spread the remaining bacterial liquid on an ampicillin-resistant plate. Incubate at 37°C overnight, pick a single colony, extract the vector for sequencing verification, and if the verification is correct, the expression vector psgRNA-egfp containing the replication origin pBR322, the antibiotic ampicillin (AmpR), the sgRNA sequence, and the gene sequence of the fluorescent protein (egfp) has been successfully constructed.

[0128] ④ Introduce a recognizable 23bp exogenous sequence and a homologous sequence upstream of the insertion site into the egfp coding sequence. The 23bp exogenous sequence includes a 20bp N20 sequence (CCATCTAGCGATACACACCG) and a 3bp ATT PAM sequence. The insertion site refers to the insertion site of the 23bp exogenous sequence in the egfp gene, which can be any site that can inactivate the egfp gene after insertion. The homologous sequence upstream of the insertion site (tgtttcgcttggtgg) can induce homologous recombination. The specific steps are as follows:

[0129] The 23 bp exogenous sequence (CCATCTAGCGATACACACCGATT) and the homologous sequence upstream of the insertion site (tgtttcgcttggtgg) were designed in primers 21 and 22, and primers 21 and 22 were used to amplify the template vector psgRNA-egfp by PCR, and the total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 21, 2 μL primer 22 and 1 μL template psgRNA-egfp. The PCR program was: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 10 s, 35 cycles were set, and the DNA fragment psgRNA-egfpn-Fragment was obtained.

[0130] ⑤The DNA fragment obtained in step ④ was run on a gel to verify whether the band was correct, and the correct band was recovered using a DNA purification kit. The purified DNA fragment was transformed into 100 μL of commercialized competent cells of Escherichia coli JM109, ice bath for 20 min, 42℃ heat shock for 45 s, immediately placed on ice for 2 min, then immediately added with 700 μL of SOC medium, and recovered at 37℃, 200 rpm on a shaker for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant was removed, and the remaining bacterial solution was evenly spread on an ampicillin-resistant plate and incubated at 37℃ overnight. Since the psgRNA-egfpn-Fragment has homologous sequences at both ends, the fragment can be self-circularized in the cell, a single colony was picked from the plate, and the vector was extracted for sequencing verification. If the sequencing is correct, the expression vector psgRNA-egfpn is successfully constructed.

[0131] (2) Cas9 protein mutant Cas9-M1, Cas9-M2 expression vector construction

[0132] ①Using the vector pvCas-pre as a template, the mutation sites were designed in primers according to the sequences of Cas9-M1 and Cas9-M2, and primers 23 / 24 and 25 / 26 were used to amplify the template vector pvCas-pre by PCR, and the total PCR reaction system was 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL primer 23 / 25, 2 μL primer 24 / 26 and 1 μL template pvCas-pre. The PCR program was: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 10 s, 35 cycles were set, and the DNA fragments pCas9-M1-Fragment and pCas9-M2-Fragment were obtained.

[0133] ② The DNA fragment obtained in step 1 is subjected to gel electrophoresis to verify whether the band is correct, and the correct band is recovered using a DNA purification kit. The purified DNA fragment is transformed into 100 μL of commercial competent cells of Escherichia coli JM109, ice bath for 20 min, 42°C heat shock for 45 s, immediately placed on ice for 2 min, then immediately add 700 μL of SOC medium, recover at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant is removed, and the remaining bacterial solution is evenly coated on a chloramphenicol-resistant plate and incubated at 37°C overnight. Since there are homologous sequences at both ends of pCas9-M1-Fragment and pCas9-M2-Fragme, the fragment can be self-circularized in the cell. Single colonies are picked from the plate, and the vector is extracted for sequencing verification. If the sequencing is correct, the expression vectors pCas9-M1 and pCas9-M2 expressing Cas9-M1 and Cas9-M2, respectively, are successfully constructed.

[0134] (3) Activity determination of Cas9 protein mutants

[0135] ① The vector psgRNA-egfpn is transformed into the competent cells of the MG1655 strain, ice bath for 20 min, 42°C heat shock for 45 s, immediately placed on ice for 2 min, then immediately add 700 μL of SOC medium, recover at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant is removed, and the remaining bacterial solution is evenly coated on a chloramphenicol-resistant plate and incubated at 37°C overnight.

[0136] ② 14 hours later, the transformants containing psgRNA-egfpn are obtained on the resistant plate. The MG1655 transformants containing the psgRNA-egfpn vector are inoculated in LB liquid medium and cultured for 12-16 hours. Then, the seed liquid is transferred to fresh LB medium at a ratio of 1:100. According to the instructions of the competent preparation kit (Shenguo, DP103), the competent cells are prepared. After the preparation of the competent cells is completed, the expression vectors pCas9-M1, pCas9-M2, and ppvCas-pre are transformed into the MG1655 competent cells containing the psgRNA-egfpn vector, 1 ml of LB or SOC medium is added, and the recovery is carried out at 30°C for 2 h. Then, the cells are transferred to 3 ml of LB medium containing chloramphenicol and ampicillin, and incubated at 16°C overnight. In this way, cells successfully introducing the expression vectors pCas9-M1, pCas9-M2, and ppvCas-pre are screened out.

[0137] ③In order to further confirm whether the eGFP protein is refolded, that is, whether the Cas9 protein mutant (Cas9-M1, Cas9-M2) successfully targets the target point with the PAM sequence of ATT after interacting with the sgRNA, the overnight bacterial liquid is used for fluorescence analysis by using a flow cytometer, and the data is recorded. The results show that the refolding rate of eGFP containing the wild type Cas9 system is 1.79%, the refolding rate of eGFP containing the Cas9-M1 mutant system is 4.58%, and the refolding rate of eGFP containing the Cas9-M2 mutant system is 19.6%( Figure 5 ).

[0138] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and any person skilled in the art can make various forms and details of changes, modifications, replacements and modifications to these embodiments without departing from the spirit and principles of the present application, and the scope of the present application is defined by the claims and their equivalents.

Claims

1. A Cas protein mutant screening system, characterized in that, The system comprises a Cas protein mutant screening vector and an sgRNA expression vector; The Cas protein mutant screening vector comprises the following expression elements: a Cas protein coding gene, a plasmid replicon, and a first resistance screening tag expression cassette; and the sgRNA expression vector comprises the following expression elements: a plasmid replicon, a second resistance screening tag expression cassette, a third resistance screening tag expression cassette, and an sgRNA expression frame; The first resistance screening tag expression cassette comprises a first resistance screening tag, which is a resistance gene, including but not limited to an ampicillin, spectinomycin, chloramphenicol, kanamycin, or tetracycline resistance gene; The second resistance screening tag expression cassette comprises a second resistance screening tag, and the third resistance screening tag expression cassette comprises a third resistance screening tag, wherein the second resistance screening tag and the third resistance screening tag are any two different resistance genes, and are different from the first resistance gene in the Cas protein mutant screening vector; The third resistance screening tag is inactivated by adding an insertion sequence, wherein the insertion sequence comprises a 23 bp exogenous sequence that can be recognized and a homologous sequence upstream of an insertion site of the third resistance screening tag; the insertion site refers to an insertion site of the 23 bp exogenous sequence on the third resistance screening tag gene, which is any site that can inactivate the third resistance screening tag gene after insertion; the 23 bp exogenous sequence comprises a 20 bp recognition sequence and a 3 bp PAM, wherein the recognition sequence is any exogenous sequence that can be efficiently recognized by CRISPR / Cas9; and the PAM is a protospacer adjacent motif, including but not limited to AAA, AAC, AAG, AAT, ACA, ACC, ACG, ACT, ATA, ATC, ATG, ATT, CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CTA, CTC, CTG, CTT, GAA, GAC, GAG, GAT, GCA, GCC, GCG, GCT, GTA, GTC, GTG, GTT, TAA, TAC, TAG, TAT, TCA, TCC, TCG, TCT, TTA, TTC, TTG, TTT, and NGG.

2. The screening system for Cas protein mutants according to claim 1, wherein On the Cas protein mutant screening vector, the Cas protein coding gene is a coding gene of a wild-type Cas9, i.e., spCas9, or a coding gene of a spCas9 variant, including a coding gene of spG, spRY, or superFI-Cas9; On the Cas protein mutant screening vector, the plasmid replicon is used to regulate replication of the Cas protein mutant screening vector in cells, and any replicon having the above function can be used in the present application, including but not limited to pBR322, pUC, p15A, pColEI, pColA, and pSC101 replicons. The replicon is used to regulate the replication of the sgRNA expression vector in cells, and any replicon having the above functions can be used in the present application, including but not limited to pBR322, pUC, p15A, pColEI, pColA, pSC101; The sgRNA expression frame comprises an sgRNA backbone sequence, an N20 sequence, a promoter and a terminator for expressing sgRNA.

3. The screening system for Cas protein mutants according to claim 2, wherein A Cas protein mutant screening vector pvCas-pre comprising a p15A replicon, a spCas9 coding gene shown in SEQ ID NO. 1, and a chloramphenicol resistance coding gene is constructed, and the nucleotide sequence is shown in SEQ ID NO.

3.

4. The Cas protein mutant screening system of claim 2, wherein the Cas protein mutant screening system is a system for screening a mutant of a Cas protein selected from the group consisting of Cas9, Cpf1, and C2c1. The sgRNA backbone sequence is shown in SEQ ID NO.

5. The N20 sequence is consistent with the 20bp recognition sequence inserted in the third resistance screening tag. The promoter and terminator for expressing sgRNA can be optional promoters and terminators commonly used in the art, including J23119, J23110, J23101, J23100, J23102; T1, T2, Tf, TtrpA.

5. The screening system for Cas protein mutants according to claim 2, wherein An sgRNA expression vector comprising a pBR322 replicon, an Amp resistance gene, a deactivated kan gene, and an sgRNA expression frame is constructed, and the nucleotide sequence is shown in SEQ ID NO.

10. The 20bp N20 sequence and the 3bp PAM sequence are inserted in the kan gene, and the PAM sequence is ATT.

6. A method for constructing a library of Cas protein mutations, characterized by, The Cas protein mutant screening vector of claim 1 is used as a template, and a mutation primer is designed to introduce random mutations to the Cas protein on the template, thereby constructing a Cas protein mutation library.

7. The method of claim 6, wherein the Cas protein mutation library is constructed by, The mutation primer comprises a homologous sequence to the Cas protein mutant screening vector, which is used to introduce Cas protein mutant sequences on the screening vector by homologous recombination. The mutation primer used in the Cas protein mutation is a degenerate primer, and the bases in the mutation region are set as N, which can be any one of A, T, C, and G. The regions that do not need to be mutated are the same as the DNA sequence of the wild-type Cas protein sequence.

8. The method of claim 7, wherein the Cas protein mutation library is constructed by, The mutation region of the Cas9 protein encoded by SEQ ID NO. 1 is divided into two regions, and at least one of the two regions is mutated, thereby constructing a mutation library. Region 1 is the 1099th to 1148th amino acid part of the Cas9 protein shown in SEQ ID NO.

1. Region 2 is the 1291st to 1306th amino acid part of the Cas9 protein shown in SEQ ID NO.

1.

9. A method of screening for a mutant of a Cas protein, characterized by, The method is to transform the Cas protein mutation library constructed in claim 6 and the sgRNA expression vector constructed in claim 1 into E. coli, respectively, and culture on a screening medium containing a third resistance screening tag. The Cas protein mutant sequence contained in the normally growing strain is an active Cas protein mutant that can recognize the corresponding PAM site.

10. The Cas protein mutant screened by the method of claim 9.

11. The Cas protein mutant of claim 10, wherein The Cas protein mutant includes but is not limited to the following sequences: Cas9-M1, the amino acid sequence is shown as SEQ ID NO. 8; Cas9-M2, the amino acid sequence is shown as SEQ ID NO.

9.

12. The application of the Cas protein mutant of claim 10 in the CRISPR / Cas9 gene editing system.

13. Use according to claim 12, wherein it is The application includes but is not limited to the following aspects: base editing, single gene target editing, multi-gene target editing, including but not limited to the following aspects: pilot editing, base knockout, base substitution, base insertion, single gene knockout / insertion, multi-gene knockout / insertion, single gene expression gradient regulation, multi-gene transcription regulation.

Images