Application of receptor-like kinase gene MdCIK2 in regulation and control of apple disease resistance

Abstract

The invention belongs to the technical field of gene engineering, and relates to application of a receptor-like kinase gene MdCIK2 in regulation and control of apple disease resistance. The invention provides an application of a receptor-like kinase gene MdCIK2 in regulation and control of apple disease resistance, which comprises the following steps: a) silencing the receptor-like kinase gene MdCIK2 to improve the resistance of apples to rot diseases; or b) silencing a specific gene segment of the receptor-like kinase gene MdCIK2, and improving the resistance of apples to rot disease. The receptor-like kinase gene MdCIK2 for negative regulation of apple disease resistance provided by the invention can provide important gene resources for apple disease resistance molecular breeding and targeted gene editing.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to the application of a receptor-like kinase gene MdCIK2 in regulating apple disease resistance. Background Art

[0002] apple( Malus domestica ) is one of the three major cultivated fruit trees in my country, and is grown by the Ascomycetes ( Valsa mali ) is a major branch and trunk disease faced by the development of the apple industry. It is characterized by strong latent infectivity and rapid spread, which can lead to tree weakness or even death of the entire tree, posing a serious threat to the sustainable development of the apple industry. Although efficient disease prevention and control technologies have been developed, which can alleviate the occurrence of diseases to a certain extent, long-term reliance on chemical agents can easily lead to various problems such as environmental pollution. In addition, with the development of society, people have higher and higher requirements for food safety, and green prevention and control of diseases has become an important trend in the current industrial development. The scientific use of disease-resistant varieties is the most economical, effective and environmentally friendly way to achieve green and long-term prevention and control of diseases. Exploiting apple's own disease-resistant genetic resources and then breeding disease-resistant varieties are considered to be the core strategy for achieving green prevention and control of apple tree rot.

[0003] The plant immune system relies on two levels of immune responses: pattern-triggered immunity (PAMP-triggered immunity (PTI)) and effector-triggered immunity (ETI). Plant receptor-like kinases (RLKs), as transmembrane signal perception and transduction elements, play a key role in PTI. They are primarily composed of an extracellular domain and an intracellular kinase domain. Plant RLKs can be further classified based on their extracellular domain structure, with the largest subfamily being LRR-RLKs containing LRR domains. Plant LRR-RLKs can function as receptors, co-receptors, or regulators, playing important roles in plant growth, development, and immunity. Currently, only a few regulatory LRR-RLKs have been identified as participating in plant immunity.

[0004] In recent years, using gene editing technology to target plant disease-susceptibility genes and create disease-resistant materials has become a green, efficient, and long-lasting disease control strategy. Functional loss of negative immune regulators may significantly enhance resistance by relieving immune suppression. However, RLKs that specifically negatively regulate rot resistance have not yet been identified in apple. Summary of the Invention

[0005] In view of this, the application identifies a class of RLK genes that negatively regulate the resistance of apples to the apple canker disease, and names it as gene MdCIK2 according to the name of the homologous protein in the model plant Arabidopsis thaliana. The silencing of the gene can significantly improve the disease resistance of apples to the apple canker disease, and the overexpression of the gene can significantly reduce the disease resistance of apples to the apple canker disease and inhibit the expression of immune marker genes of apples. The finding provides important gene resources for apple disease resistance molecular breeding and targeted gene editing, and has important theoretical value and application prospect.

[0006] To achieve this technical purpose, the application adopts the following technical solutions: In one aspect, the application provides application of a receptor-like kinase gene MdCIK2 (abbreviated as gene MdCIK2) in regulating the disease resistance of apples, comprising: a) silencing the receptor-like kinase gene MdCIK2 to improve the resistance of apples to the apple canker disease; or b) silencing a specific gene fragment of the receptor-like kinase gene MdCIK2 to improve the resistance of apples to the apple canker disease; The CDS sequence of the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO: 1.

[0007] Preferably, the nucleotide sequence of the specific gene fragment of the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO: 2.

[0008] Preferably, the amino acid sequence of the protein encoded by the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO: 3.

[0009] Preferably, the apple canker disease is caused by a fungus of the phylum Ascomycota and the genus Physoderma.

[0010] In another aspect, the application provides an anti-fungus of the phylum Ascomycota and the genus Physoderma Valsa mali The application further provides a method for breeding an apple variety, comprising the step of silencing the receptor-like kinase gene MdCIK2. The CDS sequence of the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO: 1.

[0011] Preferably, the amino acid sequence of the protein encoded by the receptor-like kinase gene MdCIK2 is shown in SEQ ID NO: 3.

[0012] Preferably, the receptor-like kinase gene MdCIK2 has a negative regulation effect in the immune response. Valsa mali Preferably, the receptor-like kinase gene MdCIK2 has a negative regulation effect in the immune response.

[0013] Preferably, the receptor-like kinase gene MdCIK2 has a negative regulation effect in the immune response.

[0014] Preferably, overexpression of the said receptor-like kinase gene MdCIK2 reduces the resistance of the apple to the rot disease.

[0015] In still another aspect, the present application provides application of the receptor-like kinase gene MdCIK2 in breeding apple varieties resistant to the ascomycota genus Valsa fungi Valsa mali The CDS sequence of the receptor-like kinase gene MdCIK2 is shown as SEQ ID NO: 1.

[0016] The SEQ ID NO: 1 is shown as follows:

[0017] SEQ ID NO: 2 is specified as follows: “TATGAGCCTCGCAACCATGAAGTGGAGGCTTTGATAAGCTTAAGGGTAGGTTTGAATGATCCGCATGGGGTGTTAAACAACTGGGATGAGGACTCAGTGGACCCTTGTAGCTGGGCTATGATCACCTGCTCCCCTGATAATCTCGTCATTGGCCTGGGAGCTCCAAGCCAGTCTCTGTCTGGAACTCTGTCCGGGG”.

[0018] SEQ ID NO: 3 is specified as follows: “MLPLKLLIFFLSSCSLCLSYEPRNHEVEALISLRVGLNDPHGVLNNWDEDSVDPCSWAMITCSPDNLVIGLGAPSQSLSGTLSGAFANLTNLRQVLLQNNNICGKLPSELGTLPKLQTLDLSNNRFSGLVPDSLAHLNTLQYLRLNNNSLSGPFPVSLAKIPDLAFLDLSYNNLSGPIPKFPARTFNVVGNPLICASSSTEGCSGSATPVPLSLSLKTSPGKHNSKTVAIALGLSLSCVLVIVLLLGILWHRKKQKTQSILNISDIQEEGIVSLGNLRSFTFKQLQLATDNFSSKHILGAGGFGNVYKGKLPDGTMVAVKRLKDVTGTAGESQFRTELEMISLAVHRNLLRLIGFCATFSERLLVYPYMSNGSVAARLRGKPALDWNTRKRIAIGAARGLLYLHEQCDPKIIHRDVKAANVLLDDYCEAIVGDFGLAKLLDHADSHVTTAVRGTVGHIAPEYLSTGQSSEKTDVFGFGILLIELITGMRALEFGKTVNQKGAILEWVKKIQQEKKVEVLVDRELGNNYDRIEVGEMLQVALLCTQYLPAHRPKMSEVVRMLEGDGLAEKWAASHNQSNSSMDRFQSHNSNKSSSHTDGIHSKHDGNERDRGSMFSAWIDEDEDENSLDSYAMELSGPR”.

[0019] The beneficial effects of the present application, with respect to the prior art, are that: (1) The application provides a kind of negative regulation apple disease resistance class receptor kinase gene MdCIK2, provides important gene resources for apple disease resistance molecular breeding and targeted gene editing.

[0020] (2) The application provides a kind of apple class receptor kinase gene MdCIK2, further clear its expression pattern in different time periods of apple rot fungus infection. Using the method of Agrobacterium-mediated transient transformation, transiently overexpress MdCIK2 in Nicotiana benthamiana leaf, by laser confocal microscopy, clear its subcellular localization. Through vacuum infiltration Agrobacterium method, transiently silence and overexpress MdCIK2 in apple tissue culture leaf, clear after reaching the requirement of silencing and overexpression, inoculate apple tree rot fungus V. mali , by statistical leaf disease area and immune gene expression to clear the role of the gene in the process of apple resistance to rot disease, lay the foundation for the follow-up function research.

[0021] (3) The application determines the function of MdCIK2 in the interaction between apple and V. mali , after transiently silencing MdCIK2 in apple leaf, the disease resistance of apple to V. mali can be improved, transiently overexpressing MdCIK2 can significantly reduce the disease resistance of apple to V. mali , and inhibit the expression of apple immune marker genes. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiment or prior art description. Obviously, the drawings in the following description only some embodiments of the application, and for those skilled in the art, without creative labor, other drawings can also be obtained according to these drawings.

[0023] Figure 1 Gel electrophoresis gel map of gene MdCIK2 provided in embodiment 2 of the application.

[0024] Figure 2 Evolutionary analysis diagram of MdCIK2 homologous protein in different species provided in embodiment 3 of the application.

[0025] Figure 3 MdCIK2 expression pattern analysis diagram in apple in response to V. mali infection at different time periods provided in embodiment 4 of the application.

[0026] Figure 4Figure 5 shows the subcellular localization of the protein encoded by the gene MdCIK2 in plant cells. A shows the green fluorescence of the MdCIK2-GFP fusion protein in plant cells; B shows the red fluorescence of the membrane-localized TaWPI6-mCherry fusion protein in plant cells; C shows the cell field of view under bright field; and D shows the subcellular localization of the protein under the superposition of green and red fluorescence.

[0027] Figure 5 The apple response after transient silencing of the gene MdCIK2 provided in Example 6 of the present invention V. mali Phenotypic analysis of infection. Among them, A is the result of MdCIK2 silencing efficiency test; B is the result of inoculation after silencing MdCIK2. V. mali Phenotypic results of lesion area; C is the inoculation after silencing MdCIK2 V. mali Statistical results of the lesion area.

[0028] Figure 6 The apple response after transient overexpression of the gene MdCIK2 provided in Example 6 of the present invention V. mali Phenotypic analysis of infection. A is the analysis of MdCIK2 overexpression results; B is the analysis of MdCIK2 overexpression and inoculation. V. mali Phenotypic results of lesion area; C is the inoculation after overexpression of MdCIK2 V. mali Statistical results of the lesion area.

[0029] Figure 7 This is an analysis of the expression of apple defense-related genes MdPR1, MdPR2, MdPR5, MdWRKY33, and MdRBOHD after transient overexpression of the gene MdCIK2 provided in Example 7 of the present invention.

[0030] Note: Figure 5 CK in the figure refers to the control pK7 empty vector, and RNAi::MdCIK2 refers to pK7-MdCIK2. Figure 6 CK refers to the control pCAMBIA1302-GFP, and OE::MdCIK2 refers to pCAMBIA1302-MdCIK2. Figure 7 CK refers to pCAMBIA1302-GFP, and OE::MdCIK2 refers to pCAMBIA1302-MdCIK2. DETAILED DESCRIPTION

[0031] The technical solutions of the present application are described below in combination with examples, but the present application is not limited to the following examples. The experimental methods and detection methods described in each example are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified, and the % in the following examples is the mass percentage unless otherwise specified.

[0032] Table 1 below is the primer information related to the embodiments of the present application.

[0033] Table 1 Primer information related to the embodiments of the present application

[0034]

[0035] The pCAMBIA1302, pK7GWIWG2D (II) vector, Gala apple tissue culture seedling leaf, and Valsa mali Miyabe involved in the embodiments of the present application V. mali Valsa mali were provided by the Fruit Tree Disease Research Team of the College of Plant Protection, Northwest A&F University, and the Gala apple branches were collected from the Xintian Garden of Northwest A&F University. The rest of the reagent consumables were commercially available.

[0036] The formula of the LB medium (1 L) involved is as follows: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and 15 g of agar powder (when preparing a solid culture medium, add) are added to a 1 L measuring cup, and then water is added to make up to 1 L, and then 121℃ high-pressure sterilization is performed for 20 min.

[0037] The formula of the PDA medium (1 L) involved is as follows: 200 g of peeled potatoes are cut into pieces, boiled with double-distilled water for 30 min, filtered with gauze into a 1 L measuring cup, 20 g of glucose and 15 g of agar powder are added, stirred uniformly, and then double-distilled water is added to make up to 1 L, and then 121℃ high-pressure sterilization is performed for 20 min.

[0038] The formula of the MS medium (1 L) involved is as follows: 30 g of sucrose, 4.43 g of MS medium (PhytoTechnology, item number: M519), 8 g of agar powder, 200 µL of 1 mg / mL IAA, and 200 µL of 1 mg / mL 6-BA are added to a 1 L measuring cup, and then 121℃ high-pressure sterilization is performed for 20 min.

[0039] Example 1 This example gives a method for obtaining the sequence of the negative regulation apple anti-rot disease gene MdCIK2 ​The nucleotide sequence of the negative regulatory gene MdCIK2 related to apple disease resistance disclosed in the embodiment is shown as SEQ ID NO: 1, which is obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and the gene number is XM_070815479.1, with a full length of 1917 bp; it encodes 638 amino acids (shown as SEQ ID NO: 3); and the specific sequence for silencing the gene MdCIK2 is shown as SEQ ID NO: 2.

[0040] Embodiment 2 The embodiment provides a cloning method of the gene MdCIK2 The RNA kit (Beijing Huayueyang Biological Technology Co., Ltd., item number 0416-50) was used to extract the RNA of Gala apple leaves according to the operation instruction; the reverse transcription kit (ThermoFisher Scientific, item number K1162) was used to obtain the apple cNDA according to the operation instruction; the snapgene software was used to design the primers of the full-length MdCIK2 with the pCAMBIA1302 vector homologous arm (see Table 1) according to the CDS complete sequence of the gene MdCIK2; the high-fidelity enzyme (Shanghai Yisheng Biological Technology Co., Ltd., item number: 10154ES03) was used to perform PCR amplification on the target fragment with the cDNA as a template. The reaction system was as follows: 25 μL 2×HieffCanace ® Plus PCR Master Mix (With Dye); 2 μL 1302-MdCIK2-F and 2 μL 1302-MdCIK2-R; 3 μL cNDA; 18 μL ddH2O. The PCR reaction program was as follows: 98 ℃ pre-denaturation for 3 min, 98 ℃ denaturation for 10 s, 58 ℃ annealing for 20 s, 72 ℃ extension for 1 min, 35 cycles, and 72 ℃ extension for 5 min. The agarose gel electrophoresis result is shown in FIG. 2, which is consistent with the gene CDS fragment size. Figure 1

[0041] Embodiment 3 The embodiment provides a homologous evolution analysis of the protein encoded by the gene MdCIK2 The homologous genes of the gene in different plants were searched in the NCBI database, including the gramineous plant corn (Zea mays) Zea mays ), the rice (Oryza sativa) Oryza sativ ), the wheat (Triticum aestivum) Triticum aestivum ); the solanaceous plant bensonii (Nicotiana benthamiana) Nicotiana benthamiana ), the potato (Solanum tuberosum) Solanum tuberosum ); the rosaceous plant apple (Malus domestica) Malus domestica ), the pear (Pyrus x bretschneideri) Pyrus bretschneideri ), the peach (Prunus persica) Prunus persica ); the leguminous plant peanut (Arachis hypogaea)​Arachis hypogaea )、Soybeans( Glycine max ); Cruciferous rapeseed ( Brassica napus ), Arabidopsis thaliana ( Arabidopsis thaliana ); Malvaceae cotton ( Gossypium hirsutum ); Grape (Vitis vinifera); Vitis vinifera ) and Cucurbitaceae ( Cucumis sativus ). Using MEGA11 software to construct an evolutionary tree of MdCIK2 based on the maximum likelihood method, it was found that this gene has a close evolutionary relationship with the Cucurbitaceae plant cucumber XP_004146714.1 protein ( Figure 2 ), but no studies have reported this gene negatively regulating disease resistance in cucumber. Currently, there are reports on the function of CIK family receptor kinases in the cruciferous plant Arabidopsis thaliana, which regulates plant growth and development, but no studies have reported the function of this family gene in negatively regulating plant disease resistance.

[0042] Example 4 This example provides an analysis of the expression pattern of the gene MdCIK2 in response to infection with apple rot pathogens. One-year-old Gala apple branches were collected from the orchard. Branches of uniform thickness were selected and cut into 10 cm long segments. The branches were disinfected with 0.7% sodium hypochlorite and both ends were sealed with paraffin. A wound was made in the middle of the branch using a 5 mm diameter borer and inoculated with the PDA medium activated in advance. V. mali , cultured at 25℃ with moisturizing condition, and plant tissues at the junction of diseased and healthy areas were scraped at 0, 6, 12, 24, 36, 48, and 72 h after inoculation of the pathogen.

[0043] The total RNA of the plant tissues was extracted using an RNA extraction kit, and cDNA was obtained after reverse transcription using a reverse transcription kit. Actin The gene was used as an internal reference gene, and qPCR was used to analyze the expression pattern of MdCIK2 in different time periods of interaction between apple and pathogens. First, a 20μL qPCR system was established: 10μL 2×ChamQ SYBR qPCR Master Mix (Nanjing Novozymes Biotechnology Co., Ltd., Product No. Q311) was added on ice in sequence; 0.5μL qRT-MdCIK2-F and qRT-MdCIK2-R; 1μL cDNA; 8μL ddH2O. The qPCR reaction was performed according to the following system and procedure: pre-deformation: 95℃ for 30 seconds; cycle reaction: 95℃ for 10 seconds, 60℃ for 30 seconds for 40 cycles, three biological replicates and three experimental replicates were taken for each treatment. By 2 –ΔΔCT The results of qPCR were analyzed and the results showed that the negative regulation of apple rot resistance gene MdCIK2 in apple response V. maliSignificantly up-regulated at 12, 24, 36h, down-regulated at 48, 72h after infection Figure 3 ).

[0044] Example 5 This example gives the subcellular localization analysis of the protein encoded by gene MdCIK2 The gene MdCIK2 was constructed into the pCAMBIA1302 vector containing a GFP tag. First, the vector was linearized, the system was: 5 μL pCAMBIA1302 plasmid; 5 μL 10×QuickCut Buffer; 2.5 μL Spe I; 2.5 μL Nco I; 35 μL ddH2O, the PCR reaction program was: 37°C for 30 min; 80°C for 10 min. After the reaction, it was taken out and placed on ice for standby, then the gene MdCIK2 fragment cloned in Example 2 was used for homologous recombination with the linearized vector pCAMBIA1302 using a homologous recombination enzyme (Novagen, item number C112), and the product was transformed into E. coli competent Trelief ® 5α (Beijing Genki Biological Company). The transformed competent cells were plated on LB solid medium containing 50 μg / mL Kana resistance, and incubated at 37°C for 12 h, and single colonies were picked for colony PCR detection, and single colony colonies with correct PCR band size and target gene were selected and added to liquid LB medium containing corresponding antibiotics for further shaking culture for 16 h. The plasmid in E. coli was extracted using a plasmid extraction kit and sent to Shanghai Shenguo Biological Co., Ltd. for sequencing comparison. The recombinant plasmid vector with correct sequencing was transformed into the Agrobacterium EHA105 strain competent cells (Shanghai Weidi Biological) according to the instructions, and the transformed competent cells were plated on LB medium containing kanamycin (50 μg / mL) and rifampicin (25 μg / mL) and incubated at 28°C for 48-72 h until single colonies grew. The Agrobacterium single colonies obtained after transformation were picked into LB liquid medium containing kanamycin (50 μg / mL) and rifampicin (25 μg / mL) and cultured at 220 rpm for 48-72 h, and the colonies were centrifuged at 5000 rpm for 3 minutes after expansion, and the bacterial cells were suspended using an infection solution (10 mM MgCl2·6H2O, 10 mM MES, 100 μM acetyl-syringone) and adjusted to OD 600 0.6-0.8, and then placed at room temperature in the dark for 2-3 h. The Agrobacterium suspension after dark standing was injected into 4-5 week old tobacco leaves using a needleless syringe, and after two days of culture in the greenhouse, fluorescence observation was performed using an FV3000 laser confocal microscope (Olympus, Japan). The results showed that the green fluorescence presented by the MdCIK2-GFP fusion protein overlapped with the red fluorescence presented by the membrane localization protein TaWP16-mCherry fusion proteinFigure 4 ), indicating that MdCIK2 (gene MdCIK2 encodes protein) is located on the cell membrane of the plant, which is consistent with its localization characteristics as a receptor-like kinase.

[0045] Example 6 This example gives the transient silencing and overexpression analysis of gene MdCIK2 in apple tissue culture seedlings 6.1 First, construct the gene MdCIK2 silencing vector.

[0046] Clone the gene MdCIK2 into the pK7GWIWG2D (II) vector to construct the gene MdCIK2 silencing vector. Use the Gateway BP Clonase enzyme and the Gateway LR Clonase enzyme (Invitrogen, USA) to construct by the Gateway recombination cloning technology. First, catalyze the in vitro recombination of DNA fragments from cloning (containing attB site) and donor vector (pDONR222 vector, containing attP site) by BP Clonase enzyme to generate entry clones and sequence the entry clones using M13-F primer. Then, catalyze the in vitro recombination of the correctly sequenced entry clones (containing the target gene with attL site) and pK7GWIWG2D (II) vector (containing attR site) by LR Clonase enzyme to generate expression clones. The reaction system is as follows: 1 μL DNA fragment / entry clone; 0.5 μL donor vector / target vector; 1 μL TE Buffer (pH 8.0); 0.5 μL BP / LR Clonase II, 25°C water bath overnight, the next day transform E. coli competent DH5α, and after single colony growth, perform colony PCR detection, and further shake the single colony that meets the expected detection. Use the plasmid extraction kit to extract the plasmid in E. coli and send it to Shanghai Shengong Biotechnology Co., Ltd. for sequencing comparison. The correctly sequenced vector is transformed into Agrobacterium EHA105 competent cells using the method of Example 5 for subsequent transient silencing experiments. The pCAMBIA1302-MdCIK2 Agrobacterium constructed in Example 5 is used for overexpression experiments.

[0047] Inoculate Agrobacterium carrying the target plasmid into LB medium containing kanamycin (50 μg / mL) and rifampicin (25 μg / mL), and incubate in a 28°C incubator at 220 rpm constant temperature oscillation overnight. Then centrifuge at 6000 rpm, room temperature for 3 min to collect the bacterial cells, and repeat washing the bacterial cells with MES buffer for 3 times. Add MES buffer to resuspend the bacterial cells, adjust OD 600For 0.6-0.8 room temperature, avoid light, stand for 2-3 h. 4-5 weeks old apple tissue culture seedlings are infiltrated in Agrobacterium liquid carrying the plasmid of interest and placed in a closed vacuum box for vacuum infiltration, 5 min each time, 2 times. Subsequently, the apple tissue culture seedlings are inserted back into the MS medium for continuous culture for 3 d to silence the target gene or overexpress the target gene in the apple tissue culture seedlings.

[0048] 6.2 Apple leaf gene MdCIK2 silencing and overexpression analysis The total RNA of pK7 empty, pK7-MdCIK2, pCAMBIA1302-GFP, and pCAMBIA1302-MdCIK2 infected apple leaves after 3 d is extracted, and the cDNA of different samples is obtained after reverse transcription. The expression amount of the gene MdCIK2 in different samples is detected by the method of Example 4. Three biological replicates and three experimental replicates are taken for each treatment.

[0049] The quantitative results show that, compared with the control pK7 empty, the expression amount of the gene MdCIK2 after pK7-MdCIK2 infecting apple leaves for 3 d is down-regulated by 53% (P < 0.05) (Fig. 6A), which meets the silencing requirement. Compared with the control pCAMBIA1302-GFP, the expression amount of pCAMBIA1302-MdCIK2 after infecting apple leaves for 3 d is up-regulated by 23.8 times (P < 0.05) (Fig. 6B), which meets the overexpression requirement. Figure 5 Figure 6

[0050] 6.3 Gene MdCIK2 response V. mali Infection functional analysis After it is clear that the target gene meets the silencing and overexpression conditions, apple leaf inoculation experiments are performed. First, PDA plate medium is used to activate V. mali , and the activated V. mali is used for inoculation. A 2 mm diameter puncher is used to take a fungus cake at the edge of the colony, and the fungus cake is pasted on the position of the wound, and water is sprayed and moisturized. 24-36 hours after inoculation, the leaves are photographed according to the disease condition, and the ImageJ software is used to count the lesion area. At least 6 biological replicates and 3 experimental replicates are used for each treatment.

[0051] The results show that, after silencing the gene MdCIK2, the disease condition of the apple tissue culture seedling leaves is significantly reduced (P < 0.05) (Fig. 7A), and the lesion area is significantly smaller (P < 0.05) (Fig. 7B) compared with the empty vector control. Figure 5 Figure 5 ​​​Middle C). Compared with the control group overexpressing GFP, the leaves of apple tissue culture seedlings with overexpressed MdCIK2 showed more severe disease ( Figure 6 Middle B), the lesion area is significantly larger than that of the control ( Figure 6 Middle C).

[0052] Example 7 This example provides an analysis of defense-related gene expression in apples after overexpression of the gene MdCIK2. Using cDNA from apple leaves overexpressing pCAMBIA1302-GFP and pCAMBIA1302-MdCIK2 as templates, RT-qPCR was used to detect the expression of apple defense-related genes MdPR1, MdPR2, MdPR5, MdWRKY33, and MdRBOHD. The results showed that compared with the control, the expression of the above five apple defense-related genes was significantly downregulated after overexpression of MdCIK2 ( Figure 7 ).

[0053] It should be noted that the apple receptor kinase gene MdCIK2 located in the cell membrane plays a key role in apple response. V. mali The expression is upregulated in the early stage of infection, and the disease resistance of apple to rot is negatively regulated. The source of the gene is clarified in Example 1. Example 2 gives the cloning method of the gene. Example 3 found that MdCIK2 has a close evolutionary relationship with the Cucurbitaceae plant cucumber XP_004146714.1 protein through phylogenetic analysis of 15 plants in 8 common families. However, at present, there have been relevant research reports on the function of CIK family receptor kinases in the Cruciferae plant Arabidopsis thaliana in regulating plant growth and development, but the function of this family gene in negatively regulating plant disease resistance has not been reported. Example 4 clarifies the role of this gene in apple response V. mali In the early stage of infection, the expression is upregulated. Example 5 clearly shows that MdCIK2 is located on the cell membrane of plants, which is consistent with its localization characteristics as a receptor-like kinase. In Example 6, after silencing and overexpressing the gene MdCIK2, the V. mali The results of pathogenic phenotype and disease area statistics indicate that this gene negatively regulates apple's resistance to rot. Example 7 shows that overexpression of MdCIK2 significantly downregulated the expression of apple defense-related genes, indicating that this gene negatively regulates apple immunity.

[0054] In summary, the discovery of the negatively regulating apple rot gene MdCIK2 provides important genetic resources for apple disease resistance breeding and an important material basis for the green and long-term prevention and control of apple tree rot.

[0055] The above-described embodiments are merely some of the embodiments of the present application, but not all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but to express selected embodiments of the application. All other embodiments obtained by those of ordinary skill in the art based on the concept of the present application, without making creative labor, are within the scope of the present application.

Claims

1. Application of the receptor-like kinase gene MdCIK2 in regulating disease resistance of apple, characterized in that, Comprising: a) silencing the said receptor-like kinase gene MdCIK2 to improve the resistance of apple to Valsa mali; or b) silencing a specific gene fragment of the said receptor-like kinase gene MdCIK2 to improve the resistance of apple to Valsa mali; The CDS sequence of the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The nucleotide sequence of the specific gene fragment of the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:

2.

3. Use according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:

3.

4. Use according to claim 1, characterized in that, The said Valsa mali is caused by fungi of Ascomycota.

5. Anti-Ascomycota fungi of the genus Valosin-containing protein (VCP) Valsa mali Method for breeding an apple variety, characterized in that, The step of silencing the receptor-like kinase gene MdCIK2; The CDS sequence of the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:

1.

6. The breeding method according to claim 5, characterized by, The amino acid sequence of the protein encoded by the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:

3.

7. The breeding method according to claim 5, characterized by, The receptor-like kinase gene MdCIK2 in apple is resistant to Ascomycota fungus of Physalacria Valsa mali has a negative regulatory effect in immune response.

8. The breeding method according to claim 5, characterized by, Silencing the said receptor-like kinase gene MdCIK2 to improve the resistance of apple to Valsa mali.

9. The breeding method according to claim 5, characterized by, Overexpressing the said receptor-like kinase gene MdCIK2 to reduce the resistance of apple to Valsa mali.

10. Use of the class receptor kinase gene MdCIK2 for breeding resistance to fungi of the order of Ascomycetae of the genus Valsa Valsa mali In apple varieties, characterized by, The CDS sequence of the said receptor-like kinase gene MdCIK2 is shown as SEQ ID NO:1.

Images