Novel carnosine synthase and method for producing carnosine using same

Abstract

The present application relates to polypeptides having carnosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising any one or more of the polypeptide, the polynucleotide, and a vector comprising the polynucleotide; variant polypeptides having carnosine synthase activity; a polynucleotide encoding the variant polypeptide; a microorganism comprising any one or more of the variant polypeptide, the polynucleotide, and a vector comprising the polynucleotide; a composition for producing carnosine, the composition comprising any one or more of a polypeptide having carnosine synthase activity, the variant polypeptide, the microorganism, and a culture product of the microorganism; a method for producing carnosine using any one or more of a polypeptide having carnosine synthase activity, the variant polypeptide, and the microorganism; and polypeptides having carnosine synthase activity, the use of the variant polypeptides and the microorganisms for the production of carnosine.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to a polypeptide having a sarcosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising any one or more of the polypeptide, the polynucleotide, and a vector comprising the polynucleotide; a variant polypeptide having a sarcosine synthase activity; a polynucleotide encoding the variant polypeptide; a microorganism comprising any one or more of the variant polypeptide, the polynucleotide, and a vector comprising the polynucleotide; a composition for producing sarcosine, the composition comprising any one or more of a polypeptide having a sarcosine synthase activity, the variant polypeptide, the microorganism, and a culture of the microorganism; a method for producing sarcosine using any one or more of a polypeptide having a sarcosine synthase activity, the variant polypeptide, and the microorganism; and use of a polypeptide having a sarcosine synthase activity, the variant polypeptide, and the microorganism for producing sarcosine. BACKGROUND

[0002] Sarcosine is present in muscle and brain tissues in high concentrations, and is known as a physiologically active peptide having an antioxidant effect and a muscle fatigue improvement effect.

[0003] Production of sarcosine can be achieved by enzyme conversion (US 4359416 A). However, since it requires a large amount of substrate and ATP, there is a problem that industrial mass production of sarcosine is not easy in terms of cost. SUMMARY

[0004] [PROBLEMS TO BE SOLVED BY THE INVENTION]

[0005] The problem to be solved by the present disclosure is to provide a polypeptide having a sarcosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising any one or more of the polypeptide, the polynucleotide, and a vector comprising the polynucleotide; a variant polypeptide having a sarcosine synthase activity; a polynucleotide encoding the variant polypeptide; a microorganism comprising any one or more of the variant polypeptide, the polynucleotide, and a vector comprising the polynucleotide; a composition for producing sarcosine, the composition comprising any one or more of a polypeptide having a sarcosine synthase activity, the variant polypeptide, the microorganism, and a culture of the microorganism; a method for producing sarcosine using any one or more of a polypeptide having a sarcosine synthase activity, the variant polypeptide, and the microorganism; and use of a polypeptide having a sarcosine synthase activity, the variant polypeptide, and the microorganism for producing sarcosine.

[0006] [TECHNICAL SOLUTION]

[0007] The present disclosure aims to provide a polypeptide having a sarcosine synthase activity, the polypeptide comprising an amino acid sequence of SEQ ID NO: 2.

[0008] Another object of the present disclosure is to provide a polynucleotide encoding a polypeptide having a creatinine synthase activity.

[0009] Another object of the present disclosure is to provide a microorganism including any one or more of a polypeptide having a creatinine synthase activity, a polynucleotide encoding the polypeptide, and a vector including the polynucleotide.

[0010] Another object of the present disclosure is to provide a variant polypeptide having a creatinine synthase activity, wherein an amino acid corresponding to position 108 and an amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 are substituted with different amino acids.

[0011] Another object of the present disclosure is to provide a polynucleotide encoding the variant polypeptide.

[0012] Another object of the present disclosure is to provide a microorganism including any one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector including the polynucleotide.

[0013] Another object of the present disclosure is to provide a composition for producing creatinine, the composition including any one or more of a polypeptide having a creatinine synthase activity; a microorganism including any one or more of a polypeptide having a creatinine synthase activity, a polynucleotide encoding the polypeptide, and a vector including the polynucleotide; a culture of the microorganism; the variant polypeptide; a microorganism including any one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector including the polynucleotide; and a culture of the microorganism.

[0014] Another object of the present disclosure is to provide a method of producing creatinine, the method including a step of culturing a microorganism.

[0015] Another object of the present disclosure is to provide a use of a polypeptide having a creatinine synthase activity, a variant polypeptide, and a microorganism for producing creatinine.

[0016] [Advantageous Effects]

[0017] Using the polypeptide having a creatinine synthase activity, the variant polypeptide, the polynucleotide, the microorganism, the composition, and / or the method of the present disclosure, efficient production of creatinine is possible. DETAILED DESCRIPTION

[0018] The present disclosure will be described in detail below. Meanwhile, each description and embodiment disclosed in the present disclosure can also be applied to other descriptions and embodiments. That is, all combinations of various elements disclosed in the present disclosure fall within the scope of the present disclosure. Furthermore, the scope of the present disclosure is not limited by the detailed description below.

[0019] Furthermore, those of ordinary skill in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. In addition, such equivalents are intended to be within the scope of the present disclosure.

[0020] In addition, numerous papers and patent documents are referenced and cited throughout the specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entireties to further delineate the level and scope of the subject matter of the present disclosure.

[0021] One aspect of the present disclosure provides a polypeptide having a carnosine synthase activity, the polypeptide comprising an amino acid sequence of SEQ ID NO: 2.

[0022] As used herein, the term "carnosine synthase" refers to an enzyme capable of catalyzing a reaction of producing carnosine using beta-alanine and L-histidine as substrates, and belongs to the ligase family, and thus can be used interchangeably with L-ligase and LAL. Specific examples of the carnosine synthase can include an enzyme containing the amino acid sequence of SEQ ID NO: 2, but are not limited thereto.

[0023] As used herein, the term "polypeptide having a carnosine synthase activity" refers to a polypeptide having a carnosine synthase activity, the polypeptide comprising an amino acid sequence of SEQ ID NO: 2.

[0024] In one embodiment, the polypeptide having a carnosine synthase activity in the present disclosure can include the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having 60% or more homology or identity thereto, but is not limited thereto, as long as it has a carnosine synthase activity. The amino acid sequence can be a polypeptide including the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto, and can have or include an amino acid sequence having the above homology or identity, or can consist of the amino acid sequence, or can consist essentially of the amino acid sequence. It is not known whether SEQ ID NO: 2 has a carnosine synthase activity, but the amino acid sequence of SEQ ID NO: 2 itself can be obtained from GenBank of NCBI or a known database, Kyoto Encyclopedia of Genes and Genomes (KEGG). For example, the polypeptide having a carnosine synthase activity can be from Streptococcus or Streptococcus pneumoniae, but is not limited thereto.

[0025] Further, in the present disclosure, although the protein including the amino acid sequence of SEQ ID NO: 2 is defined as one example of the creatinine synthase, it is also apparent that a polypeptide having an amino acid sequence with a deletion, modification, substitution, or addition of certain sequences also falls within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits the same or corresponding activity as the protein consisting of the amino acid sequence of SEQ ID NO: 2. Examples thereof do not exclude the addition of a sequence that does not change the function of the protein, a mutation that can occur naturally, a silent mutation or a conservative substitution thereof upstream or downstream of the amino acid sequence of SEQ ID NO: 2, and it is apparent that even a protein having such a sequence addition or mutation also falls within the scope of the present disclosure, as long as it has the same or corresponding activity as the protein.

[0026] Further, the creatinine synthase protein having the amino acid sequence of SEQ ID NO: 2 can be encoded by a polynucleotide having or including the sequence of SEQ ID NO: 11 or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 11, or consisting of or consisting essentially of the sequence of SEQ ID NO: 11 or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence of SEQ ID NO: 11, but is not limited thereto.

[0027] Another aspect of the present disclosure provides a variant polypeptide having creatinine synthase activity, wherein any one or more of the amino acid corresponding to position 108 and the amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 is substituted with a different amino acid.

[0028] As used herein, the term "variant polypeptide having creatinine synthase activity" refers to a variant polypeptide having creatinine synthase activity, wherein any one or more of the amino acid corresponding to position 108 and the amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 is substituted with a different amino acid. In the present disclosure, "variant polypeptide having creatinine synthase activity" can be used interchangeably with "variant polypeptide".

[0029] In one embodiment, the reference creatinine synthase subjected to mutation in the present disclosure is the same as the above-described polypeptide having creatinine synthase activity.

[0030] As used herein, the term "variant" refers to a polypeptide or protein in which one or more amino acids differ in conservative substitution and / or modification from the amino acids of the sequence, but maintains the function or property of the polypeptide or protein.

[0031] Such variants can generally be identified by modifying one or more amino acids of the amino acid sequence of the polypeptide or protein and evaluating the properties of the modified polypeptide or protein. In other words, the ability of the variant can be increased, unchanged, or decreased compared to the protein before the change. In addition, some variants can include variants in which one or more portions such as an N-terminal leader sequence or a transmembrane domain have been removed. Other variants can include variants in which a portion of the N- and / or C-terminus has been removed from the mature protein. The term "variant" can be used interchangeably with terms such as modified, modified polypeptide, modified protein, mutant, mutant protein, and difference, and is not limited thereto, as long as it is a term having the meaning of variation.

[0032] As used herein, "conservative substitution" refers to substitution of one amino acid with another amino acid having similar structure and / or chemical properties. In general, a conservative substitution can have little or no effect on the activity of the resulting protein or polypeptide. In addition, a variant can have one or more conservative substitutions while still retaining one or more biological activities.

[0033] Such amino acid substitution can generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. In addition, amino acids can be classified into amino acids with charged side chains and amino acids with uncharged side chains. Amino acids with charged side chains include aspartic acid, glutamic acid, lysine, arginine, and histidine. Amino acids with uncharged side chains can be further classified into non-polar amino acids or polar amino acids, wherein non-polar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, but are not limited thereto.

[0034] In addition, the polypeptide having a camosine synthase activity and the variant polypeptide having a camosine synthase activity can include deletion or addition of amino acids having minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a protein N-terminal signal (or leader) sequence involved in co-translational or post-translational involvement in protein translocation. In addition, the polypeptide can be conjugated with other sequences or linkers in order to identify, purify, or synthesize the polypeptide.

[0035] In one embodiment, the variant polypeptide of the present disclosure can be a variant polypeptide having a camosine synthase activity, in which the amino acid corresponding to the 108th amino acid from the N terminus of SEQ ID NO: 2 and the amino acid corresponding to the 378th amino acid are substituted with different amino acids.

[0036] As used herein, "substituted with different amino acids" is not limited as long as the substituted amino acid is different from the amino acid to be substituted. Meanwhile, in the present disclosure, when expressed as "a particular amino acid is substituted", it is obvious that the amino acid is substituted with an amino acid different from the amino acid before substitution, even if the amino acid substituted with a different amino acid is not separately indicated.

[0037] The "Nth" of the present disclosure can include the Nth and the amino acid position corresponding to the Nth. For example, the Nth can include an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a particular amino acid sequence. For example, the particular amino acid sequence can be the amino acid sequence of SEQ ID NO: 2.

[0038] As used herein, the term "corresponding to" refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue similar, identical, or homologous to a listed residue in a polypeptide. Identifying the amino acid at the corresponding position can be determining the particular amino acid in a sequence referring to a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related protein or a reference protein.

[0039] For example, any amino acid sequence is aligned with SEQ ID NO: 2, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 2. For example, a sequence alignment algorithm as described in the present disclosure can determine the position of an amino acid or the position where a modification such as substitution, insertion, or deletion occurs by comparing with a query sequence (also referred to as a "reference sequence").

[0040] In such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), etc. can be used, but are not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. can be appropriately used.

[0041] In one embodiment, the variant polypeptide of the present disclosure can include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% or more homology or identity to SEQ ID NO: 2, while fixing the amino acid corresponding to position 108 and the amino acid corresponding to position 378 in the amino acid sequence of SEQ ID NO: 2 by substitution with different amino acids.

[0042] In one embodiment of the above-described embodiment, the variant polypeptide of the present disclosure can include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% or more homology or identity to SEQ ID NO: 2, while fixing the amino acid corresponding to position 108 and the amino acid corresponding to position 378 in the amino acid sequence of SEQ ID NO: 2 by substitution with different amino acids. It is also obvious that a variant including an amino acid sequence having a deletion, modification, substitution, conservative substitution, or addition of certain sequences also falls within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits a corresponding activity to the variant polypeptide of the present disclosure.

[0043] In one embodiment, with respect to the variant polypeptide of the present disclosure, the amino acid corresponding to position 108 and the amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 are substituted with glutamic acid and lysine, respectively.

[0044] In one embodiment, with respect to the variant polypeptide of the present disclosure, aspartic acid (corresponding to the amino acid at position 108 from the N-terminus of SEQ ID NO: 2) and histidine (corresponding to the amino acid at position 378) are substituted with glutamic acid and lysine, respectively.

[0045] In one embodiment of the above-described embodiment, the variant polypeptide of the present disclosure can include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% or more homology or identity to SEQ ID NO: 2, while fixing the amino acid corresponding to position 108 and the amino acid corresponding to position 378 in the amino acid sequence of SEQ ID NO: 2 by substitution with different amino acids.

[0046] In one embodiment, the variant polypeptide of the present disclosure can include the amino acid sequence of SEQ ID NO: 8. The variant polypeptide of the present disclosure can have or include an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to SEQ ID NO: 8, or can consist of, or can consist essentially of, the amino acid sequence.

[0047] Further, with regard to the variant polypeptide of the present disclosure, it is also apparent that, in addition to the 108th and 378th amino acids, a protein including an amino acid sequence having a deletion, modification, substitution, conservative substitution, or addition of certain sequences also falls within the scope of the present disclosure, as long as the amino acid sequence has the same or corresponding activity to the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 8. Examples thereof do not exclude the addition of a sequence that does not change the function of the protein, a mutation that can occur naturally, a silent mutation thereof, or a conservative substitution, upstream or downstream of the amino acid sequence, as long as it has the same or corresponding activity to the activity of the variant polypeptide, and it is apparent that even a protein having such a sequence addition or mutation also falls within the scope of the present disclosure.

[0048] In one embodiment, the variant polypeptide of the present disclosure can have enhanced carnosine synthase activity compared to the polypeptide before modification, but is not limited thereto.

[0049] Another aspect of the present disclosure provides a polynucleotide encoding a polypeptide having carnosine synthase activity of the present disclosure.

[0050] Still another aspect of the present disclosure provides a polynucleotide encoding the variant polypeptide of the present disclosure.

[0051] As used herein, the term "polynucleotide" is a DNA or RNA chain having a certain length or more, which is a nucleotide polymer in which nucleotide monomers are linked into a long chain by a covalent bond, and more specifically, it refers to a polynucleotide fragment encoding a polypeptide and / or variant polypeptide having carnosine synthase activity.

[0052] The polynucleotide encoding the polypeptide and / or variant polypeptide having carnosine synthase activity of the present disclosure can include any polynucleotide sequence without limitation, as long as the polypeptide encoded thereby has the corresponding activity to the activity of the polypeptide and / or variant polypeptide having carnosine synthase activity of the present disclosure.

[0053] In consideration of codon degeneracy or preferred codons in organisms intended to express the polypeptide having a sarcosine synthase activity of the present disclosure and / or the variant polypeptide, the polynucleotide encoding the polypeptide having a sarcosine synthase activity of the present disclosure and / or the variant polypeptide can be variously modified in the coding region without changing the amino acid sequence of the polypeptide having a sarcosine synthase activity of the present disclosure and / or the variant polypeptide. Therefore, it is obvious that, in consideration of codon degeneracy or preferred codons in organisms intended to express the polypeptide having a sarcosine synthase activity of the present disclosure and / or the variant polypeptide, variants including polynucleotide sequences having deletion, modification, substitution, conservative substitution, or addition of certain sequences also fall within the scope of the present disclosure, as long as the polynucleotide sequence can encode the amino acid sequence of the polypeptide having a sarcosine synthase activity of the present disclosure and / or the variant polypeptide or a polypeptide having homology or identity thereto.

[0054] In one embodiment, the polynucleotide encoding the polypeptide having a sarcosine synthase activity of the present disclosure can have or include a nucleotide sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity to the sequence of SEQ ID NO: 11, or can consist of or consist essentially of the nucleotide sequence, but is not limited thereto.

[0055] For example, the polynucleotide encoding the polypeptide having a sarcosine synthase activity of the present disclosure can be SEQ ID NO: 11 or a degenerate sequence thereof.

[0056] In one embodiment, the polynucleotide encoding the variant polypeptide of the present disclosure can include a substitution of a codon encoding an amino acid corresponding to the amino acid at position 108 from the N-terminus of SEQ ID NO: 2 and a codon encoding an amino acid corresponding to the amino acid at position 378 with a codon encoding a different amino acid (e.g., glutamic acid or lysine) in a nucleotide sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity to the sequence of SEQ ID NO: 11, but is not limited thereto.

[0057] For example, with respect to a polynucleotide encoding a variant polypeptide of the present disclosure, a codon encoding an amino acid corresponding to the 108th amino acid from the N-terminus of SEQ ID NO: 2 and / or a codon encoding an amino acid corresponding to the 378th amino acid can be a codon encoding glutamic acid and / or a codon encoding lysine, respectively, in a nucleotide sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity to the sequence of SEQ ID NO: 11.

[0058] For another example, a polynucleotide encoding a variant polypeptide of the present disclosure can be SEQ ID NO: 17 or a degenerate sequence thereof.

[0059] In one embodiment, a polynucleotide encoding a variant polypeptide of the present disclosure can have or include SEQ ID NO: 17, or a nucleotide sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more, and less than 100% homology or identity to SEQ ID NO: 17, or can consist of or consist essentially of the nucleotide sequence, but is not limited thereto.

[0060] Further, a polynucleotide encoding a polypeptide having an allathionine synthase activity of the present disclosure and a polynucleotide encoding a variant polypeptide of the present disclosure can include a probe that can be prepared from a known gene sequence, for example, can include any sequence without limitation, as long as it is a sequence capable of hybridizing to a complement of all or a part of a polynucleotide sequence of the present disclosure under stringent conditions.

[0061] "Stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nded., Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). Examples thereof include conditions in which polynucleotides having a high degree of homology or identity, i.e., polynucleotides having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity, hybridize to each other, and polynucleotides having a low degree of homology or identity do not hybridize to each other, or conditions in which one washing is performed at a salt concentration and temperature equivalent to 60°C, 1x SSC, 0.1% SDS, specifically, 60°C, 0.1x SSC, 0.1% SDS, more specifically, 68°C, 0.1x SSC, 0.1% SDS, which are washing conditions of ordinary Southern hybridization.

[0062] Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between bases are allowed depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Thus, the polynucleotides of the present disclosure can include not only substantially similar nucleic acid sequences, but also isolated nucleic acid fragments that are complementary to the entire sequence.

[0063] Specifically, polynucleotides having homology or identity to the polynucleotides of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and the above conditions. In addition, the Tm value can be 60°C, 63°C, or 65°C, but is not limited thereto, and can be appropriately adjusted by a person skilled in the art according to the purpose.

[0064] The appropriate stringency of polynucleotide hybridization depends on the length and complementarity of the polynucleotides, and the variables are well known in the art (for example, J. Sambrook et al., supra).

[0065] As used herein, the terms "homology" or "identity" refer to the relatedness between two given amino acid sequences or base sequences, which can be expressed as a percentage. The terms "homology and identity" can generally be used interchangeably.

[0066] The sequence homology or identity of a conservative polynucleotide or polypeptide is determined by standard alignment algorithms and can use the default gap penalties established by the program used. Essentially, a homologous or identical sequence is typically capable of hybridizing to the entire or partial sequence under moderately or highly stringent conditions. It is clear that hybridization also includes the hybridization of a polynucleotide to a polynucleotide comprising the general codon or codons taking into account the codon degeneracy.

[0067] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program, for example using the default parameters as in Pearson et al., (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman program (version 5.0.0 or newer) of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) can be used (including the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the GCG program package ((Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.][F.,][ET AL, J Mol Biol 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.], Academic Press, San Diego, 1994 and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073). For example, homology, similarity or identity can be determined using the BLAST of the National Center for Biotechnology or ClustalW.

[0068] Homology, similarity or identity between polynucleotides or polypeptides can be determined by using the GAP computer program, as described by Needleman et al., (1970), J Mol Biol. 48:443), as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. Briefly, the GAP program defines homology, similarity or identity as the number of identical matched symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a binary comparison matrix (containing a value of 1 for identical matched symbols and 0 for non-identical matched symbols) and the weighted comparison matrix of Gribskov et al., (1986) Nucl. Acids Res. 14:6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix) as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or gap open penalty of 10 and gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, the term "homology" or "identity" as used herein represents the relatedness between sequences.

[0069] Another aspect of the present disclosure provides a vector comprising a polynucleotide encoding a polypeptide having a carnosine synthase activity of the present disclosure and / or the variant polypeptide.

[0070] The polynucleotide is as described in other aspects.

[0071] The vector can be an expression vector for expressing the polynucleotide in a microorganism, but is not limited thereto.

[0072] As used herein, the term "vector" can include a DNA construct comprising a nucleotide sequence of a polynucleotide encoding a polypeptide of interest operably linked to suitable expression regulatory regions (or expression control sequences) so that the polypeptide of interest can be expressed in a suitable host. The expression regulatory regions can include a promoter capable of initiating transcription, any operator sequence controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences controlling termination of transcription and translation. The vector can be transformed into a suitable microorganism and then replicate independently of the host genome or function as an episome, or can be integrated into the genome itself.

[0073] The vector used in the present disclosure is not particularly limited, but any vector known in the art can be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a bacteriophage vector or a cosmid vector, and pDZ system, pBR system, pUC system, pBluescriptII system, pGEM system, pTZ system, pCL system, pET system, etc. can be used as a plasmid vector. Specifically, pDZ (Korean Patent Publication No. 10-0924065 and International Publication No. 2008-033001), pDZTn (Korean Patent Publication No. 10-1126041), pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector, etc. can be used.

[0074] For example, the polynucleotide encoding the polypeptide of interest can be inserted into the chromosome through a vector for intracellular chromosomal insertion. The polynucleotide can be inserted into the chromosome by any method known in the art, for example, homologous recombination, but is not limited thereto. The vector can further include a selection marker for confirming chromosomal insertion. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the nucleic acid molecule of interest, and a marker that confers a selectable phenotype such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface polypeptide can be used. Only cells expressing the selection marker survive or exhibit other phenotypic traits in an environment treated with a selection agent, and thus transformed cells can be selected.

[0075] As used herein, the term "transformation" refers to the introduction of a vector including a polynucleotide encoding a target polypeptide into a microorganism, so that the polypeptide encoded by the polynucleotide can be expressed in the microorganism. The transformed polynucleotide can be positioned either by insertion into the chromosome of the microorganism, regardless of the location, or can be located outside the chromosome, as long as it can be expressed in the microorganism. In addition, the polynucleotide includes DNA and / or RNA encoding the polypeptide of interest. The polynucleotide can be introduced in any form as long as it can be introduced into the microorganism and expressed. For example, the polynucleotide can be introduced into the microorganism in the form of an expression cassette, which is a genetic construct including all elements necessary for self-expression. The expression cassette can typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the polynucleotide. The expression cassette can be in the form of an expression vector capable of self-replication. In addition, the polynucleotide can be introduced into the microorganism in its own form and can be operably linked to sequences required for expression in the microorganism, but is not limited thereto.

[0076] Methods of transforming the vectors of the present disclosure include any method of introducing a nucleic acid into a cell, and can be performed according to the host cell by selecting appropriate standard techniques known in the art. For example, the method can include electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method, etc., but is not limited thereto.

[0077] Further, the term "operably linked" means that a polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding a polypeptide having a sarcosine synthase activity of the present disclosure and / or a variant polypeptide.

[0078] Still another aspect of the present disclosure provides a microorganism including any one or more of a polypeptide having a sarcosine synthase activity of the present disclosure, a polynucleotide encoding the polypeptide, and a vector including the polynucleotide.

[0079] Still another aspect of the present disclosure provides a microorganism including any one or more of a variant polypeptide of the present disclosure, a polynucleotide encoding the variant polypeptide, and a vector including the polynucleotide.

[0080] The polypeptide having a sarcosine synthase activity, the variant polypeptide, the polynucleotide, and the vector are as described in other aspects.

[0081] As used herein, the term "microorganism (or strain)" includes all wild-type microorganisms or naturally or artificially genetically modified microorganisms, and it can be a microorganism in which a specific mechanism is weakened or enhanced due to insertion of an exogenous gene or activity enhancement or inactivation of an endogenous gene, and it can be a microorganism including a genetic modification for producing sarcosine. As used herein, "strain" and "microorganism" have the same meaning, and can be used interchangeably without limitation.

[0082] The microorganism of the present disclosure may be a microorganism into which the panD gene encoding the aspartate 1-decarboxylase protein required for converting aspartate to β-alanine is introduced to exhibit protein activity or enhance the activity, thereby enabling a microorganism that does not originally have the ability to produce carnosine to have the ability to produce carnosine, or enabling a microorganism that has the ability to produce carnosine to have the ability to produce carnosine further enhanced. The aspartate 1-decarboxylase protein is not limited, as long as it is a protein that exhibits the same or similar activity as the aspartate 1-decarboxylase protein. As a specific example, the aspartate 1-decarboxylase protein can consist of or include the amino acid sequence of SEQ ID NO: 9, but can also consist of or include an amino acid sequence having the activity corresponding to aspartate 1-decarboxylase (while having at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity with the amino acid sequence). It is also obvious that proteins with certain sequence deletions, modifications, substitutions or additions are included in aspartate 1-decarboxylase, as long as the protein has homology or identity and exhibits the activity corresponding to aspartate 1-decarboxylase activity. In addition, as a specific example, the polynucleotide encoding the aspartate 1-decarboxylase protein can consist of or include the sequence of SEQ ID NO: 18. Taking into account codon degeneracy or preferred codons in the disclosed microorganisms, the polynucleotides may be modified in various ways in the coding region without altering the amino acid sequence. Specifically, the polynucleotides may consist of the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 18, or comprise the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity to the sequence of SEQ ID NO: 18, but are not limited thereto.

[0083] In one embodiment, the microorganism of the present disclosure can be a microorganism of the genus Enterobacter, Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, or Brevibacterium. More specifically, it can be a microorganism of the genus Corynebacterium, but is not limited thereto.

[0084] In one embodiment of the above-described embodiment, the microorganism of the present disclosure can be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, it can be Corynebacterium glutamicum, but is not limited thereto.

[0085] In one embodiment of the microorganism of the present disclosure, any one or more of the polypeptide having a sarcosine synthase activity of the present disclosure, the polynucleotide encoding the same, and the vector including the same can have further enhanced activity of AroP (aromatic amino acid transporter) protein, but is not limited thereto.

[0086] In one embodiment of the above-described embodiment, in the microorganism including any one or more of the polypeptide having a sarcosine synthase activity of the present disclosure, the polynucleotide encoding the same, and the vector including the same, the sarcosine production ability can be increased by further enhancing the activity of AroP protein.

[0087] In one embodiment of the microorganism of the present disclosure, the microorganism including any one or more of the variant polypeptide of the present disclosure, the polynucleotide encoding the variant polypeptide, and the vector including the polynucleotide can have further enhanced AroP protein activity, but is not limited thereto.

[0088] In one embodiment of the above embodiment, in the microorganism including any one or more of the variant polypeptide of the present disclosure, the polynucleotide encoding the variant polypeptide, and the vector including the polynucleotide, the production ability of carnosine can be increased by further enhancing the activity of the AroP protein.

[0089] As used herein, the term "AroP protein" refers to an aromatic amino acid transporter protein, and can be used interchangeably with "AroP". The aromatic amino acid can include phenylalanine, tryptophan, and tyrosine. In addition, AroP can be encoded by the aroP gene, but is not limited thereto.

[0090] In one embodiment, the AroP protein of the present disclosure can include the amino acid sequence of SEQ ID NO: 19 or an amino acid sequence having 60% or more homology or identity thereto, but is not limited thereto. The amino acid sequence can be a polypeptide including SEQ ID NO: 19 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. The sequence of SEQ ID NO: 19 can be obtained from GenBank of NCBI or a known database, Kyoto Encyclopedia of Genes and Genomes (KEGG). For example, the AroP protein whose activity is enhanced can be from the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto.

[0091] In addition, in the present disclosure, although the protein including the amino acid sequence of SEQ ID NO: 19 is defined as one example of the AroP protein, it is also obvious that a polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, or added also falls within the scope of the AroP protein of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits the same or corresponding activity as that of the protein consisting of the amino acid sequence of SEQ ID NO: 19. Examples thereof do not exclude the addition of a sequence that does not change the function of the protein, a mutation that can occur naturally, a silent mutation or a conservative substitution thereof, upstream or downstream of the amino acid sequence of SEQ ID NO: 19, and it is obvious that even a protein having such a sequence addition or mutation also falls within the scope of the present disclosure, as long as it has the same or corresponding activity as that of the protein.

[0092] In addition, the AroP protein having the amino acid sequence of SEQ ID NO: 19 can be encoded by a polynucleotide having or comprising the sequence of SEQ ID NO: 20 or a nucleotide sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity thereto, or consisting of or consisting essentially of the nucleotide sequence, but is not limited thereto.

[0093] As used herein, the term "enhancement" of the activity of a polypeptide or protein means an increase in the activity of the polypeptide or protein compared to the intrinsic activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, and increase. Activation, enhancement, upregulation, overexpression, and increase can include showing an activity that was not originally present and showing an increased activity compared to the intrinsic activity or the activity before modification.

[0094] "Intrinsic activity" means the activity of a specific polypeptide or protein that a parent strain or unmodified microorganism originally had before a change in the trait due to genetic variation caused by natural or artificial factors. This can be used interchangeably with "activity before modification". The fact that the activity of a polypeptide or protein is "enhanced", "upregulated", "overexpressed", or "increased" compared to the intrinsic activity means that the activity of the polypeptide is improved compared to the activity and / or concentration (expression level) of the specific polypeptide or protein that the parent strain or unmodified microorganism originally had before a change in the trait.

[0095] This enhancement can be achieved by introducing an exogenous polypeptide or protein or enhancing the activity and / or concentration (expression level) of an exogenous and / or endogenous polypeptide or protein. Enhancement of the activity of a polypeptide or protein can be confirmed by an increase in the degree of activity and expression level of the corresponding polypeptide or protein or an increase in the amount of product produced by the corresponding protein.

[0096] In order to enhance the activity of a polypeptide or protein, various methods well known in the art can be applied, and the method is not limited as long as the activity of the polypeptide or protein of interest can be enhanced compared to the microorganism before modification. Specifically, genetic engineering and / or protein engineering well known to those skilled in the art, which are conventional methods of molecular biology, can be used, but the method is not limited thereto (for example, Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al., Molecular Cloning 2012, etc.).

[0097] Specifically, the enhancement of the activity of the polypeptide or protein in the present disclosure can be:

[0098] 1) increasing the intracellular copy number of the polynucleotide encoding the polypeptide or protein;

[0099] 2) replacing the gene expression regulatory region on the chromosome encoding the polypeptide or protein with a sequence showing strong activity;

[0100] 3) modifying the nucleotide sequence of the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide or protein;

[0101] 4) modifying the amino acid sequence of the polypeptide or protein to enhance the activity of the polypeptide or protein;

[0102] 5) modifying the polynucleotide sequence encoding the protein to enhance the activity of the polypeptide or protein (e.g., modifying the polynucleotide sequence of the protein gene to encode a protein whose activity is enhanced after modification);

[0103] 6) introducing an exogenous protein showing the activity of the polypeptide or protein or an exogenous polynucleotide encoding the same;

[0104] 7) codon optimization of the polynucleotide encoding the polypeptide or protein;

[0105] 8) analyzing the tertiary structure of the polypeptide or protein to select and modify or chemically modify exposed sites; or

[0106] 9) a combination of two or more selected from 1) to 8), but not limited thereto.

[0107] In the above, the increase in the gene copy number can be performed in the form of being operably linked to a vector or by being inserted into the chromosome of a host cell, but is not particularly limited thereto. Specifically, a vector can be introduced into a host cell, the vector being operably linked to a polynucleotide encoding a protein of the present disclosure and being capable of replicating and functioning independently of the host cell. Alternatively, a vector operably linked to a polynucleotide and capable of inserting the polynucleotide into the chromosome of a host cell can be introduced into the chromosome of a host cell. The polynucleotide can be inserted into the chromosome by any method known in the art, such as homologous recombination.

[0108] Next, the modification of the expression regulatory sequence to increase the expression of the polynucleotide can be performed by, but not particularly limited to, inducing a variation in the nucleotide sequence due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacing with a nucleotide sequence having stronger activity to further enhance the activity of the expression regulatory sequence. The expression regulatory sequence can include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling transcription and translation termination, etc.

[0109] A strong promoter instead of an original promoter can be attached to the upstream of the polynucleotide expression unit, but is not limited thereto. Examples of the known strong promoter include CJ1 to CJ7 promoters (used interchangeably with cj1 to cj7, respectively; U.S. Patent No. US7662943 B2), pyk promoter, lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. Patent No. US10584338 B2), O2 promoter (U.S. Patent No. US10273491 B2), tkt promoter, yccA promoter, etc., but are not limited thereto.

[0110] Further, the modification of the polynucleotide sequence on the chromosome can be performed by, but not particularly limited to, inducing a variation of the expression regulatory sequence due to a deletion, an insertion, a non-conservative or conservative substitution, or a combination thereof, or replacing with a polynucleotide sequence improved to have a stronger activity, thereby further enhancing the activity of the polynucleotide sequence.

[0111] In one embodiment, regarding the variant polypeptide having a camosine synthase activity of the present disclosure, the amino acid sequence of the unmodified polypeptide having a camosine synthase activity (e.g., SEQ ID NO: 2) is modified to enhance its activity, thereby enhancing the camosine synthase activity of the variant polypeptide. In the present disclosure, the polypeptide and the variant polypeptide having a camosine synthase activity can be further enhanced (e.g., replacement of the sequence of the gene expression regulatory region thereof).

[0112] In another embodiment, regarding the activity of the AroP protein of the present disclosure, the promoter of one of the gene expression regulatory regions on the chromosome encoding the AroP protein can be replaced with a sequence having a stronger activity (e.g., replacing the wild-type promoter in the expression regulatory region of aroP with a pyk or CJ7 promoter), but is not limited thereto.

[0113] In one embodiment, the microorganism of the present disclosure can produce camosine.

[0114] As used herein, the term "camosine" refers to a dipeptide consisting of β-alanine and L-histidine.

[0115] As used herein, the term "microorganism producing camosine" refers to a prokaryotic or eukaryotic microorganism capable of producing camosine in vivo, and can include a microorganism prepared by providing a parent strain having no camosine production ability or a microorganism inherently having camosine production ability with camosine production ability. The camosine production ability can be conferred or enhanced by strain improvement.

[0116] For example, the microorganism of the present disclosure can be a microorganism naturally having a polypeptide having a camosine synthase activity, a variant polypeptide having a camosine synthase activity, and / or a microorganism having a camosine production ability; or a microorganism in which a variant polypeptide having a camosine synthase activity of the present disclosure, a polynucleotide encoding the same (or a vector including the same), a variant of the present disclosure or a polynucleotide encoding the same (or a vector including the same) is introduced, and / or a parent strain not having a polypeptide having a camosine synthase activity of the present disclosure is provided with a camosine production ability, the variant polypeptide, and / or the ability to produce camosine (is conferred with the same), but is not limited thereto. In addition, the microorganism of the present disclosure can include all microorganisms including a polypeptide sequence having a camosine synthase activity of the present disclosure due to a mutation of a gene on a chromosome encoding a polypeptide having a camosine synthase activity, microorganisms including a variant polypeptide sequence having a camosine synthase activity of the present disclosure, and microorganisms including a polypeptide and / or a variant polypeptide having a camosine synthase activity of the present disclosure by introducing a vector including a polynucleotide encoding a polypeptide having a camosine synthase activity of the present disclosure and / or a variant polypeptide.

[0117] For another example, the microorganism of the present disclosure can be a microorganism having an AroP protein with naturally enhanced activity; a microorganism having a wild-type AroP; or a microorganism prepared by enhancing AroP in a parent strain without an AroP protein, but is not limited thereto. In addition, the microorganism of the present disclosure can include all microorganisms enhancing AroP due to a mutation of a regulatory region of an aroP gene, and microorganisms enhancing AroP of the present disclosure due to introduction of a vector including an aroP gene.

[0118] As used herein, the term "unmodified microorganism" does not exclude a strain including a mutation that can occur naturally in the microorganism, and can be a wild-type strain or a natural strain itself, or can be a strain before a trait is changed by genetic variation due to natural or artificial factors. For example, the unmodified microorganism can be a strain in which a polypeptide or a variant polypeptide having a camosine synthase activity described herein has not been introduced or has not been introduced yet. The term "unmodified microorganism" can be used interchangeably with "strain before modification," "microorganism before modification," "unvaried strain," "unmodified strain," "unvaried microorganism," or "reference microorganism."

[0119] For example, the microorganism having increased carnosine production ability can have about 1% or more, specifically, 30% or more of increased carnosine production ability compared to the parent strain before modification or the unmodified microorganism. However, it is not limited thereto as long as the microorganism has increased + value ability compared to the parent strain before modification or the unmodified microorganism. As another example, the recombinant strain having increased carnosine production ability can have about 1.01 times or more, specifically, about 1.30 times or more of increased carnosine production ability compared to the parent strain before modification or the unmodified microorganism, but is not limited thereto. As used herein, the term "about" refers to a range including all ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values equivalent or similar to the value after the term "about", but the range is not limited thereto.

[0120] For another example, the unmodified microorganism that is the target strain for comparing whether the carnosine production ability of the present disclosure is increased can be a wild-type Corynebacterium glutamicum strain ATCC 13032, but is not limited thereto.

[0121] In one embodiment, the microorganism including the polypeptide having carnosine synthase activity of the present disclosure, the polynucleotide encoding the same, or the vector including the same can have increased carnosine production ability compared to the microorganism including any one of the polypeptides of SEQ ID NOs: 1 and 3 to 7, the polynucleotide encoding the same, or a combination thereof, but is not limited thereto. The polynucleotides of SEQ ID NOs: 10 and 12 to 16 of the present disclosure can encode the polypeptides of SEQ ID NOs: 1 and 3 to 7, respectively, and the polypeptides of SEQ ID NOs: 1 and 3 to 7 can be encoded by the polynucleotides of SEQ ID NOs: 10 and 12 to 16, respectively, but are not limited thereto.

[0122] In one embodiment, the variant polypeptide, the polynucleotide encoding the same, or the microorganism including the same of the present disclosure can have increased carnosine production ability compared to the microorganism including any one of the polypeptides of SEQ ID NOs: 1 to 7 or the polynucleotide encoding the same, or a combination thereof, but is not limited thereto.

[0123] In one embodiment, the microorganism in which the activity of the AroP protein is further enhanced can have enhanced carnosine production ability compared to the microorganism in which the activity of the AroP protein is not enhanced.

[0124] Another aspect of the present disclosure provides a composition for producing a carnosine, the composition including any one or more of: a polypeptide having carnosine synthase activity of the present disclosure; a microorganism including any one or more of a polypeptide having carnosine synthase activity of the present disclosure, a polynucleotide encoding the polypeptide, and a vector including the polynucleotide; a culture of the microorganism; a variant polypeptide; a microorganism including any one or more of the variant polypeptide, a polynucleotide encoding the variant polypeptide, and a vector including the polynucleotide; and a culture of the microorganism.

[0125] The polypeptide having carnosine synthase activity, the variant polypeptide, the polynucleotide, the vector, the microorganism, and the carnosine are as described in other aspects.

[0126] The composition of the present disclosure can further include any suitable excipient generally used in a composition for producing carnosine, examples of the excipient can include a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, an isotonic agent, etc., but are not limited thereto.

[0127] In one specific embodiment, each component present in the composition of the present disclosure can be included in a microbiologically effective amount, or in an appropriate amount present in a composition for production.

[0128] In the present disclosure, the culture can include any one, as long as it includes a culture, for example, a dried product of a culture, a dilution, a concentrate, a culture filtrate, or a fermentation product.

[0129] Another aspect of the present disclosure provides a method of producing carnosine, the method including the step of culturing a microorganism of the present disclosure in a culture medium.

[0130] The microorganism and the carnosine are as described in other aspects.

[0131] As used herein, the term "culturing" refers to growing a microorganism of the present disclosure under appropriately adjusted environmental conditions. The culturing procedure of the present disclosure can be performed according to a suitable culture medium or culture conditions known in the art. A person skilled in the art can easily adjust such a culturing procedure according to the selected microorganism. Specifically, the culturing can be batch-type, continuous-type, and / or fed-batch-type, but is not limited thereto.

[0132] As used herein, "medium" refers to a mixture containing nutrients necessary for culturing the microorganism of the present disclosure as a main component, in which the medium provides nutrients including water, growth factors, etc. necessary for survival and growth. Specifically, for the medium and other culture conditions for culturing the microorganism of the present disclosure, any medium used for conventional culture of microorganisms can be used without particular limitation. However, the microorganism of the present disclosure can be cultured in a general medium containing a suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin under aerobic conditions while controlling temperature, pH, etc. For example, a medium for culturing a Corynebacterium strain can be found in the literature ["Manual of Methods for General Bacteriology", American Society for Bacteriology (Washington, D.C., USA, 1981)].

[0133] In the present disclosure, the carbon source can include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc.; glycerol, propylene glycol, etc. In addition, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, sugar cane bagasse, and corn steep liquor can be used, and specifically, carbohydrates such as glucose and sterile pretreated molasses (i.e., molasses converted to reducing sugars) can be used, and various other carbon sources in an appropriate amount can be used without limitation. These carbon sources can be used alone or two or more in combination, but are not limited thereto.

[0134] For the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its degradation product, etc. can be used. These nitrogen sources can be used alone or two or more in combination, but are not limited thereto.

[0135] The phosphate source can include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto. For the inorganic compound, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc. can be used, and in addition, amino acids, vitamins, and / or suitable precursors can also be included. These constituent ingredients or precursors can be added to the medium in a batch or continuous manner. However, the present disclosure is not limited thereto.

[0136] Further, the pH of the culture medium can be adjusted during the culturing of the microorganism of the present disclosure by adding a compound, for example, ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid, to the culture medium in an appropriate manner. Further, an antifoam agent, such as a fatty acid polyethylene glycol ester, can be used to suppress the formation of foam during the culturing. Further, oxygen or an oxygen-containing gas can be injected into the culture medium to maintain an aerobic state of the culture medium, or no gas or nitrogen gas, hydrogen gas, or carbon dioxide gas can be injected to maintain an anaerobic or non-aerobic state of the culture medium, but are not limited thereto.

[0137] In the culturing of the present disclosure, the culturing temperature can be maintained at 20°C to 45°C, specifically, 25°C to 40°C, and the culturing can be performed for about 10 hours to about 160 hours, but is not limited thereto.

[0138] The carnosine produced from the culture of the present disclosure can be released into the culture medium or can be retained in the cells.

[0139] In one specific embodiment, the method for producing carnosine of the present disclosure can further include a step of preparing the microorganism of the present disclosure, a step of preparing a culture medium for culturing the microorganism, or a combination (regardless of the order, in any order) of these steps, for example, before or after the culturing step.

[0140] In one specific embodiment, the method for producing carnosine of the present disclosure can further include a step of recovering carnosine from the culture medium produced from the culturing (the culture medium in which the culturing has been performed) or from the microorganism of the present disclosure. The recovery step can also be included after the culturing step.

[0141] The recovery can be the method for culturing the microorganism according to the present disclosure, for example, batch, continuous, or fed-batch type culturing, to collect L-carnosine by using a suitable method known in the art. For example, centrifugation, filtration, treatment with a crystallizing protein precipitant (salting-out), extraction, ultrasonic treatment, ultrafiltration, dialysis, various types of chromatography such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, and a combination of these methods can be used, and L-carnosine can be recovered from the culture medium or the microorganism by using a suitable method known in the art.

[0142] Further, the method for producing L-carnosine of the present disclosure can further include a purification step. The purification can be performed by using a suitable method known in the art. In one exemplary embodiment, when the method for producing L-carnosine of the present disclosure includes both the recovery step and the purification step, the recovery step and the purification step can be performed continuously or discontinuously regardless of the order, or can be performed simultaneously or integrated into one step, but are not limited thereto.

[0143] Yet another aspect of the present disclosure provides use of the polypeptide having a creatine synthase activity, the variant polypeptide, and the microorganism described in the present disclosure for producing creatine.

[0144] The polypeptide having a creatine synthase activity, the variant polypeptide, the microorganism, and the creatine are as described in other aspects.

[0145] [Means for carrying out the present invention]

[0146] Hereinafter, the present disclosure will be described in greater detail by way of exemplary embodiments. However, the following exemplary embodiments are merely for illustrative purposes of preferred embodiments of the present disclosure, and thus are not intended to limit the scope of the present disclosure thereto. Meanwhile, technical matters not described in the present specification can be sufficiently understood and easily implemented by those skilled in the art or a person with an ordinary skill in the similar technical field.

[0147] Example 1. Exploration and screening of novel creatine synthase

[0148] The amino acid sequence of the creatine synthase derived from Bacillus was used as a query sequence, and a PSI-BLAST search was performed based on the NCBI and Kegg databases. As a result, 20 kinds of candidate genes of enzymes considered to be capable of synthesizing creatine and organisms having the genes were selected. Among them, seven types of microorganisms and their derived enzymes were selected in consideration of their similarity to the query sequence, as shown in Table 1 below.

[0149] [Table 1]

[0150]

[0151]

[0152] Example 2. Construction of expression vectors introducing various creatine synthases

[0153] The creatine synthases from the 7 strains selected in Example 1 (Bacillus subtilis, Streptococcus pneumoniae, Bacillus halodurans, Pristina gigantea, Pseudomonas syringae, Pseudomonas syringae pv. phaseolicola, and Bacillus pumilus) have amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 7, respectively. Information on the genes encoding the above enzymes and the surrounding nucleotide sequences thereof was obtained from the NIH GenBank (Accession Nos. CAB15798.1, CVN04298.1, MBV7318856.1, WP_116516826.1, BAJ15424.1, AAZ37741.1, and GM828960.1), respectively.

[0154] Thereafter, the products obtained by gene synthesis based on the obtained sequences were used as templates for PCR, thereby obtaining gene fragments for vector construction, respectively.

[0155] At this time, Solg TM Pfu-X DNA polymerase was used as a polymerase, and PCR amplification conditions included denaturation at 95°C for 3 minutes, 30 cycles of denaturation at 95°C for 20 seconds; annealing at 56°C for 40 seconds; polymerization at 72°C for 2 minutes, and then polymerization reaction at 72°C for 5 minutes.

[0156] In order to amplify the gene derived from Bacillus subtilis, primers of SEQ ID NOs: 21 and 22 shown in Table 2 below were prepared, and PCR was performed under the same polymerase and PCR amplification conditions as described above, as a result of which a 1,419 bp gene fragment was obtained.

[0157] In order to amplify the gene derived from Streptococcus pneumoniae, primers of SEQ ID NOs: 23 and 24 shown in Table 2 below were prepared, and PCR was performed in the same manner, as a result of which a 1,422 bp gene fragment was obtained.

[0158] In order to amplify the gene derived from Bacillus halodurans, primers of SEQ ID NOs: 25 and 26 shown in Table 2 below were prepared, and PCR was performed, as a result of which a 1,419 bp gene fragment was obtained.

[0159] In order to amplify the gene derived from Pristia gigantea, primers of SEQ ID NOs: 27 and 28 shown in Table 2 below were prepared, and PCR was performed in the same manner, as a result of which a 1,422 bp gene fragment was obtained.

[0160] In order to amplify the gene derived from Pseudomonas syringae, primers of SEQ ID NOs: 29 and 30 shown in Table 2 below were prepared, and PCR was performed in the same manner, as a result of which a 1,260 bp gene fragment was obtained.

[0161] In order to amplify the gene derived from Pseudomonas syringae pv. phaseolicola, primers of SEQ ID NOs: 31 and 32 shown in Table 2 below were prepared, and PCR was performed in the same manner, as a result of which a 1,245 bp gene fragment was obtained.

[0162] In order to amplify the gene derived from Bacillus pumilus, primers of SEQ ID NOs: 33 and 34 shown in Table 2 below were prepared, and PCR was performed in the same manner, as a result of which a 1,434 bp gene fragment was obtained.

[0163] [Table 2]

[0164]

[0165]

[0166] In addition, in order to obtain the promoter, the o2 promoter (US 10273491 B2) was used as a template, and primers of SEQ ID NOs: 35 and 36 as shown in Table 2 above were prepared to perform PCR.

[0167] The amplified o2 promoter region, the gene fragment from 7 microorganisms, and the pCES208 vector digested with XbaI restriction enzyme ("Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes." Journal of microbiology and biotechnology 18.4 (2008): 639-647.) were ligated with a fusion cloning kit to obtain each gene expression vector.

[0168] Accordingly, the vector containing the gene derived from Bacillus subtilis, the vector containing the gene derived from Streptococcus pneumoniae, the vector containing the gene derived from Alcaligenes faecalis, the vector containing the gene derived from Pristina megas, the vector containing the gene derived from Pseudomonas syringae, the vector containing the gene derived from Pseudomonas syringae phaseolicola, and the vector containing the gene derived from Bacillus pumilus were named "pCES208-Po2-BsLAL", "pCES208-Po2-SpLAL", "pCES208-Po2-AhLAL", "pCES208-Po2-PmLAL", "pCES208-Po2-PsLAL", "pCES208-Po2-PspLAL", and "pCES208-Po2-BpLAL", respectively.

[0169] Example 3. Preparation of coryneform bacteria strain producing beta-alanine and L-histidine

[0170] In order to evaluate the carnosine synthesis activity of the above-described enzymes, an attempt was made to prepare a coryneform bacteria strain producing beta-alanine and L-histidine. Accordingly, a vector was prepared to insert panD into the genomic DNA of the strain, which is a gene required for converting aspartate produced in the Corynebacterium glutamicum strain into beta-alanine.

[0171] To amplify the panD gene, the chromosomal DNA of wild-type C. glutamicum ATCC 13032 was used as a template, primers of SEQ ID NOs: 37 and 38 shown in Table 3 below were prepared, and PCR was performed in the same manner as in Example 2. As a result, a 411 bp gene fragment was obtained.

[0172] To obtain the o2 promoter derived from C. glutamicum, PCR was performed using the genomic DNA of C. glutamicum as a template and primers of SEQ ID NOs: 39 and 40 shown in Table 3 below.

[0173] [Table 3]

[0174]

[0175] The amplified o2 promoter region, panD gene fragment, and pDZTn vector for chromosomal transformation, which has been digested with a SpeI restriction enzyme, were cloned using a Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid, and the obtained plasmid was named pDZTn-Po2-panD. Cloning was performed by mixing Gibson assembly reagents and each gene fragment in a calculated molar amount, and then storing the mixture at 50°C for 1 hour.

[0176] The prepared pDZTn-Po2-panD vector was transformed into a wild-type C. glutamicum ATCC 13032 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52: 541-545), and then a strain in which one copy of the Po2-panD gene was inserted between transposon genes on the chromosome was obtained through a second crossover process. The genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NOs: 41 and 42 shown in Table 3, which are capable of amplifying the outer regions of the homologous recombination upstream and downstream regions of the gene insertion.

[0177] The strain thus obtained was named C. glutamicum "ATCC 13032::Po2-panD".

[0178] Example 4. Preparation of C. glutamicum strains introducing various camosine synthetases

[0179] The vector prepared in Example 2 was transformed into the Corynebacterium glutamicum ATCC 13032::Po2-panD strain prepared in Example 3 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52: 541-545), thereby obtaining 7 strains into which each gene was introduced, respectively.

[0180] At this time, the strain into which pCES208-Po2-BsLAL was introduced, the strain into which pCES208-Po2-SpLAL was introduced, the strain into which pCES208-Po2-AhLAL was introduced, the strain into which pCES208-Po2-PmLAL was introduced, the strain into which pCES208-Po2-PsLAL was introduced, the strain into which pCES208-Po2-PspLAL was introduced, and the strain into which pCES208-Po2-BpLAL was introduced were named "ATCC 13032::Po2-panD-BsLAL", "ATCC 13032::Po2-panD-SpLAL", "ATCC 13032::Po2-panD-AhLAL", "ATCC 13032::Po2-panD-PmLAL", "ATCC 13032::Po2-panD-PsLAL", "ATCC 13032::Po2-panD-PspLAL", and "ATCC 13032::Po2-panD-BpLAL", respectively.

[0181] Example 5. Verification of carnosine production in Corynebacterium strains into which various carnosinase were introduced

[0182] Fermentation titration was performed to verify the carnosine production of the 7 Corynebacterium glutamicum strains prepared in Example 4. Colonies of each strain were subcultured on a nutrient medium, and then cultured on a fermentation medium for 48 hours. The medium components used herein are as follows.

[0183] < Nutrient medium >

[0184] 1% glucose, 0.5% beef extract, 1% polypeptone, 0.25% sodium chloride, 0.5% yeast extract, 2% agar, 0.2% urea, pH 7.2

[0185] < Fermentation medium >

[0186] 6% glucose, 3% calcium carbonate, 2% ammonium sulfate, 1% cane molasses, 0.1% yeast extract, 0.4% potassium dihydrogen phosphate, 0.3% magnesium sulfate, 0.026% isoleucine, 36 mg / L nicotinamide, 2.5 mg / L ferric sulfate, 1.175 mg / L manganese sulfate, 0.05 mg / L biotin

[0187] After culturing under the above conditions, the concentration of carnosine in each culture medium was determined by HPLC. The carnosine concentrations produced by the seven strains are shown in Table 4 below.

[0188] [Table 4]

[0189]

[0190]

[0191] As shown in Table 4, ATCC13032::Po2-panD-SpLAL (into which the enzyme derived from Streptococcus pneumoniae among various carnosine synthases was introduced) produced 1.5 g / L of carnosine, indicating that this was approximately 0.6 g / L (approximately 67%) higher than the carnosine concentration produced by the previously reported ATCC13032::Po2-panD-BsLAL (into which the enzyme derived from Bacillus subtilis was introduced), and approximately 0.4 g / L (approximately 36%) higher than the carnosine concentration produced by ATCC13032::Po2-panD-BpLAL (into which the enzyme derived from Bacillus pumilus was introduced).

[0192] The above results confirmed that the enzyme derived from Streptococcus pneumoniae had the highest carnosine synthesis activity and that, in some cases, no carnosine was produced depending on the origin of the carnosine synthase.

[0193] Example 6. Carnosine production in a Corynebacterium strain incorporating an enzyme variant derived from Streptococcus pneumoniae

[0194] Example 6-1. Preparation of strains introduced with enzyme variants derived from Streptococcus pneumoniae

[0195] Two amino acid variants were introduced into the enzyme derived from Streptococcus pneumoniae having the highest carnosine synthesis activity selected in Example 5. Specifically, the improvement in carnosine synthesis activity was confirmed by replacing asparagine and histidine at amino acid positions 108 and 378 in the enzyme sequence with glutamic acid and lysine, respectively.

[0196] To this end, first, in order to replace asparagine as the 108th amino acid of SEQ ID NO: 2 with glutamic acid, a set of primers (mutagenizing primers) of SEQ ID NO: 43 and 44 shown in Table 5 below were prepared using pCES208-Po2-SpLAL prepared in Example 2 as a template.

[0197] [Table 5]

[0198]

[0199] The PCR mixture shown in Table 6 below was prepared using the above primer set, and site-directed mutagenesis PCR was performed using the cycles shown in Table 7 below.

[0200] [Table 6]

[0201] Site-directed mutagenesis PCR composition Units (ul) 10X pfu-X buffer 5 10 mM dNTP Mix 1 Pfu-X polymerase 1 Mutagenic forward primer (5 pmol) 2 Mutagenic reverse primer (5 pmol) 2 Template DNA, 200 ng / ul 1 [dH2O] 38 Total 50

[0202] [Table 7]

[0203]

[0204] 1 μl of Dpn I restriction enzyme was added to the mixture in which PCR was completed, and was left at 37°C for 1 hour. 3 μl of Dpn I-treated DNA was transformed into DH5a competent cells to obtain the pCES208-Po2-SpLAL N108E plasmid.

[0205] In addition, in order to substitute lysine for histidine as the 378th amino acid, the pCES208-Po2-SpLAL N108E plasmid prepared above was used as a template and a set of primers (mutagenic primers) of SEQ ID NOs: 45 and 46 shown in Table 5, in the same manner as described above, to obtain the pCES208-Po2-SpLAL N108E / H378 plasmid. Through sequencing, substitution of each mutation shown in the plasmid of Table 5 was confirmed, and as a result, the sequence of SEQ ID NO: 8 was obtained.

[0206] The pCES208-Po2_SpLAL N108E / H378K vector constructed above was transformed into the Corynebacterium glutamicum ATCC 13032::Po2-panD strain prepared in Example 3 by electroporation, and then a strain in which the variant SpLAL gene (N108E / H378K) was inserted was obtained. This strain was named "ATCC 13032::Po2-panD-SpLAL N108E / H378K".

[0207] Example 6-2: Verification of production of camosine in a Corynebacterium strain into which a Streptococcus pneumoniae-derived enzyme variant was introduced

[0208] In order to detect the production of camosine in the Corynebacterium glutamicum ATCC 13032::Po2-panD-SpLAL N108E / H378K strain prepared in Example 6-1, after cultivation in the same manner as in Example 5, the production of camosine was measured using HPLC.

[0209] [Table 8]

[0210]

[0211] As shown in Table 8, it was confirmed that the concentration of carnosine produced by the microorganism into which the variant SpLAL enzyme (N108E / H378K) was introduced was about 0.6 g / L (about 40%) higher than that of carnosine produced by the microorganism into which the wild-type SpLAL enzyme was introduced.

[0212] The above results indicate that the N108E / H378K variation increases the carnosine production capacity of the microorganism having the enzyme.

[0213] Example 7. Improvement of carnosine productivity of AroP-enhanced Corynebacterium strain

[0214] Example 7-1. Preparation of AroP-enhanced strain

[0215] In order to enhance AroP of the Corynebacterium strain, a vector for introducing the pyk promoter and the cj7 promoter was constructed (US 7662943B2).

[0216] In order to amplify the pyk promoter, chromosomal DNA of wild-type Corynebacterium glutamicum ATCC 13032 was used as a template, primers of SEQ ID NOs: 47 and 48 shown in Table 9 below were prepared, and PCR was performed in the same manner as in Example 2, as a result of which a 500 bp gene fragment was obtained. In order to obtain a gene fragment required for insertion into host genomic DNA, SEQ ID NOs: 49 and 50 and SEQ ID NOs: 51 and 52 shown in Table 9 were prepared, and PCR was performed in the same manner as in Example 2 to obtain 501 bp and 500 bp gene fragments.

[0217] [Table 9]

[0218]

[0219] The amplified pyk promoter region and the two gene fragments obtained above were ligated to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) that has been digested with restriction enzymes BamHI and XbaI using a fusion cloning kit to prepare a vector for gene introduction, designated as "pDZ-pyk(AroP)".

[0220] Further, in order to amplify the CJ7 promoter, the chromosomal DNA of the wild type C. glutamicum ATCC 13032 was used as a template, primers of SEQ ID NOs: 53 and 54 shown in Table 10 below were prepared, and PCR was performed in the same manner as in Example 2, as a result of which a 317 bp gene fragment was obtained. In order to obtain a gene fragment required for insertion into the host genomic DNA, primers of SEQ ID NOs: 49 and 55 and SEQ ID NOs: 56 and 52 shown in Tables 9 and 10 were prepared, and PCR was performed in the same manner as in Example 2 to obtain 501 bp and 500 bp gene fragments.

[0221] [Table 10]

[0222]

[0223]

[0224] The amplified CJ7 promoter region and the two gene fragments obtained above were ligated to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) that has been digested with restriction enzymes BamHI and Xbal using a fusion cloning kit to prepare a vector for gene introduction, designated as "pDZ-cj7(AroP)".

[0225] The prepared pDZ-pyk(AroP) and pDZ-cj7(AroP) vectors were transformed into the ATCC 13032::Po2-panD-SpLAL N108E / H378K strain prepared in Example 6-1 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), respectively, and then by a second crossover process, strains in which the promoter was inserted before the AroP gene on the chromosome were obtained. The corresponding genetic manipulation was confirmed by PCR and genome sequencing using primers of SEQ ID NOs: 57 (check_AroP_F; CTCTGCGGTCCCGCGGAC) and 58 (check_AroP_R; CGTGATCACCGATGAAGTTTG) that can amplify the outer regions of the homologous recombination upstream and downstream regions of the corresponding gene insertion, respectively.

[0226] The C. glutamicum strains thus obtained were designated as "ATCC 13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP" and "ATCC 13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP", respectively.

[0227] Example 7-2. Verification of carnosine production of AroP-boosted strains

[0228] To measure the carnosine production of the ATCC13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP strain and the ATCC13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP strain, each strain was cultured in the same manner as in Example 5, and then the carnosine production was measured using HPLC.

[0229] [Table 11]

[0230]

[0231] As shown in Table 11, it was confirmed that the carnosine concentration produced by the ATCC13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP into which the pyk promoter was introduced was about 0.4 g / L (about 19%) higher than the carnosine concentration produced by the ATCC13032::Po2-panD-SpLAL N108E / H378K, and the carnosine concentration produced by the ATCC13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP into which the cj7 promoter was introduced was about 0.6 g / L (about 29%) higher than the carnosine concentration produced by the ATCC13032::Po2-panD-SpLAL N108E / H378K.

[0232] The above results indicate that the boosting of AroP improves the carnosine production capacity of microorganisms.

[0233] Based on the above description, those skilled in the art will understand that the present disclosure can be implemented in different specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are not restrictive but are illustrative in all aspects. The scope of the present disclosure is defined by the appended claims, not by the specification, and thus all changes and modifications falling within the boundaries and scope of the claims, or equivalents of these boundaries and scope, are included in the claims.

Claims

1. A polypeptide having a carnosine synthase activity, the polypeptide comprising the amino acid sequence of SEQ ID NO:

2.

2. A polynucleotide encoding the polypeptide having a carnosine synthase activity of claim 1.

3. A microorganism comprising any one or more of the polypeptide having a carnosine synthase activity of claim 1, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide.

4. The microorganism of claim 3, wherein the microorganism produces carnosine.

5. The microorganism of claim 3, wherein the activity of an aromatic amino acid transporter (AroP) protein is further enhanced.

6. The microorganism of claim 5, wherein the AroP protein comprises the amino acid sequence of SEQ ID NO:

19.

7. The microorganism of claim 3, wherein the microorganism is a microorganism of the genus Corynebacterium.

8. The microorganism of claim 3, wherein the microorganism is Corynebacterium glutamicum.

9. A variant polypeptide having a carnosine synthase activity, wherein the amino acid corresponding to position 108 and the amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 are substituted with different amino acids.

10. The variant polypeptide of claim 9, wherein the amino acid corresponding to position 108 and the amino acid corresponding to position 378 from the N-terminus of SEQ ID NO: 2 are substituted with glutamic acid and lysine, respectively.

11. The variant polypeptide of claim 9, wherein the amino acids corresponding to positions 108 and 378 from the N-terminus of SEQ ID NO: 2, asparagine and histidine, respectively, are substituted with glutamic acid and lysine, respectively.

12. The variant polypeptide of claim 9, comprising the amino acid sequence of SEQ ID NO:

8.

13. A polynucleotide encoding the variant polypeptide of claim 9.

14. A microorganism comprising any one or more of the variant polypeptide of claim 9, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide.

15. The microorganism of claim 14, wherein the microorganism produces carnosine.

16. The microorganism of claim 14, wherein the activity of an aromatic amino acid transporter (AroP) protein is further enhanced.

17. A composition for producing carnosine, the composition comprising any one or more of: a microorganism comprising any one or more of the polypeptide having a carnosine synthase activity of claim 1, a polynucleotide encoding the polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism; the variant polypeptide of any one of claims 9 to 12; a microorganism comprising any one or more of the variant polypeptide of any one of claims 9 to 12, a polynucleotide encoding the variant polypeptide, and a vector comprising the polynucleotide; a culture of the microorganism. The polypeptide having a myopeptidase activity according to claim 1 ; ​ ​ 18. The composition of claim 17, wherein the microorganism has further enhanced activity of aromatic amino acid transporter (AroP) protein.

19. A method of producing carnosine, the method comprising the step of culturing the microorganism of any one of claims 3 to 8 and 14 to 16 in a culture medium.

20. The method of claim 19, further comprising the step of recovering carnosine from any one or more of the microorganism, its culture, and culture medium.

21. Use of the microorganism of any one of claims 3 to 8 and 14 to 16 for the production of carnosine.

Images