Method for constructing low-beauvericin cordyceps sobolifera strain based on non-resistance marker technology and application of low-beauvericin cordyceps sobolifera strain

Abstract

The invention discloses a method for constructing a low-beauvericin cordyceps sobolifera strain based on a non-resistance marker technology and application of the low-beauvericin cordyceps sobolifera strain, and belongs to the technical field of fungus molecular biology. In order to obtain a low-beauveria-bassiana cordyceps sobolifera strain (Cordyceps canhua KIVI with a preservation number of CCTCC NO: M2025637) without a resistance marker, the preparation method comprises the following steps: firstly, carrying out double enzyme digestion on a plasmid pPK2-bar to remove a herbicide-resistant gene bar, and inserting an upstream region and a downstream region of a coding region of cordyceps sobolifera orotic acid nucleotide decarboxylase URA3 into the plasmid to obtain a knockout plasmid pPK2-URA3 of the URA3. And then obtaining the URA3 gene deleted cordyceps sobolifera strain through a homologous recombination technology and the screening effect of 5-fluoroorotic acid (5-FOA) on the uridine / uracil auxotroph strain, so as to obtain the URA3 gene deleted cordyceps sobolifera strain. The content of the beauveria bassiana in the obtained cordyceps sobolifera strain meets the requirement (the content of the beauveria bassiana is less than or equal to 3mg / kg) of the'announcement of 15 kinds of'three-new foods' of national health commission about cordyceps sobolifera sporocarp (artificially cultivated) and the like '(No.9 in 2020).

Description

Technical Field

[0001] This invention belongs to the field of fungal molecular biology technology, specifically relating to the modification and application of a non-resistance marker technology for the target gene of cicada flower. Background Technology

[0002] Cordyceps chanhua is a precious edible and medicinal fungus, and also a traditional and valuable Chinese medicinal herb. As a food-medicine homologous fungus with promising application prospects, its industrial production as an important health food has high economic value. Modern research shows that Cordyceps chanhua has various physiological effects, including anti-tumor, anti-fatigue, immune regulation, and improvement of kidney function. Nucleosides, polysaccharides, amino acids, aromatic compounds, and other substances have been found in Cordyceps chanhua. In 2021, the National Health Commission of my country approved artificially cultivated Cordyceps chanhua fruiting bodies for use as a new food, expanding its application from traditional Chinese medicine to the food industry. This further broadens its application scope, leading to a surge in future demand and a huge market potential.

[0003] Beauvericin (BEA) is a fungal toxin produced as a secondary metabolite by entomopathogenic fungi such as *Cicada nymph* and *Beauveria bassiana* during infection of arthropods. Beauvericin has also been shown to have antitumor, antibacterial, and antiviral effects, possessing significant potential medicinal value, but it also exhibits certain toxic side effects on various cell lines. Furthermore, beauvericin has been found to be a contaminant in various grains and grain products, and its content is one of the key indicators for food safety risk assessment in grains and their products, vegetable oils, and nuts. In 2020, the National Health Commission issued the "Announcement of the National Health Commission on 15 Kinds of 'Three New Foods' including Cicada nymph Fruiting Bodies (Artificially Cultivated)" (No. 9 of 2020), explicitly requiring that the beauvericin content in Cicada nymph fruiting bodies be ≤3mg / kg. However, the beauvericin content in the fruiting bodies of Cicada nymph is relatively high during its growth process, posing a potential safety hazard to consumers.

[0004] Nutritional screening is a genetic transformation method used to select auxotrophic strains by adding exogenous substances due to abnormal synthetic or catabolistic pathways. Auxotrophic markers are effective markers linked to expression vectors, often after the promoter. The introduced marker gene complements the mutated gene in the recipient cell, causing the recipient cell to exhibit wild-type growth, providing positive selection for the transformant and achieving resistance-free knockout. Auxotrophic screening is an excellent method for selecting marker genes, achieving scarless knockout without leaving resistance or recombination sites, while eliminating exogenous plasmids, greatly facilitating subsequent research. It also provides more precise and controllable gene editing, avoiding the blindness and randomness of random integration. However, obtaining suitable auxotrophic strains in fungal genetic transformation is difficult and time-consuming.

[0005] Selection markers are essential tools for the genetic modification of microbial strains. In the genetic modification of *Cicadae Persicae*, antibiotic resistance screening is the most commonly used selection marker. Current research indicates that antibiotic resistance screening is the primary selection marker used in antibiotic modification. Furthermore, compared to antibiotic resistance screening, auxotrophic selection markers with complementary functions offer advantages such as high biosafety and low false-positive rates, and have wider applications in the food and feed industries for recombinant protein production. Therefore, developing antibiotic-free selection markers and using them to construct food-safe bacterial strains has significant application value for achieving protein production in the food sector.

[0006] Chinese patent application CN111996129A discloses a novel strain of *Isaria cicadae*, named *Isaria cicadae* HMGIM-N140534. This patented strain is a highly vigorous new strain collected from the wild. The strain was isolated from the wild and preserved in a patent strain preservation center. It was confirmed as *Isaria cicadae* by a combination of traditional and molecular identification methods. Large-scale production can be achieved through artificial fermentation, and it exhibits significant inhibitory effects against tumors and *Candida albicans*. However, this patent does not possess the advantage of low beauvericin content, thus requiring further improvement. Summary of the Invention

[0007] The technical problem to be solved by this invention is how to address the high content of beauveria bassiana in the fruiting bodies of cicada flowers. This invention is based on non-resistance labeling technology to mutate the beauveria bassiana synthesis regulator Kivr.

[0008] The present invention solves the above-mentioned technical problems through the following technical means:

[0009] The first aspect of this invention provides a *Cicadae Fragrance* strain with low benzimidin content, whose preservation number is CCTCCNO: M2025637.

[0010] The Cordyceps Chanhua KIVI strain was deposited at the China Center for Type Culture Collection on March 31, 2025, with accession number CCTCC NO: M2025637 and taxonomically named Cordyceps Chanhua KIVI.

[0011] A second aspect of the present invention provides the fruiting body of the above-mentioned Cordyceps militaris strain.

[0012] Preferably, the beauveria bassiana content in the fruiting body of the cicada flower is <3 mg / kg.

[0013] A third aspect of the present invention proposes the application of the above-mentioned Cordyceps militaris strain or its fruiting bodies in the production of food protein and / or feed protein.

[0014] The fourth aspect of this invention proposes the application of the gene Kivr in regulating fungal metabolism.

[0015] Preferred application in regulating the synthesis content of beauveria bassiana in Cordyceps militaris.

[0016] The fifth aspect of the invention proposes the application of the gene URA3 and / or the gene Kivor in screening for Cordyceps militaris strains with low beauveria bassiana content.

[0017] A sixth aspect of the present invention provides a method for screening *Cicadae Fragrance* strains with low benzimidin content, comprising the following steps:

[0018] (1) The herbicide resistance gene bar was removed by double enzyme digestion of plasmid pPK2-bar. The upstream and downstream regions of the URA3 coding region were inserted into the plasmid to obtain the URA3 knockout plasmid pPK2-URA3.

[0019] (2) Then, by using homologous recombination technology and 5-fluoroorotic acid (5-FOA) to screen uridine / uracil auxotrophic strains, we obtained the URA3 gene-deleted Cordyceps militaris strain.

[0020] (3) The coding region of Cicada Flower URA3, the upstream promoter and the downstream terminator region were inserted into the plasmid to obtain the pPK2-EURA3 plasmid; the upstream and downstream fragments of the 2-ketoisovalerate reductase gene kivr were obtained by PCR and inserted into the pPK2-EURA3 plasmid to obtain the kivr knockout plasmid pPK2-EURA3-kivr.

[0021] (4) Transform plasmid pPK2-EURA3-kivr into Agrobacterium tumefaciens AGL-1 and obtain a kivr knockout strain without resistance marker based on homologous recombination technology.

[0022] The seventh aspect of the present invention provides a fungal gene knockout vector pPK2-EURA3-kivr, wherein the multiple cloning site region is sequentially connected to the upstream homologous arm of the Kivr gene, the URA3 uracil / uridine defect gene expression cassette, and the downstream homologous arm of the Kivr gene.

[0023] Preferably, the upstream and downstream homologous arms of the Kivr gene are sequences 1-1.5k upstream and downstream of the Kivr gene ORF region, respectively, and the fragments are linked to the pPK2-EURA3 plasmid backbone through BamHI and SpeI restriction sites.

[0024] Orotic acid nucleotide decarboxylase URA3 is a key enzyme in the biosynthesis of uridine / uracil, essential for fungal survival. It participates in nitrogen metabolism and plays a crucial role in the synthesis of uracil nucleosides. Mutations in the URA3 gene of *Cicada nymph* prevent the conversion of orotic acid to uridine (a precursor to uracil). Strains lacking the URA3 gene cannot grow on media without uridine / uracil and require exogenous uridine / uracil for growth. Based on this characteristic of URA3-deficient strains, the URA3 gene was used as a tag for knockout. Simultaneously, the URA3 gene was reinserted into the URA3-deficient strain, enabling it to grow on media without uridine / uracil.

[0025] Meanwhile, orotidine decarboxylase can convert the non-toxic component 5-fluoroorotonic acid (5-FOA) into 5-fluorouracil (5-FUMP), which has strong biotoxicity to cells, thereby inhibiting fungal growth. However, in the URA3 mutant strain, 5-FOA does not convert into 5-FUMP, meaning that the URA3 mutant can grow normally in a culture medium containing 5-FOA. Therefore, 5-FOA can be used as a selector for URA3 auxotrophic strains. Normally growing *Cicada spp.* URA3 mutant strains can be screened on a medium containing 5-FOA and uridine / uracil, and further confirmed by PCR.

[0026] Another advantage of the URA3 marker compared to other auxotrophic markers is that it allows for reverse selection. Using ΔURA3 as the starting strain, a Kivr gene knockout vector was constructed. Cordyceps militaris strains that could grow normally were screened on uridine / uracil-free medium, and the target gene sequence was verified by PCR to obtain the Cordyceps militaris Kivr mutant strain.

[0027] The beneficial effects of this invention are as follows:

[0028] 1. This invention utilizes non-resistance marker technology and genetic engineering to knock out the beauveria bassiana synthesis regulatory gene Kivr, successfully obtaining a low-beauveria bassiana strain, Cordyceps Chanhua KIVI. This strain has been specially modified to achieve a beauveria bassiana content of <3 mg / kg in the fruiting body without the need for resistance markers, making it suitable for direct production.

[0029] 2. This invention provides for the first time a mutant fungus, *Cicada spp.*, with a mutation related to fungal metabolism, *Kivr*, and its application. The uracil / uridine-deficient gene URA3 was knocked out using *Agrobacterium tumefaciens*-mediated genetic transformation to obtain URA3-deficient strains. Then, *Agrobacterium tumefaciens*-mediated genetic transformation combined with reverse selection of mutant strains was used to achieve targeted knockout of *Kivr*. Results showed that compared to wild-type strains, the content of beauveria bassiana in the metabolites of the *Kivr* gene-deficient strains was significantly reduced. Simultaneously, this invention also investigated this gene and its mechanism of action, further clarifying the function of the beauveria bassiana synthesis-regulating gene *Kivr*, and solving the problem in existing technologies of lacking research on key genes regulating *Cicada spp.* under antibiotic-free conditions.

[0030] 3. The beauvericin synthesis regulatory gene Kivr is a key gene regulating beauvericin synthesis in *Cicada spp.* This invention elucidates the function of the Kivr gene, demonstrating its role in regulating beauvericin synthesis. The genetically engineered host cells described in this invention exhibit the following characteristics: In the absence of resistance markers, the Kivr gene is specifically knocked out, resulting in a significant reduction in beauvericin production. This addresses the lack of understanding of the function of key genes regulating beauvericin synthesis in *Cicada spp.* in existing technologies, enabling the potential reduction of beauvericin production in *Cicada spp.* through genetic engineering. Attached Figure Description

[0031] Figure 1 The images show the PCR verification results of the knockout strain in Example 1 of this invention. In (a), the PCR verification result of the URA3 target primer is without a band, while the wild-type (WT) control band is 889bp. In (b), the PCR verification result of the Kivr target primer is without a band, while the wild-type (WT) control band is 488bp.

[0032] Figure 2 This is a diagram showing the results of the resistance verification of the knockout strain to 5-fluoroorotic acid in Example 1 of this invention.

[0033] Figure 3 The image shows the colony morphology and growth diameter of Cordyceps chanhua KIVI obtained in Example 1 of this invention.

[0034] Figure 4The image shows the colony morphology and relative growth inhibition rate of Cordyceps chanhua KIVI obtained in Example 1 of this invention.

[0035] Figure 5 This is a graph showing the relative germination rate of Cordyceps chanhua KIVI after UV irradiation, obtained in Example 1 of this invention.

[0036] Figure 6 The image shows the results of the relative germination rate determination of Cordyceps chanhua KIVI after heat shock obtained in Example 1 of this invention.

[0037] Figure 7 The image shows the sporulation results of Cordyceps chanhua KIVI obtained in Example 1 of this invention.

[0038] Figure 8 The image shows the beauvericin assay results of Cordyceps chanhua KIVI obtained in Example 1 of this invention. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0040] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0041] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0042] Example 1:

[0043] 1. Materials

[0044] Unless otherwise specified, all methods used in this embodiment are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0045] The expression vector used in this study was pPK2-bar, which was stored in the Key Laboratory of Green Control of Major Forest Pests in Anhui Province. The *E. coli* Top10 and *Agrobacterium* AGL1 used for DNA homologous substitution were both purchased from Weidi Biotechnology.

[0046] The solutions required for this implementation and their preparation methods are as follows:

[0047] (1) Salts for Induction Media: Accurately weigh 1.125g K2H2PO4, 3.625g KH2PO4, 1.250g MgSO4·7H2O, 0.375g NaCl, 0.165g CaCl2 2H2O, 0.0062g FeSO4·7H2O, and 1.25g (NH4)2SO4 into a beaker, add ddH2O and stir well, then bring the volume to 1L.

[0048] 2.5×MM induction medium salt solution is used to prepare IM medium.

[0049] M-100 Trace Element Solution: Weigh 0.03g H3BO3, 0.07g MnCl2·4H2O, 0.20g ZnCl2, 0.02g NaMoO4·2H2O, 0.02g FeCl3·6H2O, and 0.2g CuSO4·5H2O into a beaker, add ddH2O to bring the volume to 0.5L, and store in a capped reagent bottle. M-100 Trace Element Solution is used to prepare M-100 salt solutions.

[0050] M-100 Salt Solution: Weigh 16g KH₂PO₄, 4g Na₂SO₄, 8g KCl, MgSO₄·7H₂O, and 1g CaCl₂ into a beaker. Add 8mL of M-100 trace element solution and dilute to 1L with ddH₂O. Store in a capped reagent bottle. M-100 salt solution is used to prepare M-100 culture medium.

[0051] Thiazolam reagent: Weigh 30g of thiazolam reagent and dissolve it in 100mL of distilled water to prepare a 300mg / mL stock solution. Filter the solution in a clean bench to sterilize it, dispense it into sterile 1mL centrifuge tubes, and store it at -20℃. The working concentration is 300ug / mL.

[0052] Acetyleugenol (AS): Weigh 0.2g of acetyleugenol reagent and dissolve it in 100mL of distilled water to prepare a 2mg / mL stock solution. Incubate overnight in a shaker at 25℃ in the dark. Adjust the pH to about 8.0 with NaOH. Filter and sterilize in a clean bench. Aliquot into sterile 5mL brown centrifuge tubes and store at -20℃. The working concentration is 200ug / mL.

[0053] Kanamycin reagent: Weigh 0.5g of kanamycin, add 10ml of ddH2O, shake well, and filter to sterilize. Store the kanamycin reagent at -20℃.

[0054] Uric acid reagent: Weigh 0.5g of uridine reagent and dissolve it in 10mL of pure water to prepare a 50mg / mL stock solution. Filter and sterilize the solution in a clean bench, dispense it into sterile 1mL centrifuge tubes, and store it at -20℃. The working concentration is 0.5mg / mL.

[0055] 5-Fluororotic acid reagent: Weigh 1g of 5-fluoroororotic acid reagent and dissolve it in 10mL of dimethyl sulfoxide to prepare a 100mg / mL stock solution. Filter and sterilize the solution in a clean bench, dispense it into sterile 1.5mL centrifuge tubes, and store it at -20℃. The working concentration is 1mg / mL.

[0056] The culture medium required for this embodiment and its preparation method are as follows:

[0057] LB medium: 10g tryptone, 10g yeast extract, 10g NaCl, 15g agar powder, add pure water to make up to 1L, autoclave at 121℃ for 20min.

[0058] YEB medium: 10g tryptone, 1g yeast extract, 5g sucrose, 0.5g MgSO4·7H2O, 15g agar powder, add pure water to make up to 1L, autoclave at 121℃ for 20min.

[0059] Induction medium (IM): 0.36 g glucose, 3.154 g MES, 80 mL of 2.5 × MM induction medium saline solution, 0.50 mL glycerol, and pure water to a final volume of 200 mL. Autoclave at 121 °C for 20 min.

[0060] Induction medium (IM): 0.18 g glucose, 30154 g MES, 3 g agar powder, 80 mL 2.5×MM induction medium salt solution, 0.50 mL glycerol, and dilute to 200 mL with pure water. Autoclave at 121 °C for 20 min. When cooled to 45 °C, add 40 μL 1 mol / L AS solution.

[0061] M-100 medium: 10g glucose, 3g KNO3, 15g agar powder, add 62.5mL M-100 salt solution, add pure water to make up to 1L, autoclave at 121℃ for 20min.

[0062] Grain culture medium: 10 kg wheat grains, 0.05 kg gypsum powder, 0.1 kg quicklime, 2 kg mushroom residue, add water and stir to adjust the moisture content to 60%-65%.

[0063] 2. Method

[0064] 2.1 Extraction of genomic DNA from Cicada Flower:

[0065] (1) Take 50-100 mg of fresh Cordyceps militaris tissue and grind it thoroughly in liquid nitrogen. Add 400 μL of Buffer GP1 and 6 μL of LNase A, vortex for 1 min, and let it stand at room temperature for 10 min to allow it to fully lyse.

[0066] (2) Add 130 μL of Buffer GP2, mix thoroughly, and vortex for 1 min;

[0067] (3) Centrifuge at 12,000 r / min for 5 min, and transfer the supernatant to a new centrifuge tube;

[0068] (4) Add 1.5 times the volume of Buffer GP3 and immediately shake for 15 seconds to mix thoroughly;

[0069] (5) Add the solution to the DNA Columns, centrifuge at 12,000 r / min for 30 s, discard the waste liquid, and put the adsorption column back into the collection tube;

[0070] (6) Add 600 μL Buffer GW2 to the adsorption column, centrifuge at 12000 r / min for 30 s, discard the waste liquid, and put the adsorption column back into the collection tube;

[0071] (7) Repeat step (6);

[0072] (8) Centrifuge at 12,000 r / min for 2 min and discard the waste liquid;

[0073] (9) Place the adsorption column in a clean centrifuge tube, add 50 μL of BufferTE to the middle of the adsorption membrane, place at room temperature for 2–5 min, centrifuge at 12,000 r / min for 2 min, collect the DNA solution, and store at -20℃.

[0074] 2.2 Construction of the URA3 target gene knockout vector

[0075] The herbicide resistance gene *bar* was removed by double enzyme digestion of plasmid pPK2-bar. Two homologous arms, 1376 bp and 822 bp in length, were designed upstream and downstream of the target gene URA3. Two pairs of primers were designed, and homologous sequences of BamHI and SpeI were added before the primers. Using genomic DNA of Cordyceps militaris as a template, PCR amplification was performed. The product was then recombined into the pPK2 plasmid using multi-fragment ligase at the BamHI and SpeI restriction sites to obtain the pPK2-URA3 knockout plasmid, which was verified by PCR and DNA sequencing.

[0076] The coding region of URA3, upstream promoter, and downstream terminator of *Cicada spp.* were obtained by PCR and inserted into a plasmid to obtain the pPK2-EURA3 plasmid. The upstream and downstream fragments of the *Cicada spp.* kivr gene were PCR-mediated, and a pair of primers were designed for each of the flanking sequences of the target sequence. Using *Cicada spp.* genomic DNA as a template, the upstream and downstream sequences of the target sequence were obtained by PCR and cloned into the pPK2-EURA3-kivr plasmid to obtain the knockout plasmid.

[0077] The following are primers:

[0078]

[0079] Cicada flower DNA was used as a template for PCR amplification. Primers were synthesized by Youkang Company. Before use, the lyophilized powder needed to be dissolved in ddH2O, and the synthesized primer concentration was diluted to 10 μmol / L. The PCR reaction was as follows:

[0080] PCR reaction system

[0081]

[0082]

[0083] PCR reaction procedure

[0084]

[0085] BamHⅠ and SpeⅠ enzyme digestion system

[0086]

[0087]

[0088] Multi-fragment recombination system

[0089]

[0090] 2.3 Plasmid extraction steps:

[0091] (1) Escherichia coli was inoculated into a conical flask containing 20 mL of Kan-resistant LB liquid medium and incubated overnight at 37°C and 220 r / min on a shaker.

[0092] (2) Take 4 mL of bacterial culture into a 5 mL centrifuge tube, centrifuge at 10000 r / min for 1 min, discard the supernatant, use a pipette tip to remove the remaining liquid culture medium, add 250 μL of solution I, and use a pipette to resuspend the bacterial precipitate to suspend the precipitate.

[0093] (3) Transfer the suspension to a new 1.5 mL centrifuge tube, add 250 μL Solution II solution, gently invert and mix until the solution becomes clear. Be careful to avoid violent shaking and the lysis time should not exceed 5 min.

[0094] (4) Add 350 μL of Solution III solution and immediately gently invert to mix until a white flocculent precipitate forms;

[0095] (5) Centrifuge at 13000 r / min for 10 min;

[0096] (6) Place the binding column in a 2 mL collection tube, transfer 700 μL of supernatant into the binding column, centrifuge at 13000 r / min for 1 min, discard the filtrate, and put the binding column back into the collection tube.

[0097] (7) Add 500 μl of HBC Buffer solution, centrifuge at 13000 r / min for 1 min, discard the filtrate, and put the binding column back into the collection tube;

[0098] (8) Add 700 μl of DNA Wash Buffer solution, centrifuge at 13000 r / min for 1 min, discard the filtrate, place the binding column into a new 1.5 mL centrifuge tube, add 50 μL of Elution Buffer solution to the binding column, let stand for 2 min, then centrifuge at 13000 r / min for 1 min to elute the plasmid. The elution can be repeated twice.

[0099] (9) At this point, the product in the 1.5 mL centrifuge tube is the plasmid. The plasmid concentration is measured and stored at -20℃.

[0100] 2.4 Glue Recycling Steps:

[0101] (1) Add the PCR amplification product to the well of a 1% agarose gel, place the gel block in a gel electrophoresis apparatus containing fresh 1×TAEBuffer electrophoresis buffer, run the gel at 120V for 20 minutes, and then cut out the target band gel block and place it in a 1.5mL centrifuge tube.

[0102] (2) Weigh the gel block, add an equal volume of XP2 Binding Buffer, and place it in a 50-60℃ water bath for 7-10 minutes until the gel is completely melted. Shake the gel mixture every 2 minutes.

[0103] (3) Place the binding column in a 2mL collection tube;

[0104] (4) Transfer the melted gel mixture into the binding column, centrifuge at 10000r / min for 1min at room temperature, discard the filtrate, and put the binding column back into the collection tube;

[0105] (5) Add 300 μL XP2 Binding Buffer solution to the binding adsorption column, centrifuge at 13000 r / min for 1 min at room temperature, discard the filtrate, and put the binding column back into the collection tube;

[0106] (6) Add 700 μL of SPW Wash Buffer solution to the binding column, centrifuge at 13000 r / min for 1 min at room temperature, discard the filtrate, and put the binding column back into the collection tube;

[0107] (7) Repeat step (6), centrifuge the empty column at 13000 r / min for 2 min, discard the filtrate, and put the bound column back into the collection tube;

[0108] (8) Transfer the binding column to a new 1.5 mL centrifuge tube, add 15-30 μL of Elution Buffer to the binding column membrane, let stand at room temperature for 2 min, and then centrifuge at 13000 r / min for 1 min to elute the DNA.

[0109] 2.5 Steps for transferring the ligation product into competent E. coli cells:

[0110] (1) Take TOP10 competent cells out of -80℃, wait for the bacterial block to thaw in ice, add the target DNA and mix gently, and let stand in ice for 25 minutes.

[0111] (2) Heat shock in a 42℃ water bath for 45 seconds, then quickly return to ice and let stand for 2 minutes;

[0112] (3) Add 700 μl of sterile culture medium to the centrifuge tube, mix well, and thaw at 37°C and 200r for 60 min.

[0113] (4) Centrifuge at 5000 r / min for 1 min to collect the bacterial cells, and resuspend the bacterial block in 100 μl of supernatant and spread it on LB solid medium containing kanamycin resistance (50 μg / mL Kan);

[0114] (5) Invert the plate and incubate it overnight in a 37°C incubator;

[0115] (6) Pick a single colony into a 1.5 mL centrifuge tube and incubate it in a shaker at 37°C and 220 r / min for 6 h;

[0116] (7) The above bacterial culture was verified by PCR, and positive transformants were obtained.

[0117] 2.6 Steps for transforming Agrobacterium tumefaciens with recombinant plasmids:

[0118] (1) Take out Agrobacterium AGL1 competent cells from the -80℃ freezer, add plasmids to the ice box after the bacterial block melts, let stand in the ice box for 5 min, quick freeze in liquid nitrogen for 5 min, incubate at 37℃ for 5 min, and incubate in ice for 5 min.

[0119] (2) Add 700 μL of YEB liquid medium and incubate at 28℃ with shaking at 220 r / min for 2 h;

[0120] (3) Centrifuge at 5500 r / min to collect bacterial cells, resuspend the bacterial block in 100 μL of supernatant, spread it evenly on YEB solid plate medium, and incubate it upside down in a 28℃ constant temperature incubator for 2 days.

[0121] (4) Pick a single colony into a 1.5 mL centrifuge tube and incubate at 28℃ and 220 r / min for 14-20 h;

[0122] (5) PCR verification: The bacterial culture that yielded positive transformants was stored at -80℃.

[0123] 2.7 Steps for co-culturing Cicadae periostracum and Agrobacterium tumefaciens:

[0124] (1) Take 100 μL of Agrobacterium positive transformant culture and add it to 20 mL of YEB liquid medium (containing 50 μg / mL Carb and 50 μg / mL Kan) in an Erlenmeyer flask, and incubate overnight at 28 °C and 220 r / min;

[0125] (2) Collect bacterial cells by centrifugation at 12000 r / min for 2 min, discard the supernatant, resuspend the bacterial cells in 1M liquid medium, and record the OD value of the bacterial solution. 600 Adjust to 0.15;

[0126] (3) Incubate at 28℃ and 220r / min for 6h with shaking until the bacterial concentration reaches OD600. 660 It is 0.5-0.8;

[0127] (4) Take the above Agrobacterium bacterial solution and the prepared spore suspension in equal volumes and mix them well;

[0128] (5) Take 100 μL of the mixed liquid and spread it evenly on IM solid plate culture medium, and incubate it in a constant temperature incubator at 28℃ for 48 h.

[0129] (6) Cover the IM solid plate medium with 15-20 mL of M-100 solid medium, and after the medium solidifies, incubate in a 25℃ constant temperature incubator for 5 days.

[0130] (7) The resistant single colonies were transferred to resistant M-100 solid medium for secondary screening;

[0131] (8) The resistant single colonies that grew on the surface of the M-100 solid medium after secondary screening were transferred to PDA solid plate medium containing cellophane and placed in a constant temperature incubator at 25℃ for 5 days.

[0132] (9) Extract DNA and verify it by PCR.

[0133] 3. Determination of beauveria bassiana:

[0134] 3.1 Sample preparation: Weigh an appropriate amount of the well-mixed sample, add 1 ml of 70% methanol, grind for 5 min, vortex for 1 min, centrifuge, and then take the supernatant to pass through a membrane for instrumentation.

[0135] 3.2 Operating methods and procedures for liquid chromatographs and mass spectrometers:

[0136] (1) Chromatographic column: Agilent C 18 Column (2.1mm × 100mm, 1.7μm);

[0137] (2) Column temperature: 35℃, flow rate: 0.3mL / min;

[0138] (3) Acquisition mode: ESI+;

[0139] (4) Injection volume: 2 μL;

[0140] (5) Mobile phase gradient ratio:

[0141]

[0142] 3.3 Calculation formula:

[0143] The content is calculated using the formula:

[0144] Note:

[0145] W—The content of the target substance in the sample, in μg / kg;

[0146] C—Concentration of the target analyte in the sample solution, in μg / kg;

[0147] C0—Concentration of the target analyte in the blank control, in μg / kg;

[0148] V – Constant volume, in mL;

[0149] N – Dilution factor;

[0150] m — the amount of sample taken, in grams.

[0151] 4. Experimental Results

[0152] 4.1 Results of PCR verification of the knockout strain and verification of resistance to 5-fluoroorotic acid.

[0153] Validation of the knockout strains involved screening for single transformants on a medium covered with Agrobacterium tumefaciens and Cordyceps militaris using 5-fluoroorotic acid. These single transformants were then cultured on cellophane-lined medium for 4 days. Genomic DNA was extracted from a small amount of mycelium to verify whether URA3 and Kivr were knocked out. Primers were designed near the precursors of URA3 and Kivr to verify the presence of the target fragment.

[0154] PCR validation results are as follows Figure 1 As shown, (a) shows the PCR verification result of the target primer for URA3 with no band, while the wild-type (WT) control band size is 889 bp; (b) shows the PCR verification result of the target primer for Kivr with no band, while the wild-type (WT) control band size is 488 bp. 5-Fluoroic acid was used as a screening agent... Figure 2 As shown, ΔURA3 grows normally on PDA medium containing 5-fluoroorotic acid under the condition of added uridine / uracil, while the wild type cannot grow normally; Cordycepschanhua KIVI grows normally without the addition of uridine / uracil, but cannot grow in PDA medium containing 5-fluoroorotic acid. In summary, this proves that URA3 and Kivr knockout strains have been obtained.

[0155] 4.2 Results of Cordyceps chanhua KIVI colony morphology and growth diameter

[0156] To analyze the effect of Kivr gene knockout on the growth of Cordyceps chanhua, WT and Cordyceps chanhua KIVI strains were prepared into 1×10⁻⁶ strains. 7 A spore suspension of conidia / mL was inoculated at 1 μL into PDA, SDAY, and 1 / 4 SDAY. After culturing for 7 days, the colony size was observed and the growth diameter was measured using the cross-sectional method.

[0157] like Figure 3As shown, the growth diameters of WT and Cordyceps chanhua KIVI on PDA were 42.72 (±0.48, n=5) and 39.43 (±0.94, n=5), respectively; on SDAY, they were 34.33 (±0.90, n=5) and 30.65 (±0.34, n=5), respectively; and on 1 / 4 SDAY, they were 32.23 (±1.79, n=5) and 29.79 (±0.08, n=5), respectively. Compared with WT, there was no significant difference in the growth diameter of Cordyceps chanhua KIVI on PDA, SDAY, and 1 / 4 SDAY (P>0.05), indicating that the deletion of the Kivr gene does not affect the growth and development process of Cordyceps chanhua KIVI.

[0158] 4.3 Results of Cordyceps chanhua KIVI colony morphology and relative growth inhibition rate

[0159] To analyze the effect of Kivr gene knockout on the chemical stress resistance of Cordyceps chanhua, H2O2 (2 mmol), NaCl (2000 ug / mL), and Congo Red (600 ug / mL) were added to PDA solid medium. WT and Cordyceps chanhua KIVI strains were prepared into 1×10⁻⁶ saturated solutions. 7 A spore suspension of conidia / mL was inoculated at 1 μL into three different culture media. After culturing for 7 days, the colony size was observed and the growth diameter was measured using the cross-cross method. The relative growth inhibition rate of WT and Cordyceps chanhuaKIVI strains under different chemical stress conditions was calculated. The results showed that the growth inhibition rates of WT and Cordyceps chanhua KIVI strains on PDA+H2O2 were 21.90 (±1.67, n=5) and 22.85 (±0.87, n=5), respectively; on PDA+NaCl, they were 1.54 (±1.11, n=5) and -7.03 (±0.47, n=5), respectively; and on PDA+Congo Red, they were 49.44 (±6.81, n=5) and 33.19 (±9.78, n=5), respectively. These results indicated that compared with the wild type, there were no significant differences in the relative growth inhibition rates of Cordyceps chanhua KIVI on PDA+H2O2, PDA+NaCl, and PDA+Congo Red (P>0.05), suggesting that knocking out Kivr did not significantly affect the chemical stress resistance of Cordyceps chanhua.

[0160] 4.4 Results of relative germination rate determination of Cordyceps chanhua KIVI after UV irradiation

[0161] To analyze whether knocking out the Kivr gene affects the UV tolerance of Cordyceps chanhua, WT and Cordyceps chanhua KIVI strains were formulated into 5×10⁻⁶ strains respectively. 6 The spore suspension at conidia / mL was dried and then placed in a UV crosslinker (0.2 J / cm²). 2 The experimental group was irradiated for 5 seconds, while the control group received no UV irradiation. 20 μL of each strain was inoculated onto GB medium, dried, and then cultured at 25°C. After 24 hours, the spores were observed and counted under a microscope, and the relative germination rate was calculated. The results showed that after 24 hours of UV irradiation, the relative germination rates of WT and Cordyceps chanhua KIVI were 29.74% (±2.53, n=5) and 5.67% (±0.87, n=5), respectively. Compared with the wild type, the relative germination rate of Cordyceps chanhua KIVI was significantly reduced, indicating that the knockout of Kivr reduced the UV tolerance of Cordyceps chanhua.

[0162] 4.5 Results of relative germination rate determination of Cordyceps chanhua KIVI after heat shock

[0163] To analyze whether knocking out the Kivr gene affects the heat resistance of Cordyceps chanhua, WT and Cordyceps chanhuaKIVI strains were prepared into 5×10⁻⁶ samples. 6 A spore suspension of conidia / mL was prepared, then treated in a 42℃ water bath for 30 min, and 20 μL was inoculated onto GB medium. After drying, the medium was incubated in a 25℃ incubator. After 24 h, the spores were observed and counted under a microscope, and the relative germination rate was calculated. The results are as follows: Figure 6 As shown, after 24 hours of UV irradiation, the relative germination rates of WT and Cordyceps chanhua KIVI were 12.36% (±1.33, n=5) and 4.61% (±0.29, n=5), respectively. Compared with the wild type, the relative germination rate of Cordyceps chanhua KIVI was significantly reduced, and the absence of all Kivr reduced the heat tolerance of Cordyceps chanhua.

[0164] 4.6 Results of Cordyceps chanhua KIVI sporulation assay

[0165] To verify the role of Kivr in the sporulation process of Cordyceps chanhua, 35 mm PDA solid medium was prepared in advance, with 5 mL PDA per plate. WT and Cordyceps chanhua KIVI were prepared into a 1×10⁻⁶ medium. 6A spore suspension of conidia / mL was taken, and 30 μL was spread onto PDA medium and incubated at 25°C. After 7 and 14 days, all spores were scraped into Tween-80 medium and shaken to disperse. The spore yields of the two strains, WT and Cordyceps chanhua KIVI, at 7 and 14 days were calculated using a hemocytometer to determine the spore production: 6.76 × 10⁻⁶. 6 conidia / cm 2 (±0.71, n=5), 6.80×10 6 conidia / cm 2 (±0.78, n=5) and 18.14×10 6 conidia / cm 2 (±1.54, n=5), 32.15×10 6 conidia / cm 2 (±2.34, n=5), after 14 days, the sporulation of Cordyceps chanhua KIVI was significantly increased compared with the wild type. Therefore, the knockout of the Kivr gene enhanced the asexual reproduction ability of Cordyceps chanhua.

[0166] 4.7 Results of Beauveria bassiana determination in Cordyceps chanhua KIVI

[0167] To determine whether the knockout of Kivr affected the beauvericin content in *Cicada nymphoides*, WT and *Cordyceps chanhuaKIVI* were inoculated onto grain culture medium to obtain fruiting bodies. A suitable amount of the sample was weighed, thoroughly mixed, centrifuged, and the supernatant was filtered through a membrane for analysis. The results are as follows: Figure 8 As shown, the beauvericin content in WT was 195.81 mg / kg, and the beauvericin content in Cordycepschanhua KIVI was 0.66 mg / kg. In summary, the beauvericin content in the fruiting body of Cordycepschanhua KIVI is far less than 3 mg / kg, which meets the beauvericin content requirements stipulated in the "Announcement of the National Health Commission on 15 kinds of 'Three New Foods' including Cordyceps chanhua fruiting bodies (artificially cultivated)" (No. 9 of 2020).

[0168] The nucleotide sequences of the orotic acid nucleotide decarboxylase gene URA3 and the beauveria bassiana synthase regulatory gene Kivr are shown below:

[0169] CDS sequence of the URA3 gene: (SEQ ID NO.1)

[0170] ATGGCGTCTCATCCGACTCTCAAGGCTACTTTTGCATCGAGAGCTGCCACAGCCAC

[0171] CCACCCTCTCAATGCCTATCTCTTCAAGTTGATGGATCTCAAAGCCTCAAATCTCTG

[0172] CCTCAGCGCCGATGTCGCAACCGCCCACGAACTTCTCTACTTTGCCGACAGGATCG

[0173] GTCCCGCCATTGTTGTCCTCAAGACTCATCATGACATGGTCTCGGGATGGGACTTT

[0174] CACCCCCAGCACGGCACTGGCGCAAAGCTCGCTGCTCTGGCCCGGCGCCATGGCT

[0175] TCCTCATCTTCGAAGACCGCAAGTTTGGAGATATCGGCAACACGGTTGAGCTGCA

[0176] GTACACCAGCGGCTCCGCTCGCATCATTGAATGGGCTCACATCGTCAACGTCAACA

[0177] TGGTTCCCGGCAAAGCCTCCGTCACCTCCCTAGCCAATGCCGCCTCCAGATGGCTT

[0178] GAGCGCTACCCGTGCGAAGTGCACACTTCGGTCACCGTAGGCACTCCGACAACTG

[0179] ACCAGTTTGATCCGGAGGAAGAGCAACAGGATGCCGCTCCAGATGCCCAAGAAAC

[0180] GCCAGCCGCATATCGACGAGAAGATGGCCGCAAGGGCAGTATCGTCTCCGTCACC

[0181] ACCGTCACACAAAAATACGAGTCTGCTTTGTCACCGCGCATGAGCAAGAGCATTA

[0182] GCGAAGGCGACGAGATGCTGTTCCCCGGTATCGAGGAGGCACCTCTGGAGCGTGG

[0183] ACTACTCATCCTCGCGCAGATGTCCAGTCAAGGCAACTTCATGAACAAAGAGTAC

[0184] ACGCAAGCTTGCGTTGAGGCTGCCCGGGAGCACAAGGGCTTTGTCATGGGCTTCG

[0185] TATCTCAGGAGTGCCTCAACACCCGGGACGATGACCTCTTTCTGCACATGACTCCC

[0186] GGCTGTCAACTGCCACCCGAAGGCGACGCAAACGGCACCCTCAAGGGTGACGGC

[0187] AAGGGTCAGCAGTACAACACACCTGCAAACATCATTGGCGTTGCTGGCTCTGACA

[0188] TTGCTATTGTCGGGCGTGGCATTCTTAAAGCTAGCGATCCGTACGAGGAGGCCGAG

[0189] CGTTACCGGTCAGCTGCTTGGAAAGCATACACGGAAAGGCTCCGGTGAKivr gene CDS sequence: (SEQ ID NO.2)

[0190] TCACAGTAGTCTCCTCGCCAACTCCTCCTTGTCCAGGACCTCACACCCCTCAATCA

[0191] ACTCAACCAATCCCCGATGGACGCTCACGTCCAGGTCACCGCCCAAAAAAGCAGC

[0192] CATTTCAAGTAACCAACCATTGACATCCCGTATTTCTGTCTTCCTCCCGGCCTCCAC

[0193] ATCCTGGAGCATCGAGCTTCGGTGCTCGCTGATCTTCAGCCCAAACGCGTACAGCT

[0194] TGGCCTTGAGGATCGGCTGCGAAAATCGAACACACAGCTTGCGGCGAATTGCAGC

[0195] AAAATTCCTGTCATAGTCATCGCTGCCGGGCATGAGCCGACGCACTGTCTCTGCGT

[0196] AGGATGCAATCACGTCGACGCTCGTCTCATGGTTGATCAGGGCTTGGGTCACCACG

[0197] CTGGCCTGCCACAGAAGCTTGTCAAGAACGCGCGTCAGGGAGTCCTGCGAATCGT

[0198] AGCTCGCGAAAAGCTGTCCGTTTTGCATCGCAGCAGGGTCGTGAGTGGGTTGAT

[0199] GGCGGCGTTGACGATCAGCTTCTCCAGCTGGATGAGCCACAGCTCGCCGACGAC

[0200] ACAACCTTGGTATCGACAACGGGCGTGCTGCTGATGTAACGGATGAAGCGGTCAC

[0201] CCAGAAGCATCTTTTTTCGATTCATTGACGGCGGGGAACCGTAGAATATGGGTCCA

[0202] ATGAAGGCATCGGCCGGCGCAGAATGGATGCTCCGAAAGGGCCCGACTGACGACA

[0203] GCCCGTGGTTCACCACACAGGCAGAAAAGGAGGGTGCTTCGTGGCATGATATCG

[0204] GTTGGCCACGTATAGAGGGCCGTGAGGAGGCCACAGCTTATTGACGCCGTTTTGTG

[0205] CAAAGACGACGGAGCTGCATCGTCCCAAGTATCGACGCAGTCGGTCCGCTTCTGC

[0206] CAGGCCAGCGTTGGCTTTGTTGAAATGAAGAGGTTGTGCAACTTCTGTCCATCAG

[0207] CAACTTCTCTGACAGGCCCGTACGGTGGTCTAGTCTCAGACCACCACTCAACGTTG

[0208] AAGTGTTTGTTTTGCAGTCTCTTGCCGCCACGTCGATCGGTGAGGACTACTCCTTC

[0209] GCTCGTGATCCATTCCAACAAGAGTTCCTTTCTATGCACAACCAGTGTGATTGGTA

[0210] GGGCGTCAGTATTCATGGACATGTAGCTCGCATACAGTCTTCCGACGTTACCGGGT

[0211] CCGACGATGAAGATGTGGTTCGCGGAGTTCGCCGGGAAAGCCATCGTTTTCGCCCA

[0212] CGTCCTCGAGCTGTGCTTCCATGGATGGATCAATGTTGGCAGGGGACCAAGCGAAT

[0213] AGCTTCGGGGGGGTTCTTGTGTCTTCAAGAAGCGCTGAAAGCCAGTGAGGATACT

[0214] CTTGGGAGGCCAT

[0215] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A *Cicadae Fragrance* strain with low beauveria bassiana content, characterized in that, Its accession number is CCTCC NO: M2025637.

2. The fruiting body of the cicada flower strain according to claim 1.

3. The fruiting body of the *Cicada Flower* strain according to claim 2, characterized in that, The content of beauveria bassiana in the fruiting body is <3 mg / kg.

4. The use of the Cordyceps militaris strain of claim 1 or the fruiting body of claim 2 in the production of food protein and / or feed protein.

5. Application of the gene Kivr in regulating fungal metabolism.

6. The application according to claim 5, characterized in that, Application in regulating the synthesis of beauveria bassiana in Cordyceps militaris.

7. Application of the URA3 gene and / or the Kivor gene in screening for Cordyceps militaris strains with low beauveria bassiana content.

8. A method for screening *Cicadae Fragrance* strains with low beauveria bassiana content, characterized in that, Includes the following steps: (1) The herbicide resistance gene bar was removed by double enzyme digestion of plasmid pPK2-bar. The upstream and downstream regions of the URA3 coding region were inserted into the plasmid to obtain the URA3 knockout plasmid pPK2-URA3. (2) Then, by using homologous recombination technology and 5-fluoroorotic acid (5-FOA) to screen uridine / uracil auxotrophic strains, we obtained the URA3 gene-deleted Cordyceps militaris strain. (3) Insert the URA3 coding region of cicada flower, the upstream promoter and the downstream terminator region into the plasmid to obtain the pPK2-EURA3 plasmid; PCR was used to obtain upstream and downstream fragments of the 2-ketoisovalerate reductase gene *kivr*, which were then inserted into the *pPK2-EURA3* plasmid to obtain the *kivr* knockout plasmid *pPK2-EURA3-kivr*. (4) Transform plasmid pPK2-EURA3-kivr into Agrobacterium tumefaciens AGL-1 and obtain a kivr knockout strain without resistance marker based on homologous recombination technology.

9. A fungal gene knockout vector pPK2-EURA3-kivr, characterized in that, Its multiple cloning site region is sequentially connected to the upstream homologous arm of the Kivr gene, the URA3 uracil / uridine defect gene expression cassette, and the downstream homologous arm of the Kivr gene.

10. The fungal gene knockout vector pPK2-EURA3-kivr according to claim 9, characterized in that, The upstream and downstream homologous arms of the Kivr gene are sequences 1–1.5 kJ upstream and downstream of the Kivr gene ORF region, respectively. The fragments are linked to the pPK2-EURA3 plasmid backbone through BamHI and SpeI restriction sites.

Images