Staphylococcus carnosus with high salt tolerance and good fermentation characteristic and application of staphylococcus carnosus

Abstract

The invention provides staphylococcus carnosus with high salt tolerance and good fermentation characteristic and application thereof, and belongs to the technical field of microorganism application and meat product processing. The staphylococcus carnosus is staphylococcus carnosus XUCSB 022, the staphylococcus carnosus is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation date is June 24, 2025, and the preservation number of the strain is CGMCC No.34991. The staphylococcus carnosus has the advantages that the staphylococcus carnosus XUCSB 022 can be used for preparing the staphylococcus carnosus; the staphylococcus carnosus XUCSB 022 strain disclosed by the invention has the beneficial effects that the staphylococcus carnosus XUCSB 022 strain has the capacity of resisting the salt concentration of 18% ultimately and has the capacity of degrading nitrite in fermented meat, after the meat product is fermented for 15 days, the average value of the residual quantity of the nitrite is 9.77 mg / kg and is reduced by 39.77% compared with a CK group, flavor substances containing aldehydes, ketones, alcohols, esters, acids and other types are generated, and the flavor substances are rich in flavor substances, rich in flavor substances and capable of resisting the salt concentration of 18%. The strain has the characteristics of high safety, excellent fermentation capability and fermentation aroma-producing capability during inoculation of fermented meat, and provides strain resources for production of fermented meat products.

Description

Technical Field

[0001] This invention belongs to the field of microbial application and meat processing technology, specifically relating to a highly salt-tolerant Staphylococcus aureus with good fermentation characteristics and its application. Background Art

[0002] The flavor, texture, and safety of fermented meat products (such as salami, cured ham, bacon, and sausage) are highly dependent on microbial activity. In traditional fermentation, microorganisms produce enzymes such as proteases and lipases through metabolism, breaking down muscle proteins and fats to generate polypeptides, free amino acids, fatty acids, and volatile flavor compounds (such as aldehydes and ketones), giving the product a unique flavor and improving its texture (e.g., tenderizing, reducing firmness). However, natural fermentation relies on the environmental microbial community and suffers from problems such as long fermentation cycles (usually several months or even more than a year), unstable quality (e.g., excessive hydrolysis leading to a loose texture), and unreliable food safety (e.g., potential pathogen contamination). In food industrial production, high-quality strains selected through inoculation are typically used as fermentation agents for meat products, effectively shortening the fermentation cycle, improving product quality, and ensuring the safety and controllability of the fermentation process. The microorganisms used for meat product fermentation mainly include molds, yeasts, coagulase-negative staphylococci (CNS), and lactic acid bacteria. During their metabolic activities, they can improve the taste, texture, flavor, and color of meat products, inhibit the growth of miscellaneous bacteria, give fermented meat products a unique flavor and quality, and improve the nutritional value of fermented meat products.

[0003] Staphylococcus carnosus, a coagulase-negative staphylococcus (CNS), is present in various fermented meats and is now widely used in food. Since the 1950s, Staphylococcus carnosus has been used as a starter culture for fermented meats such as salami and cured ham. It possesses many advantages, such as the ability to form and stabilize a desirable red color through nitrate reduction (e.g., the formation of nitrosomyoglobin), catalase-positive properties extending shelf life, inducing the breakdown of proteins and fats in meat, and exhibiting salt and nitrite tolerance. In the updated announcement (No. 4, 2022) of the National Health Commission of China regarding the "List of Microbial Strains that Can Be Used in Food" and the "List of Microbial Strains that Can Be Used in Infant Food," Staphylococcus carnosus is listed as a microorganism suitable for food processing, primarily used in fermented meat products. The most promising microorganisms used as meat starter cultures are typically found within the microbial community of the fermented meat substrate; they are adapted to the environment and conditions of fermentation and therefore may possess stronger growth and fermentation characteristics. The growth of bacterial strains is susceptible to the effects of the processing environment of fermented meat products, particularly the salt, nitrite, and acidity of the product. Sodium chloride is the most commonly used component in the production of fermented meat products, playing a crucial role in quality (dissolution of myofibrillar proteins and saltiness) and safety (reducing water activity, thereby inhibiting microbial growth). For example, 100 grams of fermented sausage contains 230 to 3300 mg of sodium, making these fermented meat products a significant dietary source of sodium. Fermented meat products using different traditional curing processes typically contain varying salt contents; however, the reported fermentation characteristics and salt tolerance of Staphylococcus aureus are limited. This invention provides a Staphylococcus aureus strain with extremely high salt tolerance and excellent fermentation characteristics, which can be used to produce different types of fermented meat products adapted to processing conditions with varying salt contents.

[0004] Patent application CN109868251A discloses a Staphylococcus aureus strain B1-2 with color-developing properties and its application in salami sausage. This Staphylococcus aureus can achieve color development to replace nitrite. The conversion of metmyoglobin by strain B1-2 was studied in shake-flask MRS medium, but NOS expression of strain B1-2 was induced using the toxic reagent methanol. Furthermore, salami sausage was inoculated and fermented for 21 days without the addition of nitrite to achieve the goal of promoting salami sausage fermentation and maturation without nitrite addition. However, the Staphylococcus aureus in this patent does not exhibit high salt tolerance.

[0005] Currently, there are no reported Staphylococcus aureus strains that can cope with the production of fermented meat products under different salt concentrations. Summary of the Invention

[0006] The technical problem to be solved by this invention is how to provide a highly salt-tolerant Staphylococcus aureus strain with good fermentation characteristics and its applications.

[0007] The present invention solves the above-mentioned technical problems through the following technical means:

[0008] The first aspect of this invention provides a highly salt-tolerant and fermentation-promoting Staphylococcus aureus strain, with accession number CGMCC No. 34991.

[0009] The Staphylococcus carnosus strain is Staphylococcus carnosus XUCSB 022, which has been deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with the accession number CGMCC No. 34991 and the classification name Staphylococcus carnosus.

[0010] Preferably, the 16S rDNA sequence of the Staphylococcus aureus is shown in SEQ ID NO.1.

[0011] A second aspect of the present invention proposes the application of the above-mentioned Staphylococcus aureus in the fermentation preparation of meat products.

[0012] The present invention also proposes the application of the above-mentioned Staphylococcus aureus in the preparation of meat fermentation inoculants.

[0013] A third aspect of the present invention provides a meat fermentation agent with excellent salt tolerance and fermentation flavor, the main components of which include one or more of the above-mentioned Staphylococcus aureus, Staphylococcus aureus fermentation supernatant, and Staphylococcus aureus lysate.

[0014] Preferably, the fermentation supernatant is obtained by culturing the Staphylococcus aureus in a culture medium for a period of time and then centrifuging to remove the bacterial cells.

[0015] Preferably, the lysate is obtained by culturing the Staphylococcus aureus in a culture medium for a period of time, followed by ultrasonic disruption and centrifugation to remove the bacterial cells.

[0016] The fourth aspect of the present invention provides a method for improving the sensory flavor of fermented meat products, comprising the following steps: adding the above-mentioned meat fermentation agent during the preparation of fermented meat products, and then proceeding with the normal process.

[0017] Preferably, the meat includes, but is not limited to, pork, beef, mutton, or its heart, liver, lungs, kidneys, etc.

[0018] Preferably, the fermented meat products include, but are not limited to, cured meat, sausage, ham, etc.

[0019] Preferably, the main component of the meat fermentation agent is the aforementioned Staphylococcus aureus, and the addition concentration is 0.5-1.5 × 10⁻⁶. 7 CFU / g.

[0020] Preferably, the method includes the following steps: mincing the meat into granules, then adding 0.5-1.5% glucose, 0.005-0.015% sodium nitrite, and 2-3% salt by weight; and adding Staphylococcus aureus XUCSB 022 to a concentration of 0.5-1.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5-2.5 hours, stuff the mixture into sausages, and hang them in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure is as follows: air dry at 22-27℃ for 20-28 hours with a relative humidity of 40-50%; ferment at 22-27℃ for 2-4 days with a relative humidity of 70-80%; and dry and mature at 16-20℃ with a relative humidity of 60-70% for 10-15 days.

[0021] The beneficial effects of the present invention are:

[0022] 1. This invention proposes a Staphylococcus carnosus strain XUCSB 022, with accession number CGMCC NO:34991. Its characteristics include the ability to grow under ≥18% NaCl conditions, nitrite degradation capability, and good fermentation characteristics. It possesses nitrate reduction ability, protein and fat hydrolysis capability, is catalase positive, does not hemolyze, does not produce mucus, produces acid but not gas, does not produce NH3, does not produce H2S, does not produce bio-amines, is resistant to 150 mg / L Na2NO2, and is acid-resistant (pH 4.5) and low-temperature resistant (10℃).

[0023] 2. The Staphylococcus aureus of this invention possesses nitrate reductase, catalase, proteolytic enzymes, and lipolytic enzymes. It can utilize glucose to produce acid, and exhibits acid resistance, nitrite resistance, and low-temperature resistance. This is beneficial for enriching the variety of microbial resources in high-salt environments, adapting to the production of fermented meat with different salt concentrations, and the adaptive evolution mechanism of microorganisms has been studied.

[0024] 3. Breakthrough in salt tolerance, achieving high salt and low nitrate performance.

[0025] The Staphylococcus carnosus XUCSB 022 strain of this invention exhibits the ability to tolerate a maximum salt concentration of 18% and the ability to degrade nitrite in fermented meat. After 15 days of fermentation, the average nitrite residue in meat products was 9.77 mg / kg, a reduction of 39.77% compared to the control group, and far lower than the 30 mg / kg nitrite residue in fermented meat products. This indicates that Staphylococcus carnosus XUCSB 022 has a good ability to degrade nitrite.

[0026] 4. It has outstanding aroma and color production capabilities, forming a unique sensory flavor.

[0027] When Staphylococcus carnosus of the present invention was inoculated into fermented sausage, after 15 days of fermentation, the redness value a* was 15.96±0.80, which was 1.27 higher than that of the control group. There were 21 volatile flavor compounds, more than the 11 in the control group. Among them, alcohols, unsaturated hydrocarbons, aromatics, and acids are unique to Staphylococcus carnosus XUCSB 022, making the flavor of the fermented sausage more complex and layered, and promoting the formation of unique sensory flavor characteristics. Attached Figure Description

[0028] Figure 1 The morphological characteristics of Staphylococcus carnosus XUCSB 022 on MSA solid plate and microscopic Gram staining are shown in Example 1 of this invention.

[0029] Figure 2 This is a phylogenetic tree of Staphylococcus carnosus XUCSB 022 (abbreviated as C22) in Example 1 of the present invention.

[0030] Figure 3 The table shows the viable count of Staphylococcus carnosus XUCSB 022 (C22) in MSA medium with different salt concentrations in Example 1 of this invention; Note: Different letters indicate statistically significant differences (P<0.05). Error bars represent standard deviations (SD).

[0031] Figure 4 This invention illustrates the effect of inoculation with Staphylococcus carnosus XUCSB 022 (C22) on the redness value (a*) of fermented sausage in Example 1. Note: Different letters indicate statistically significant differences (P<0.05). Error bars represent standard deviation (SD).

[0032] Figure 5 The nitrite content of fermented sausage after 15 days inoculated with Staphylococcus carnosus XUCSB 022 (C22) in Example 1 of this invention; Note: Different letters indicate statistically significant differences (P<0.05). Error bars represent standard deviation (SD). Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0034] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0035] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0036] Preservation of microbial strains

[0037] Staphylococcus carnosus XUCSB 022 is deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 24, 2025, with accession number CGMCC No. 34991; deposit address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0038] Example 1: A highly salt-tolerant Staphylococcus aureus strain with good fermentation characteristics and its application

[0039] 1. Experimental materials:

[0040] Sample: Changsha cured pork from Hunan.

[0041] MSA liquid culture medium: 3g beef extract, 10g peptone, 10g NaCl, 10g D-mannitol, 1000mL distilled water, adjust pH to 7.2. Sterilize at 121℃ for 15min.

[0042] MSA solid culture medium: 3g beef extract, 10g peptone, 10g NaCl, 10g D-mannitol, 1000mL distilled water, 18g agar powder, adjust pH to 7.2. Sterilize at 121℃ for 15min.

[0043] 2. Experimental Methods

[0044] 2.1 Sequencing of the strain's 16S rDNA

[0045] Primer 7F was used: CAGAGTTTGATCCTGGCTCAG (SEQ ID NO.2)

[0046] PCR amplification was performed using primer 1540R: AGGAGGTGATCCAGCCGCA (SEQ ID NO.3). The PCR amplification conditions were: 95℃, 5 min; 95℃, 15 s, 55℃, 15 s, 72℃, 1 min 30 s, 34 cycles; 72℃, 5 min; stored at 4℃. The amplified DNA fragments were detected using 1% agarose gel and sent to Shanghai Sangon Biotech for sequencing.

[0047] 2.2 Sample preparation:

[0048] Samples of cured pork were collected from local residents in Changsha, Hunan Province. 25g of cured pork was taken with sterile scissors, chopped, and added to 225mL of physiological saline (0.9% NaCl solution). The mixture was homogenized using a sterile homogenizer (SCIENTZ-09) (SCIENTZ, Ningbo, China) at a speed of 12 times / second for 2 minutes. 1ml of sample was then collected and serially diluted 10-fold with physiological saline. 100µL of each appropriate serial dilution was spread onto MSA solid medium, screened for bacteria at 30℃, and incubated for 72 hours. Colonies with inconsistent morphology were randomly selected and streaked three times until purified.

[0049] 2.3 Determination of physicochemical properties of Staphylococcus carnosus XUCSB 022:

[0050] 2.3.1 Screening for hemolysis characteristics

[0051] Using a sterile inoculating loop, streak activated pure bacteria from MSA liquid medium onto Columbia blood agar plates and incubate at 37°C for 48 hours. Observe whether there is a hemolytic zone around the colony. If a transparent hydrolyzed area appears around the colony, it is β-hemolysis; if a partially hydrolyzed or dark green area appears, it is α-hemolysis; if there is no obvious change around the colony, it is γ-hemolysis (non-hemolysis).

[0052] 2.3.2 Viscosity Generation Experiment

[0053] If a single colony cultured on MSA solid medium is picked up directly with an inoculation needle and no stringing occurs, then no sticky substance is produced.

[0054] 2.3.3 Nitrate reductase activity

[0055] Preparation of nitrate-reducing solid medium: 0.2% potassium nitrate was added to MSA medium and sterilized.

[0056] The isolated and purified bacterial colonies were inoculated onto nitrate-reducing solid medium and incubated upside down at 37°C for 8 hours. 1 mL of Griess' reagent A and 1 mL of reagent B were added to the medium, and after one minute of reaction, the remaining liquid was poured off. The appearance of a red color zone around the colonies was observed, and the size of the color zone was compared. The size of the red color zone can, to some extent, reflect the relative activity of the nitrate reductase in the bacterial strain.

[0057] 2.3.4 Protease activity

[0058] Add 5% skim milk powder (SM medium) to MSA solid enrichment medium and sterilize at 115℃ for 20 min. Inoculate onto SM medium using the single colony inoculation method and incubate at 37℃ for 48 h, observing the decomposition of the clear zone.

[0059] 2.3.5 Lipase Activity

[0060] Add 1% glyceryl tartrate to MSA solid enrichment medium, dissolve the soluble substance uniformly by sonication, and sterilize at 115℃ for 20 min. Inoculate the glyceryl tartrate medium using the single colony inoculation method, incubate at 37℃ for 72 h, and observe the decomposition of the clear zone.

[0061] 2.3.6 Catalase Experiment

[0062] Take a clean glass slide and place a drop of 3% hydrogen peroxide solution on it. Use an inoculation needle to pick up a single colony of the bacteria to be tested and smear it in the hydrogen peroxide solution. Observe whether bubbles are produced. The production of bubbles indicates a positive catalase reaction of the bacteria; the absence of bubbles indicates a negative reaction.

[0063] 2.3.7 Detection of Glucose Gas and Acid Production

[0064] Glucose fermentation gas-producing medium: 1g peptone, 0.5g NaCl, 1g glucose, add 100mL distilled water, adjust pH to 7.4, add a trace amount of 1.6% bromocresol purple solution (0.16g dissolved in 10mL 95% ethanol) until the solution turns purple, dispense into test tubes, 10mL per tube, invert the Durham tubes into the test tubes and remove air, sterilize at 121℃ for 15min. Then, inoculate 1% bacterial suspension into the test tubes and incubate at 37℃ for 24h. A blank control group is included. If bubbles are produced in the Durham tubes, it indicates that the inoculated bacteria are fermenting glucose to produce gas; if the color turns yellow, it indicates acid production.

[0065] 2.3.8 NH3 production detection

[0066] Arginine ammonia-producing medium: 5g peptone, 5g yeast extract, 5g beef extract, 2.5g NaCl, 0.5g glucose, 2g ammonium citrate, 2g dipotassium hydrogen phosphate, and 10g L-arginine were dissolved in 1000mL distilled water. The pH was adjusted to 5.3. The solution was dispensed into test tubes (10mL per tube), and an inverted Durham tube was added to remove air. The tubes were then sterilized at 121℃ for 15min. The test strain was inoculated with a 1% bacterial suspension into the test tubes containing NH3-producing medium. Sterile liquid paraffin was added to cover the surface of the medium, and the tubes were incubated at 37℃ for 24h. The presence of bubbles in the Durham tubes indicated a positive result for NH3 production.

[0067] 2.3.9 Detection of biological amines

[0068] Amino acid decarboxylase detection medium: 5g peptone, 3g beef extract, 1g glucose, 0.02g bromocresol purple, and 5g amino acids (L-lysine and L-ornithine, respectively) were dissolved in 1000mL distilled water, and the pH was adjusted to 6.8. The solution was dispensed into test tubes (10mL per tube) and sterilized at 121℃ for 15min. The test strain was inoculated with a 1% bacterial suspension into the test tubes containing the different amino acids, covered with sterile liquid paraffin, and incubated at 37℃ for 48h. The color change was observed; if the color first turned yellow and then purple, the result was positive.

[0069] 2.3.10 H2S Detection

[0070] Ferrous sulfate agar medium: 0.3g beef extract, 0.3g yeast extract, 1g peptone, 0.02g ferrous sulfate, 0.03g sodium thiosulfate, 0.5g NaCl, 1.2g agar, dissolved in 100mL distilled water, pH adjusted to 7.4, sterilized at 121℃ for 15min. After sterilization, remove and stand upright until it solidifies into a uniform solid state.

[0071] 2.3.11 NaNO2 Resistance Detection

[0072] A 1% concentration of activated third-generation bacterial culture was inoculated into 150 mg / L MSA liquid medium. Turbidity was observed after 24 hours, and OD was measured. 600 .

[0073] 2.3.12 Acid Resistance Test

[0074] A 1% concentration of activated third-generation bacterial culture was inoculated into MSA liquid medium at pH 4.5, 5, and 5.5. Turbidity was observed after 48 hours, and OD was measured. 600 .

[0075] 2.3.13 Low Temperature Resistance Test

[0076] A 1% concentration of activated third-generation bacterial culture was inoculated into MSA liquid medium and incubated at 10°C for 48 hours. Turbidity was observed, and OD was measured. 600 .

[0077] 2.4 Antibiotic susceptibility testing

[0078] The antibiotic susceptibility of screened strains was determined using the KB method (disk diffusion method). 100 μL of activated, third-generation bacterial suspension grown to the end-log phase was evenly spread onto MSA solid medium. After the plate surface was slightly dry, antibiotic disks containing a quantitative amount of each antibiotic were affixed to the plate containing the strain. A total of eight antibiotics were used: rifampin (5 μg), chloramphenicol (30 μg), kanamycin (30 μg), streptomycin (10 μg), tetracycline (10 μg), penicillin (10 μg), vancomycin (30 μg), and gentamicin (10 μg). The plates were incubated at 37°C. The size of the inhibition zone reflected the sensitivity of the screened bacteria to the tested antibiotics. The diameter of the inhibition zone (mm) was measured after 48 hours.

[0079] 2.5 PCR assay for determining enterotoxin and amine-producing genes

[0080] PCR technology is used to directly confirm the presence of pathogenic genes and biogenic amine genes, including the sea, seb, sec, sed, and see enterotoxin genes, as well as hdc (histidine decarboxylase gene), odic (ornithine decarboxylase gene), tdc (tyrosine decarboxylase gene), and ldc (lysine decarboxylase gene).

[0081] 2.6 Salt Tolerance Test

[0082] Inoculate 1% of the activated third-generation bacterial culture into liquid enrichment medium containing 2%-18% MSA, incubate at 37°C for 48 hours, observe turbidity, and detect viable cell count using MSA solid medium.

[0083] 2.7 Staphylococcus aureus applied to fermented sausages

[0084] 2.7.1 Making Fermented Sausage

[0085] The pork raw material was selected from the hind leg of free-range pigs, minced into granules using a meat grinder, with a lean-to-fat ratio of 2:8 (m / m). Seasonings were added: 1% glucose, 0.01% sodium nitrite, and 2.5% salt. The control group received 5% sterile water, while the experimental group received a bacterial solution mixed with 5% sterile water. The concentration of the single-strain bacterial fermentation agent was 1×10⁻⁶. 7 CFU / g. Chop and mix thoroughly. After low-temperature marinating for 2 hours, stuff into sausages and hang in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure was as follows: natural air drying at 25℃ for 24 hours, with relative humidity controlled at 45%; fermentation at 25℃ for 3 days, with relative humidity at 75%; drying and maturation at 18℃, with humidity at 65%, for 11 days. Sampling was conducted at 0, 3, 6, 9, 12, and 15 days.

[0086] 2.7.2 Color Changes in Fermented Sausages

[0087] Remove the fat, chop the sample, mix and press into thin slices 1.5 cm thick and 2.5 cm in diameter. Calibrate the colorimeter and measure the redness value (a*) of the sausage. Perform three parallel measurements.

[0088] 2.7.3 Determination of nitrite residue in fermented sausages

[0089] The spectrophotometric method in the national standard GB 5009.33-2016 was used for detection.

[0090] 2.7.4 GC-MS determination

[0091] (1) Sample pretreatment

[0092] Weigh 2.0 g of chopped sample into a 20 mL headspace vial, and add 10 μL of 0.1 g / L 2,4,6-trimethylpyridine as an internal standard. Headspace solid-phase microextraction (SPME) was used. For the first use, a syringe was used for injection, and the SPME extraction tip was preheated at the GC inlet (250 °C) for 20 min. Then, the microextraction needle was inserted into the headspace vial, and extraction was performed for 30 min. The sample was then manually transferred to GC-MS, desorbed for 5 min, and analyzed for volatile flavor compounds.

[0093] (2) GC conditions: The chromatographic column was a DB-5MS capillary column (60m × 0.32mm, 1μm); the carrier gas was high-purity helium; the flow rate was 0.8mL / min; the injection port temperature was 250℃, and the split mode was used with a split ratio of 5:1 and a split flow rate of 4mL / min. Hold for 2min. The initial column temperature was 40℃, and hold for 5min. The temperature program was as follows: increase the temperature to 90℃ at a rate of 2℃ / min, hold for 0min, then increase the temperature to 100℃ at a rate of 5℃ / min, hold for 0min, and then increase the temperature to 230℃ at a rate of 10℃ / min, hold for 8min.

[0094] (3) MS conditions: Full scan mode was used, and the mass spectrometer scanning mass was 45-500 m / z. The ion source was EI, the ion source temperature was 230℃, the electron energy was 70 eV, and the sample inlet temperature was 250℃.

[0095] The content of each volatile component (internal standard: 2,4,6-trimethylpyridine, concentration: 100 ppm, usage: 10 μL) is calculated using the following formula:

[0096] The amount of flavor compound (mg / kg) = (C0*V0 / m)*(A1 / A2), where C0 is the concentration of the internal standard (mg / L), V0 is the injection volume of the internal standard (µL), and m is the mass of the chopped sample (g). A1 is the peak area of ​​the compound, and A2 is the peak area of ​​the internal standard.

[0097] 3. Experimental Results

[0098] 3.1 Isolation, purification, and 16S rDNA sequencing of Staphylococcus aureus

[0099] The morphological characteristics of Staphylococcus carnosus XUCSB 022 on MSA plates and the results of Gram staining microscopy at 60x magnification are shown in the figure. Figure 1 The colonies are approximately 0.15 ± 0.05 cm in diameter, opaque, pale yellow, with a moist and smooth surface and edges, and a slightly raised center. They stain purple with Gram stain, indicating that Staphylococcus carnosus XUCSB 022 is a positive bacterium.

[0100] The sequencing sequence of the 16S rDNA of Staphylococcus carnosus XUCSB 022 is as follows:

[0101] (SEQ ID NO.1)

[0102]

[0103] NCBI sequence comparison revealed a 99.79% sequence similarity to strain *Staphylococcus carnosus* HSP-S10. To further clarify the phylogenetic relationship and taxonomic position of this strain, a phylogenetic tree was constructed. The results showed that *Staphylococcus carnosus* XUCSB 022 (C22) and *Staphylococcus carnosus* HSP-S10 clustered together in the phylogenetic tree, as shown in the phylogenetic tree below. Figure 2 As shown, it was therefore identified as Staphylococcus carnosus.

[0104] 3.2 Physicochemical properties of Staphylococcus carnosus XUCSB 022

[0105] The physicochemical properties of *Staphylococcus carnosus* XUCSB 022 were determined as shown in the table below. As can be seen from the table, using agar plate color reaction, *Staphylococcus carnosus* XUCSB 022 exhibits high nitrate reducing ability. Nitrate reductase activity plays an important role in the formation of the red color and flavor in fermented meat, with a red circle diameter of 4.25 ± 0.16 cm. Through agar plate hydrolysis zone test, *Staphylococcus carnosus* XUCSB 022 also possesses good proteolytic and lipolytic abilities. Proteases break down proteins to form free amino acids, and lipases break down fats to form fatty acids, playing an important role in the special aroma and flavor of fermented meat. Simultaneously, it also possesses the ability to adapt to the fermentation environment, surviving under conditions of low temperature, high sodium chloride (see description of salt tolerance test results), high sodium nitrite concentrations, and an acidic pH of 4.5-5.5.

[0106] The fermentation physicochemical properties of Staphylococcus carnosus XUCSB 022 are shown in the table below:

[0107]

[0108]

[0109] Note: "+" and "-" indicate whether the reaction is positive or negative. The numbers represent OD values. 600 The absorbance at that point.

[0110] 3.3 Antibiotic susceptibility testing of Staphylococcus aureus

[0111] The results of the antibiotic susceptibility test for Staphylococcus carnosus XUCSB 022 are shown in the table below. As can be seen from the table, using the susceptibility testing method, Staphylococcus carnosus XUCSB 022 exhibited inhibition zones to all commonly tested antibiotics in this study, indicating susceptibility. Among them, penicillin, rifampin, and chloramphenicol showed the largest inhibition zones, indicating the highest susceptibility. This demonstrates that Staphylococcus carnosus XUCSB 022 is a non-drug-resistant bacterium, will not cause the spread of drug-resistant genes into the environment, meets GRAS standards, and ensures the safety of fermented foods.

[0112] Drug susceptibility of Staphylococcus carnosus XUCSB 022

[0113]

[0114] 3.4 Detection of virulence genes in Staphylococcus aureus

[0115] The PCR results of enterotoxin and amine-forming genes in *Staphylococcus carnosus* XUCSB 022 are shown in the table below. The PCR results indicate that *Staphylococcus carnosus* XUCSB 022 does not contain virulence genes, including the enterotoxin-coding genes sea, seb, sec, sed, and see, as well as biogenic amine-forming genes such as histamine (hdc), cadaverine (ldc), putrescine (odc), and tyramine (tdc). Therefore, further safety testing demonstrates that *Staphylococcus carnosus* XUCSB 022 has the potential to be relatively safe for use in fermented meat.

[0116] PCR detection of enterotoxin and biogenic amine production genes in Staphylococcus carnosus XUCSB 022

[0117]

[0118] Note: "+" and "-" indicate whether the phenomenon is positive or negative.

[0119] 3.5 Salt tolerance characteristics of Staphylococcus aureus

[0120] The salt tolerance of Staphylococcus carnosus XUCSB 022 is as follows: Figure 3 As shown, under MSA liquid medium concentrations of 2%-12% salt, there was no significant difference in the viable count of *Staphylococcus carnosus* XUCSB022. At a salt concentration of 14%, the viable count decreased by 3.30-fold, while at 14%-16% salt concentrations, there was no significant difference. After 24 hours of incubation at an 18% salt concentration, MSA solid plate assays showed a sharp decrease in the viable count of *Staphylococcus carnosus* XUCSB022, but some viable cells remained, with a survival rate of 3.56-3.70 log CFU / mL. This indicates that *Staphylococcus carnosus* XUCSB022 possesses excellent salt tolerance and can withstand different salt concentrations in fermented meat production processes.

[0121] 3.6 Characteristics of Staphylococcus aureus in fermented sausages

[0122] 3.6.1 Color Changes

[0123] The effect of inoculation with Staphylococcus carnosus XUCSB 022 on the redness value (a*) of fermented sausage after 15 days was detected using a colorimeter. The results are as follows: Figure 4 As shown. Nitrites, as a food additive, have multiple functions, including improving the color of meat products. The color formation of fermented sausages is achieved through the action of nitrate reductase in microorganisms on nitrites. The reduction product, nitric oxide (NO), interacts with myoglobin in the meat to form the red pigment nitrosomyoglobin. Figure 4 It was found that from day 3 until day 15 when the fermented sausages matured, the redness value of the fermented sausages inoculated with Staphylococcus carnosus XUCSB 022 was significantly higher than that of the uninoculated control group. On day 15, the redness value a* was 15.96±0.80, which was 1.27 higher than that of the CK group. This indicates that Staphylococcus carnosus XUCSB 022 promotes the formation of red color in fermented sausages.

[0124] 3.6.2 Detection of nitrite residue in fermented sausages

[0125] After 15 days of fermentation, the residual nitrite level in the fermented sausage was as follows: Figure 5As shown, the average nitrite residue in fermented sausages from the *Staphylococcus carnosus* XUCSB 022 group was 9.77 mg / kg, while the average nitrite residue in the control group (CK) was 16.22 mg / kg, representing a reduction of 39.77%, and was also lower than the 30 mg / kg nitrite residue in fermented meat products. This indicates that *Staphylococcus carnosus* XUCSB 022 has a good ability to degrade nitrite.

[0126] 3.6.3 Detection of volatile flavor compounds in fermented sausages

[0127] The flavor compounds in fermented sausages originate from a series of physical and biochemical changes in fats, proteins, and carbohydrates during sausage production, as well as added flavorings. They are mainly related to the presence of volatile substances such as aldehydes, ketones, esters, alcohols, acids, and phenols. The table below shows the results of GC-MS detection of volatile substances in fermented sausages inoculated with *Staphylococcus carnosus* XUCSB 022. A total of 24 volatile substances were identified. In the *Staphylococcus carnosus* XUCSB 022 group, 20 volatile chemical substances were detected, including 2 aldehydes, 1 alcohol, 10 esters, 3 unsaturated hydrocarbons, 2 aromatic hydrocarbons, and 2 acids. In the CK group, 11 volatile chemical substances were detected, including 1 aldehyde, 2 ketones, and 8 esters. Compared to the control group, *Staphylococcus carnosus* XUCSB 022 exhibits a richer variety of volatile chemical compounds, which significantly contribute to the richness and complexity of sausage flavor. Among these, alcohols such as 2-methyl-3-butyn-2-ol, esters such as ethyl cyanate, methyl propionate, methyl butyrate, and methyl isovalerate, unsaturated hydrocarbons such as limonene, styrene, and 1,3-hexadien-5-yne, acids such as isooctanoic acid and 2-oxovaleric acid, and aromatic hydrocarbons such as ethylbenzene and o-xylene are unique to *Staphylococcus carnosus* XUCSB 022.

[0128] Staphylococcus carnosus XUCSB 022 Content of volatile flavor compounds in fermented sausage

[0129]

[0130]

[0131] Note: Different lowercase letters indicate significant differences in the data of different sample groups in the same row (P < 0.05); ND means the corresponding compound was not detected.

[0132] Esters are formed by the esterification of alcohols and acids, and most of them have an aromatic flavor. Esters containing short-chain acids (<C6) mostly have a fruity aroma, while esters containing long-chain acids (C14 - C18) mostly have a faint oily taste. Free fatty acids produced by fat hydrolysis can also react with alcohols to form esters, which contribute significantly to the unique flavor of sausages. The total ester content in the CK group was 3151.91 ± 276.35 μg / kg, higher than that in the Staphylococcus carnosus XUCSB 022 group, which was 1679.88 ± 257.60 μg / kg. However, the number of ester substances was less than that in the Staphylococcus carnosus XUCSB 022 group. The top 3 substances with the highest ester content in the CK group were mainly methyl acetate, ethyl acetate, and methyl octanoate. The top 3 substances with the highest ester content in the XUCSB 022 group were mainly ethyl acetate, methyl acetate, and methyl butyrate. Aldehydes contribute significantly to the formation of the special flavor of fermented meat products and can reflect the degree of fat oxidation. The XUCSB 022 group had more aldehydes than the CK group, but with a lower threshold, making them secondary contributors. Ketones are generally produced by the Maillard reaction and have a buttery flavor. Two ketone substances were only detected in the CK group, but ketones are secondary contributors to the aroma of meat products. Alcohols generally come from carbohydrate metabolism, fat oxidation, and amino acid catabolism. Most unsaturated alcohols have a good fruity and herbal aroma. Among them, the XUCSB 022 group contains unique unsaturated alcohols that may impart a fruity aroma to fermented sausages. Compared with the CK group, the presence of unsaturated hydrocarbons such as alkenes, alkynes, and aromatic hydrocarbons can increase the flavor complexity of the Staphylococcus carnosus XUCSB 022 group, imparting fruity, nutty, and buttery flavors to fermented sausages, but with a lower threshold, making them secondary flavor components. Acids in fermented sausages are mainly produced by microorganisms metabolizing carbohydrates. Isooctanoic acid has a slightly cheesy and fatty aroma when present in appropriate amounts. 2-oxopentanoic acid is a keto acid with a fruity, sweet, or slightly sour taste. The Staphylococcus carnosus XUCSB 022 group contains acids, while the CK group did not detect acids. Acids are representative in fermented sausages and also play an important role in the formation of esters. The presence of acids can enrich the taste and aroma of fermented sausages, making the flavor of sausages more complex and layered, and promoting the formation of their unique sensory flavor characteristics.

[0133] In summary, Staphylococcus carnosus XUCSB 022 is a promising meat fermentation agent with high salt tolerance and good fermentation characteristics.

[0134] The strain was derived from Hunan cured pork, a traditional fermented food (Changsha, Hunan, China). Screening methods included nitrate reducing ability, protein and fat hydrolysis ability, catalase positivity, hemolytic characteristics, production of mucus, gas and acid, production of NH3, production of H2S, production of bioamines, resistance to Na2NO2, acid resistance, and low temperature resistance.

[0135] 2.16S rDNA molecular biological identification and phylogenetic tree construction confirmed it as Staphylococcus carnosus.

[0136] Breakthrough technological features:

[0137] 1. Extremely high salt tolerance: The bacteria remained viable after 24 hours of incubation at an 18% salt concentration. MSA plate assays showed that *Staphylococcus carnosus* XUCSB 022 maintained a viable count of 7.57 log CFU / mL at a 16% salt concentration. This salt tolerance is comparable to known patents, but the viable count at 16% salt surpasses the viable count of *Staphylococcus carnosus* M43 as described in the known patents when the viable count began to decline at a 12% salt concentration.

[0138] 2. Color development ability: Inoculation with 1×10 7 CFU / g of Staphylococcus carnosus XUCSB022 was inoculated from day 3 until day 15 when the sausages matured. The redness value of the sausages inoculated with Staphylococcus carnosus XUCSB022 was significantly higher than that of the uninoculated control group. On day 15, the redness value (a*) was 15.96 ± 0.80, an increase of 1.27 compared to the control group. This indicates that Staphylococcus carnosus XUCSB022 promotes red color formation in fermented sausages.

[0139] 3. Nitrite Degradation Capacity: The initial nitrite content of the fermented sausage was 100 mg / kg. After 15 days of fermentation, the average nitrite residue in the sausage fermented with Staphylococcus carnosus XUCSB 022 was 9.77 mg / kg, a decrease of 39.77% compared to the control group (CK), and lower than the 30 mg / kg nitrite residue in fermented meat products. This indicates that Staphylococcus carnosus XUCSB 022 has a good ability to degrade nitrite.

[0140] 4. Aroma production capacity: Inoculation 1×10 7 CFU / g Staphylococcus carnosus XUCSB022 was analyzed by GC-MS for volatile compounds. Compared with the 11 compounds in the control group, Staphylococcus carnosus XUCSB022 contained 21 more volatile flavor compounds. Among them, alcohols, unsaturated hydrocarbons, aromatics, and acids are characteristic of sausages fermented with Staphylococcus carnosus XUCSB022.

[0141] 5. Safety: No hemolytic characteristics; PCR verification showed no enterotoxins or amine-producing genes; antibiotic sensitivity of the selected strains was determined by the KB method paper disk agar diffusion method, showing sensitivity to all 8 antibiotics, meeting GRAS standards.

[0142] Comparative Example 1:

[0143] (1) The strain published under CN109868251A, when inoculated into salami sausages and fermented to maturity, showed a redness value increasing to approximately 16, comparable to the redness value of matured meat products inoculated with the strain Staphylococcus carnosus XUCSB 022 in this embodiment. However, this technical solution does not provide tests on the strain's own fermentation ability or safety. Furthermore, the proper and appropriate use of nitrite not only contributes to color development but also acts as a preservative to inhibit lipid oxidation and has antibacterial effects, inhibiting the growth of harmful microorganisms such as Clostridium botulinum. When using strain B1-2 for sausage fermentation for 21 days (longer than the 15-day fermentation time using strain Staphylococcus carnosus XUCSB 022 in this patent), the flavor compounds and sensory evaluation of the salami sausages without added nitrite were unknown, and it was unclear whether the mature salami sausages were prone to spoilage and storage. In addition, it was unclear whether the characteristics of this strain were applicable to processing techniques for more fermented meat products with different salt contents.

[0144] (2) Patent application CN110846260A discloses a strain of Staphylococcus aureus M43 that can reduce biogenic amines and its application in soybean paste. This strain was screened from soybean paste and its degradation under culture medium conditions was studied for eight biogenic amines required for the experiment. The results showed a degradation rate of 1.51%-100% for different biogenic amines. After inoculation into soybean paste, the biogenic amine content was measured, and it could degrade all eight biogenic amines with a degradation rate of 8.69%-100%. Furthermore, the viable cell count was measured at different salt concentrations. It can grow at salt concentrations of 0%-18%, but at salt concentrations above 12%, the viable cell count significantly decreased, falling below 7.25 log CFU / mL. This technology also explored the optimal growth temperature for Staphylococcus aureus M43 between 20℃ and 45℃. Therefore, it is not suitable for outdoor soybean paste fermentation in cold winters (the Staphylococcus aureus XUCSB 022 strain disclosed in this patent can still grow at 10℃). The patent also failed to test the fermentation ability and safety of the strain itself, and failed to study its contribution to aroma production in other fermented foods such as fermented meat products.

[0145] (3) Patent application CN 118516286 A discloses a compound fermentation agent (Staphylococcus xylose YB-12, Staphylococcus carinatum S10, and Zoonoticia calfii S11), which can improve the color of fermented meat products and reduce the additional addition of nitrite in meat products to reduce the residue of nitrite in fermented meat products, thereby improving the safety and quality of meat products. Among them, Staphylococcus carinatum S10 has the effect of protecting color and enhancing aroma. It promotes color development by producing nitrate reductase, and its metabolites release more aroma substances by decomposing proteins and fats, playing an important role in the flavor formation of fermented meat products.

[0146] (4) The literature (Shi Zhijia, Zang Mingwu, Lü Yu. Effect of Staphylococcus aureus on sausage color development [J]. Meat Research, 2012, 26(02):4-7.) utilizes the nitrate reductase activity of Staphylococcus aureus to study the effect of different factors on the color development (redness value) of sausage by Staphylococcus aureus, and optimizes the color development process conditions. Finally, the optimal color development conditions of Staphylococcus aureus were obtained as follows: nitrate addition of 0.005%, isoVC-Na addition of 0.01%, Staphylococcus aureus freeze-dried powder addition of 0.25%, heat preservation temperature of 30℃ and heat preservation time of 3h.

[0147] (5) The literature (Müller, A. et al., Safety assessment of selected Staphylococcus carnosus strains with regard to their application as meat starterculture. Food Control 2016, 66, 93-99.) analyzed the safety risks of 39 different Staphylococcus carnosus strains, including virulence and pathogenicity determinants. Only two strains were resistant to more than one antibiotic. None of the tested strains tested positive for staphylococcal enterotoxin genes, exfoliative toxin genes, or toxic shock syndrome toxin genes via PCR. None of the tested strains produced cadaverine, putrescine, or histamine. This study screened and assessed the safety feasibility of S. carnosus strains, ensuring their safe application as starter cultures in fermented foods.

[0148] (6) The literature (Zhou Huimin, Zhang Shunliang, Zhao Bing, et al. Effect of mixed starter culture of Staphylococcus xylose and Staphylococcus caryopsis on the quality of cured meat[J]. Food Science, 2018, 39(22):32-38.) reported the use of Staphylococcus caryopsis and Staphylococcus xylose from Chr. Hansen (Beijing) Trading Co., Ltd. as mixed starter culture. Among them, Staphylococcus caryopsis has a maximum salt tolerance of 16%, does not produce acid, and has nitrate reductase and catalase, proteolytic enzyme and lipolytic enzyme.

[0149] Example 2:

[0150] A method for improving the sensory flavor of fermented sausages includes the following steps:

[0151] Mince the pork into small pieces, then add 0.5% glucose, 0.005% sodium nitrite, and 2% salt by weight; and add Staphylococcus aureus XUCSB 022 to a concentration of 0.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5 hours, stuff into sausages, and hang in a pre-sterilized constant temperature and humidity chamber for fermentation, drying and maturation of sausages; the program is as follows: natural air drying at 22℃ for 20 hours with a relative humidity of 40%; fermentation at 22℃ for 2 days with a relative humidity of 70%; drying and maturation at 16℃ with a relative humidity of 60% for 10 days.

[0152] Example 3:

[0153] A method for improving the sensory flavor of fermented sausages includes the following steps:

[0154] Mince the pork into small pieces, then add 1.5% glucose, 0.015% sodium nitrite, and 3% salt by weight; and add Staphylococcus aureus XUCSB 022 to a concentration of 1.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 2.5 hours, stuff into sausages, and hang in a pre-sterilized constant temperature and humidity chamber for fermentation, drying and maturation of sausages; the procedure is as follows: natural air drying at 27℃ for 28 hours with a relative humidity of 50%; fermentation at 27℃ for 4 days with a relative humidity of 80%; drying and maturation at 20℃ with a relative humidity of 70% for 15 days.

[0155] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A highly salt-tolerant Staphylococcus aureus strain with excellent fermentation characteristics, characterized by: The accession number is CGMCCNo.34991.

2. The Staphylococcus aureus according to claim 1, characterized in that: The 16S rDNA sequence of the Staphylococcus aureus is shown in SEQ ID NO.

1.

3. The use of Staphylococcus aureus as described in claim 1 in the fermentation preparation of meat products or in the preparation of meat fermentation agents.

4. A meat fermentation agent with excellent salt tolerance and fermentation flavor, characterized in that: Its main components include one or more of the following: Staphylococcus aureus as described in claim 1, fermentation supernatant of Staphylococcus aureus, and lysate of Staphylococcus aureus.

5. The meat fermentation agent according to claim 4, characterized in that: The fermentation supernatant is obtained by culturing the Staphylococcus aureus in a culture medium for a period of time and then centrifuging to remove the bacterial cells.

6. The meat fermentation agent according to claim 4, characterized in that: The lysate is obtained by culturing the Staphylococcus aureus in a culture medium for a period of time, followed by ultrasonic disruption and centrifugation to remove the bacterial cells.

7. A method for improving the sensory flavor of fermented meat products, characterized in that: Includes the following steps: During the preparation of fermented meat products, the meat fermentation agent described in claim 4 is added.

8. The method according to claim 7, characterized in that: The meats include pork, beef, mutton, or their heart, liver, lungs, and kidneys; the fermented meat products include bacon, sausage, ham, and cured meat.

9. The method according to claim 7, characterized in that: The main component of the meat fermentation agent is Staphylococcus aureus as described in claim 1, and the concentration added is 0.5-1.5 × 10⁻⁶. 7 CFU / g.

10. The method according to claim 7, characterized in that: Includes the following steps: The meat is minced into granules, then 0.5-1.5% by weight of glucose, 0.005-0.015% by weight of sodium nitrite, and 2-3% by weight of salt are added; and the Staphylococcus aureus as described in claim 1 is added, with an addition concentration of 0.5-1.5 × 10⁻⁶. 7 CFU / g; after chopping and mixing, marinate for 1.5-2.5 hours, stuff the mixture into sausages, and hang them in a pre-sterilized constant temperature and humidity chamber for fermentation, drying, and maturation. The procedure is as follows: air dry at 22-27℃ for 20-28 hours with a relative humidity of 40-50%; ferment at 22-27℃ for 2-4 days with a relative humidity of 70-80%; and dry and mature at 16-20℃ with a relative humidity of 60-70% for 10-15 days.

Images