Whole blood free DNA preserving fluid, vacuum blood collection tube and application

Abstract

The invention relates to the technical field of biological medicine, and particularly discloses a whole blood free DNA preserving fluid, a vacuum blood collection tube and application, and the preserving fluid is prepared by mixing an anticoagulant, a ribozyme inhibitor, a DNA stabilizer, a metabolic inhibitor, a cell stabilizer and RNase-free pure water. The preservation solution has excellent nuclease inhibition efficiency, and free DNA in plasma can be remarkably protected and is prevented from being degraded; meanwhile, the blood cell structure can be stabilized, blood cell rupture is effectively inhibited, and then nuclear DNA is prevented from being mixed into cfDNA to be detected to cause pollution. Besides, the preservation solution and the vacuum blood collection tube containing the preservation solution can remarkably prolong the stable storage time of the blood sample under the room temperature condition, provide convenience for long-distance transportation of the blood sample, and solve the problem that the prior art cannot give consideration to the structural integrity of blood cells and the detection accuracy of cfDNA. The stability of the blood sample is difficult to maintain for a long time under a normal temperature condition.

Description

Technical Field

[0001] This application relates to the field of biomedical technology, and in particular to a whole blood cell-free DNA preservation solution and a vacuum blood collection tube and its application. Background Technology

[0002] Cell-free DNA (cfDNA), as an important molecular marker in living organisms, has shown great potential in research and application in areas such as non-invasive prenatal diagnosis and tumor liquid biopsy. This type of cfDNA mainly originates from apoptotic cells in healthy individuals, but also includes cfDNA released by tumor cells and the fetus in pregnant women. However, the content of cfDNA in plasma is extremely low and easily affected by various factors, such as nuclease degradation and genomic DNA contamination. These factors severely hinder the accurate detection of cfDNA.

[0003] Currently, two main measures are taken to ensure the quality of cfDNA testing: first, whole blood samples are collected using blood collection tubes containing anticoagulants to avoid clotting of whole blood cells and reduce the release of genomic DNA from white blood cells; second, plasma is separated within 6 hours of collection and stored and transported at 4°C, but the storage time must be controlled within a certain range to prevent nucleases in the plasma from degrading cfDNA. Although these measures have improved the detection results of plasma cfDNA to some extent, there are still many shortcomings. Long-term storage at 4°C leads to a significant loss of cfDNA, thus affecting the accuracy of the test. In addition, low-temperature storage and transportation not only increase the complexity of operations but also increase costs, bringing many inconveniences to applications such as early tumor screening and prenatal screening.

[0004] Existing technologies have made the following improvements to address the above problems: They use urea as a cell membrane osmotic pressure regulator to maintain cell integrity, or disodium EDTA as a chelating agent to prevent metal ions from catalyzing cfDNA degradation, or ascorbic acid to protect cfDNA from oxidative damage, and nuclease-inhibiting peptides to inhibit the degradation of cfDNA by nucleases. However, these methods still have certain limitations in completely preventing blood cell lysis and the release of genomic DNA. Summary of the Invention

[0005] In view of this, the purpose of this application is to provide a whole blood cell-free DNA preservation solution and a vacuum blood collection tube and its application, in order to solve the shortcomings of the prior art that cannot simultaneously ensure the structural integrity of blood cells and the accuracy of cfDNA detection, as well as the difficulty in maintaining the stability of blood samples under normal temperature conditions for a long period of time.

[0006] To achieve the above technical objectives, this application provides a whole blood cell-free DNA preservation solution, comprising the following components:

[0007] Anticoagulant, ribonuclease inhibitor, DNA stabilizer, metabolic inhibitor, cell stabilizer, and RNase-free purified water.

[0008] Further, it includes the following components in parts by weight: 20-100 parts of anticoagulant; 30-100 parts of ribozyme inhibitor; 10-80 parts of DNA stabilizer; 1-30 parts of metabolic inhibitor; 100-300 parts of cell stabilizer; and 200-800 parts of RNase-free purified water.

[0009] Further, the anticoagulant is at least one of sodium citrate, sodium citrate, sodium heparin, lithium heparin, dipotassium EDTA, tripotassium EDTA, and disodium EDTA; and / or, the ribozyme inhibitor is at least one of diethyl pyrocarbonate, disodium hydrogen phosphate, urea, ammonium sulfate, sodium dodecyl sulfate, guanidine isothiocyanate, cysteine, benzyl sulfonyl fluoride, dithiothreitol, and Schiff base-vanadium complex of 4-formylbenzoate; and / or, the DNA stabilizer is EDTA, glucose, mannose, or succinate. At least one of trehalose, hydroxyethyl starch, polyvinyl alcohol, glycine, polylysine, dithiothreitol, and β-mercaptoethanol; and / or, at least one of sodium fluoride, adenine, ginsenoside tricarboxylic acid, sodium azide, glyceraldehyde, and iodoacetic acid; and / or, at least one of 4-hydroxyethylpiperazine ethanesulfonic acid, glycine, mannitol, polyvinyl alcohol, trehalose, vitamin C, vitamin E, glutathione, dimethyl sulfoxide, sodium pyruvate, glycerol, polyvinylpyrrolidone, and hydroxyethyl starch.

[0010] This application provides a method for preparing a whole blood cell-free DNA preservation solution, comprising the following steps:

[0011] The anticoagulant, ribozyme inhibitor, DNA stabilizer, metabolic inhibitor, cell stabilizer, and RNase-free pure water were mixed and then filtered to obtain a whole blood free DNA preservation solution.

[0012] This application provides a method for storing a whole blood cell-free DNA preservation solution, wherein the whole blood cell-free DNA preservation solution is stored in an environment below 35°C.

[0013] This application provides an application of a whole blood cell-free DNA preservation solution for blood storage; or, for the preparation of products with blood storage function.

[0014] This application provides a vacuum blood collection tube containing a whole blood cell free DNA preservation solution.

[0015] Furthermore, the volume ratio of the whole blood cell-free DNA preservation solution to the volume of the vacuum blood collection tube is 1:(30~150).

[0016] This application provides a method for preparing a vacuum blood collection tube, comprising the following steps: filling a sterilized blood collection tube with a whole blood cell-free DNA preservation solution, and subjecting the blood collection tube to vacuum treatment to obtain a vacuum blood collection tube.

[0017] This application provides an application of a vacuum blood collection tube, characterized in that it is used to store blood.

[0018] In summary, this application provides a whole blood cell-free DNA preservation solution. This solution is formulated from an anticoagulant, a ribozyme inhibitor, a DNA stabilizer, a metabolism inhibitor, a cell stabilizer, and RNase-free purified water. It possesses excellent nuclease inhibition efficacy, significantly protecting cell-free DNA in plasma from degradation. Simultaneously, it stabilizes blood cell structure, effectively inhibiting cell rupture and preventing nuclear DNA from contaminating the cfDNA to be detected. Furthermore, the preservation solution and the vacuum blood collection tube containing it significantly extend the stable storage time of blood samples at room temperature, greatly facilitating long-distance transportation of blood samples.

[0019] This application also provides a vacuum blood collection tube containing a whole blood cell-free DNA preservation solution, which enables efficient collection, safe storage and convenient transportation of screening samples.

[0020] Compared with existing technologies, the preservation solution provided in this application has significant effects in inhibiting blood cell rupture and improving the accuracy of cfDNA detection, and can also realize long-term storage and transportation of blood samples at room temperature. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The hemolysis test characterization diagrams are for Examples 1, 2 and Comparative Example 3; where A, B and C correspond to Examples 1, 2 and Comparative Example 3 respectively, and 1 to 5 represent 5 parallel tests.

[0023] Figure 2 The graphs show the qPCR amplification curves for Examples 1, 2, and 3; where A, B, and C correspond to Examples 1, 2, and 3, respectively, and 1 to 5 represent 5 parallel tests. Detailed Implementation

[0024] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this application. Based on the embodiments in this application specification, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection claimed in this application.

[0025] In the description of this application, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing this application and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on this application. Furthermore, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0026] Unless otherwise expressly specified and limited, the terms "installation," "connection," and "linking" should be interpreted broadly. For example, they can refer to fixed connections, detachable connections, or integral connections; they can refer to mechanical connections or electrical connections; they can refer to direct connections or indirect connections through an intermediate medium; and they can refer to the internal connection between two components. Those skilled in the art can understand the specific meaning of the above terms in this application based on the specific circumstances.

[0027] The raw materials used in this invention are not particularly restricted in their source; they can be purchased on the market or prepared using conventional methods known to those skilled in the art.

[0028] This application provides a whole blood cell-free DNA preservation solution, comprising the following components:

[0029] Anticoagulant, ribonuclease inhibitor, DNA stabilizer, metabolic inhibitor, cell stabilizer, and RNase-free purified water.

[0030] The whole blood cell-free DNA preservation solution has excellent nuclease inhibition efficacy, which can effectively prevent the degradation of cell-free DNA in plasma; the preservation solution can stabilize the blood cell structure, effectively inhibit blood cell rupture, and prevent nuclear DNA from being mixed into the cfDNA to be tested, thus preventing contamination; in addition, the preservation solution can significantly extend the stable storage time of blood samples at room temperature.

[0031] In some embodiments, the components include the following parts by weight: 2-200 parts of anticoagulant; 1-200 parts of ribozyme inhibitor; 5-200 parts of DNA stabilizer; 1-100 parts of metabolic inhibitor; 1-500 parts of cell stabilizer; and 200-800 parts of RNase-free purified water.

[0032] In some preferred embodiments, the anticoagulant is 2-150 parts; the ribozyme inhibitor is 1-100 parts; the DNA stabilizer is 5-100 parts; the metabolic inhibitor is 1-80 parts; the cell stabilizer is 1-300 parts; and the RNase-free purified water is 200-800 parts.

[0033] In some preferred embodiments, the anticoagulant is 20-100 parts; the ribozyme inhibitor is 30-100 parts; the DNA stabilizer is 10-80 parts; the metabolic inhibitor is 1-30 parts; the cell stabilizer is 100-300 parts; and the RNase-free purified water is 200-800 parts.

[0034] In some embodiments, the anticoagulant is at least one of sodium citrate, sodium citrate, sodium heparin, lithium heparin, dipotassium ethylenediaminetetraacetate, tripotassium ethylenediaminetetraacetate, and disodium ethylenediaminetetraacetate.

[0035] In some embodiments, the ribozyme inhibitor is at least one of diethyl pyrocarbonate, disodium hydrogen phosphate, urea, ammonium sulfate, sodium dodecyl sulfate, guanidine isothiocyanate, cysteine, benzyl sulfonyl fluoride, dithiothreitol, and Schiff base vanadium complex of 4-formylbenzoate.

[0036] In some embodiments, the DNA stabilizer is at least one selected from ethylenediaminetetraacetic acid, glucose, mannose, trehalose, hydroxyethyl starch, polyvinyl alcohol, glycine, polylysine, dithiothreitol, and β-mercaptoethanol.

[0037] In some embodiments, the metabolic inhibitor is at least one of sodium fluoride, adenine, ginsenoside tricarboxylic acid, sodium azide (NaN3), glyceraldehyde, and iodoacetic acid.

[0038] In some embodiments, the cell stabilizer is at least one of 4-hydroxyethylpiperazine ethanesulfonic acid, glycine, mannitol, polyvinyl alcohol, trehalose, vitamin C, vitamin E, glutathione, dimethyl sulfoxide, sodium pyruvate, glycerol, polyvinylpyrrolidone, and hydroxyethyl starch.

[0039] This application provides a method for preparing a whole blood cell-free DNA preservation solution, comprising the following steps: mixing an anticoagulant, a ribozyme inhibitor, a DNA stabilizer, a metabolic inhibitor, a cell stabilizer, and RNase-free pure water, followed by filtration, to obtain a whole blood cell-free DNA preservation solution.

[0040] This application provides a method for storing a whole blood cell-free DNA preservation solution, wherein the whole blood cell-free DNA preservation solution is stored in an environment below 35°C.

[0041] This application provides an application of a whole blood cell-free DNA preservation solution for blood storage; or, for the preparation of products with blood storage function.

[0042] This application provides a vacuum blood collection tube containing a whole blood cell free DNA preservation solution.

[0043] In some embodiments, the volume ratio of the whole blood cell-free DNA preservation solution to the volume of the vacuum blood collection tube is 1:(30~150).

[0044] In some preferred embodiments, the volume ratio of the whole blood cell-free DNA preservation solution to the volume of the vacuum blood collection tube is 1:(30~100).

[0045] In some more preferred embodiments, the volume ratio of the whole blood cell-free DNA preservation solution to the volume of the vacuum blood collection tube is 1:(30~50).

[0046] In some embodiments, the vacuum negative pressure inside the vacuum blood collection tube is ≥13.0 kg / cm². 2 .

[0047] In some preferred embodiments, the vacuum negative pressure inside the vacuum blood collection tube is 14.0~18.6 kg / cm². 2 .

[0048] It should be noted that the whole blood cfDNA vacuum blood collection tube containing the above-mentioned whole blood cell-free DNA preservation solution provides an ideal solution for the efficient collection, safe storage, and convenient transportation of early tumor screening samples and prenatal screening samples.

[0049] This application provides a method for preparing a vacuum blood collection tube, comprising the following steps: filling a sterilized blood collection tube with a whole blood cell-free DNA preservation solution, and vacuuming the blood collection tube to obtain a vacuum blood collection tube.

[0050] This application provides an application of a vacuum blood collection tube, characterized in that it is used to store blood.

[0051] The applicant further provides the following specific embodiments to describe the present invention. It should be noted that these embodiments are merely descriptive and do not limit the present invention in any way.

[0052] Example 1

[0053] This embodiment provides a whole blood cell-free DNA preservation solution, comprising the following components in parts by weight:

[0054] 50 parts anticoagulant—sodium citrate, 30 parts ribozyme inhibitor—diethyl pyrocarbonate, 10 parts DNA stabilizer—mannose, 20 parts metabolic inhibitor—adenine, 200 parts cell stabilizer—glycine, and 690 parts RNase-free purified water.

[0055] The whole blood cell-free DNA preservation solution provided in this embodiment is prepared by mixing the above components and then filtering.

[0056] This embodiment provides a vacuum blood collection tube, the preparation method of which is as follows:

[0057] Step S1: The whole blood cell-free DNA preservation solution is sterilized by cobalt-60 irradiation;

[0058] Step S2: Add 0.2 mL of whole blood cell-free DNA preservation solution to a 10 mL blood collection tube, and evacuate the blood collection tube to a negative pressure of 15 kg / cm² to obtain a vacuum blood collection tube; wherein the volume ratio of the preservation solution to the vacuum blood collection tube is 1:50.

[0059] Example 2

[0060] The difference from Example 1 lies in the composition and mass fraction of the whole blood cell-free DNA preservation solution, as detailed below:

[0061] 100 parts anticoagulant—disodium EDTA, 50 parts ribozyme inhibitor—phenylmethylsulfonyl fluoride, 40 parts DNA stabilizer—hydroxyethyl starch, 10 parts metabolic inhibitor—adenine, 200 parts cell stabilizer—glycine, and 600 parts RNase-free purified water.

[0062] Comparative Example 1

[0063] The difference from Example 1 is that the vacuum blood collection tube used in this comparative example is a commercially available purple-capped EDTA vacuum tube, which does not contain whole blood cell-free DNA preservation solution.

[0064] Comparative Example 2

[0065] The difference from Example 1 is that the vacuum blood collection tube used in this comparative example is a commercially available Kangjian Medical free DNA preservation vacuum tube, which contains cell preservatives but does not contain whole blood free DNA preservation solution.

[0066] Comparative Example 3

[0067] The difference from Example 1 is that the cell stabilizer (glycine) is replaced with an equal amount of polyvinylpyrrolidone (PVP).

[0068] Comparative Example 4

[0069] The difference from Example 2 is that the metabolic inhibitor (adenine) is replaced with an equal amount of sodium fluoride.

[0070] To further evaluate the storage effect of the whole blood cell-free DNA preservation solution provided in this embodiment on blood samples, 9.8 mL of blood samples were collected using vacuum blood collection tubes and stored at room temperature (25°C in this embodiment) for 7 days. The hemolysis rate and qPCR CT value of the blood samples were measured on the 0th, 3rd and 7th days of storage, respectively. At the same time, the relevant data of comparative examples 1 to 4 were tested as controls. The test results are shown in Table 1.

[0071] This embodiment also provides test standards or methods for hemolysis rate and CT value of qPCR, and the specific standards and test steps are as follows:

[0072] Hemolysis rate test standard: GB / T16886.4~2022 "Biological evaluation of medical devices - Part 4: Selection of blood interaction tests"

[0073] CT value test for qPCR:

[0074] Step S1: Extract cfDNA using the Baypure magnetic bead cfDNA extraction kit.

[0075] Take a 1.5 mL centrifuge tube and add lysis binding buffer (CLB), freshly separated or thawed plasma, 20 μL proteinase K, and 20 μL magnetic beads (MXVB-CF) in sequence. Mix well and vortex at room temperature for 7-10 minutes to allow the magnetic beads to adsorb DNA, obtaining a sample mixture. Remove the sealing film from the pre-dispensed deep-well plate and transfer the sample mixture (volume less than 990 μL) to the wells in column 2 or 8 of the pre-dispensed deep-well plate. Place the pre-dispensed deep-well plate into the base slot of the nucleic acid extraction and purification instrument, insert the 8-strand magnetic rod sleeve into the sleeve slot, and select the appropriate program according to the number of sample wells. The extracted cfDNA is in the wells in column 5 / 11. Transfer it to a 1.5 mL sterile, nuclease-free centrifuge tube and store at -15 to 25°C.

[0076] Step S2: The qPCR concentration and CT value were detected using an instrument (Beyo Fast SYBR Green qPCR Mix (2X), Bio-rad qPCR instrument).

[0077] The parameters for the PCR reaction system are set as follows:

[0078] The RT-PCR template is β-act; upper primer A is CCACACTGTGCCCATTTACG; lower primer B is ACGGCCAGCAAGATCCAA; the loading volume is 2uL; after melting and mixing Beyo Fast SYBR Green qPCR Mix (2X), place it on an ice bath or in an ice box, and set up the PCR reaction system (8 tubes) at room temperature or on an ice bath according to the following formula:

[0079] Reagent Volume for One PCR Reaction 20μL; Beyo Fast SYBR Green qPCRMix (2X) 10μL; Forward and Reverse Primer Mix (3μMeach) 2μL; Template DNA 2μL; RNase-Free Water 6μL;

[0080] The PCR reaction program parameters were set as follows: a) Pre-denaturation: 95℃, 2 min; b) Denaturation: 95℃, 15 s; c) Annealing / Extension: 60℃, 15~30 s; d) Repeat steps b and c for a total of 40 cycles; e) Melting curve analysis: 95℃ / 15 s, 60℃ / 15 s, 95℃ / 15 s; f) Analyze the results using the software provided by the real-time PCR instrument.

[0081] Table 1. Differences between the Examples and Comparative Examples, and Storage Performance Parameter Values

[0082]

[0083] Based on the data shown in Table 1 and Figures 1-2 Based on the experimental results, the following analytical conclusions can be drawn:

[0084] Experimental results showed that the blood samples treated in Examples 1 and 2 exhibited low hemolysis rates and high CT values ​​during a 7-day storage period at room temperature. In contrast, the blood collection tube storage systems of Comparative Examples 1-4 showed that the hemolysis rate of the blood samples increased significantly with prolonged storage time, while the CT values ​​remained at a low level. Further comparative analysis of Comparative Examples 3-4 indicated that by replacing glycine in Example 1 with PVP and adenine in Example 2 with sodium fluoride, the prepared blood collection tubes containing the preservation solution not only had significantly higher hemolysis rates than those in Examples 1 and 2, but also lower CT values ​​than the other comparative examples.

[0085] The above results indicate that the glycine and other synergistic components added in Example 1 can effectively reduce the hemolysis rate (reduce cell rupture) and demonstrate their inhibitory effect on cfDNA enzymatic digestion by increasing the CT value; the adenine and other complex components in Example 2 also have the dual effect of low hemolysis rate and high CT value. Therefore, the whole blood cell-free DNA preservation solution and its blood collection tubes provided in this application have the ability to balance the integrity of blood cell structure and the accuracy of cfDNA detection, as well as the ability to maintain the stability of blood samples for a long time under normal temperature conditions.

[0086] The above are merely preferred embodiments of this application and are not intended to limit the present invention. Although this application has been described in detail with reference to examples, those skilled in the art can still modify the technical solutions described in the foregoing examples or make equivalent substitutions for some of the technical features. However, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A whole blood cell-free DNA preservation solution, characterized in that, Includes the following components: Anticoagulant, ribonuclease inhibitor, DNA stabilizer, metabolic inhibitor, cell stabilizer, and RNase-free purified water.

2. The whole blood cell-free DNA preservation solution according to claim 1, characterized in that, The components include the following parts by mass: The anticoagulant is 20-100 parts; the ribozyme inhibitor is 30-100 parts; the DNA stabilizer is 10-80 parts; the metabolic inhibitor is 1-30 parts; and the cell stabilizer is 100-300 parts. The amount of RNase-free pure water is 200-800 parts.

3. The whole blood cell-free DNA preservation solution according to claim 1, characterized in that: The anticoagulant is at least one of sodium citrate, sodium citrate, sodium heparin, lithium heparin, dipotassium ethylenediaminetetraacetate, tripotassium ethylenediaminetetraacetate, and disodium ethylenediaminetetraacetate. And / or, the ribozyme inhibitor is at least one of diethyl pyrocarbonate, disodium hydrogen phosphate, urea, ammonium sulfate, sodium dodecyl sulfate, guanidine isothiocyanate, cysteine, benzyl sulfonyl fluoride, dithiothreitol, and 4-formylbenzoic acid Schiff base vanadium complex. And / or, the DNA stabilizer is at least one of ethylenediaminetetraacetic acid, glucose, mannose, trehalose, hydroxyethyl starch, polyvinyl alcohol, glycine, polylysine, dithiothreitol, and β-mercaptoethanol; And / or, the metabolic inhibitor is at least one of sodium fluoride, adenine, ginsenoside tricarboxylic acid, sodium azide, glyceraldehyde, and iodoacetic acid; And / or, the cell stabilizer is at least one of 4-hydroxyethylpiperazine ethanesulfonic acid, glycine, mannitol, polyvinyl alcohol, trehalose, vitamin C, vitamin E, glutathione, dimethyl sulfoxide, sodium pyruvate, glycerol, polyvinylpyrrolidone, and hydroxyethyl starch.

4. A method for preparing a whole blood cell-free DNA preservation solution according to any one of claims 1 to 3, characterized in that, Includes the following steps: The anticoagulant, ribonuclease inhibitor, DNA stabilizer, metabolic inhibitor, cell stabilizer, and RNase-free pure water were mixed and then filtered to obtain a whole blood free DNA preservation solution.

5. A method for storing a whole blood cell-free DNA preservation solution, characterized in that, The storage method involves storing the whole blood cell-free DNA preservation solution as described in any one of claims 1 to 3 or the whole blood cell-free DNA preservation solution prepared by the preparation method described in claim 4 in an environment below 35°C.

6. The application of a whole blood cell-free DNA preservation solution according to any one of claims 1 to 3 or a whole blood cell-free DNA preservation solution prepared by the preparation method according to claim 4, characterized in that, Used for blood storage; or, used to prepare products with blood storage function.

7. A vacuum blood collection tube, characterized in that, The vacuum blood collection tube contains the whole blood cell-free DNA preservation solution as described in any one of claims 1 to 3 or the whole blood cell-free DNA preservation solution prepared by the method described in claim 4.

8. The vacuum blood collection tube according to claim 7, characterized in that, The volume ratio of the whole blood cell-free DNA preservation solution to the volume of the vacuum blood collection tube is 1:(30~150).

9. A method for preparing a vacuum blood collection tube according to any one of claims 7-8, characterized in that, Includes the following steps: Whole blood cell-free DNA preservation solution was filled into sterilized blood collection tubes, and the blood collection tubes were then vacuumed to obtain vacuum blood collection tubes.

10. The application of a vacuum blood collection tube according to any one of claims 7-8 or a vacuum blood collection tube prepared by the preparation method according to claim 9, characterized in that, Used for storing blood.

Images