Snps molecular marker rs637601961 related to the body weight of a goat at 6 months old and application

By screening out the SNP molecular marker rs637601961 associated with the body weight of goats at 6 months of age, and using its G/T polymorphism genotype to select superior individuals, the problems of long breeding cycles and low selection efficiency in goat breeding have been solved, and the growth traits of goats have been rapidly improved and economic benefits increased.

CN120843699BActive Publication Date: 2026-03-17INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511265927.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2026-03-17
Estimated Expiration
2045-09-05

AI Technical Summary

Technical Problem

Existing technologies in goat breeding suffer from problems such as long breeding cycles and low selection efficiency. Furthermore, the effects of SNP loci are unstable across different goat breeds, limiting their versatility and application value.

Method used

A SNP molecular marker rs637601961 associated with the body weight of goats at 6 months of age is provided. It is located on the EPHA6 gene on goat chromosome 1 and has a polymorphism of G/T. Individuals with the genotype of GT or TT associated with this SNP molecular marker are selected, and individuals with the GG genotype are eliminated. The frequency of the T gene at this locus is increased generation by generation to improve the growth performance of offspring goats.

Benefits of technology

Marker-assisted selection significantly increased the body weight of goats at 6 months of age, improved breeding efficiency, shortened the breeding cycle, and increased the economic benefits of the mutton sheep farming industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843699B_ABST
    Figure CN120843699B_ABST
Patent Text Reader

Abstract

The present application relates to the modern livestock breeding technical field, especially to a SNP molecular marker rs637601961 related to the 6-month weight of a goat and an application thereof.The SNP molecular marker is located at the 51bp of the nucleotide sequence shown in SEQ ID NO.01, and the polymorphism thereof is G / T.When the genotype of the polymorphism site contained in the molecular marker is GT or TT, the corresponding 6-month weight of the goat to be detected has a relative advantage.The molecular marker provided by the present application can be applied to the identification or prediction of the growth state of a goat, and can also be applied to the field of molecular breeding, the genetic potential of a goat is judged based on the analysis of the genotype of the goat, and the 6-month weight of the offspring of the goat can be improved by selecting the advantage allele genotype of the SNP molecular marker, and the genetic improvement of the breeding goat is further used, and the economic benefits of the mutton sheep breeding industry are effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of modern animal husbandry technology, and in particular to an SNP molecular marker rs637601961 related to the weight of goats at 6 months of age and its application. Background Technology

[0002] Growth traits are core target traits in goat breeding. Traditional breeding methods mainly rely on phenotypic selection and pedigree information, but these methods have limitations such as long breeding cycles and low selection efficiency. With the development of molecular biology techniques, marker-assisted selection (MAS) and genomic selection (GS) have become important tools in animal genetic breeding. Among them, single nucleotide polymorphisms (SNPs), as third-generation genetic markers, are widely used in the analysis of the genetic mechanisms of important traits and in breeding practices due to their abundant quantity, broad genomic coverage, and mature genotyping techniques.

[0003] In studies of SNPs related to growth traits in goats, several candidate genes and loci have been reported, providing potential targets for molecular breeding. However, due to genetic diversity, the effects of SNP loci in different goat breeds are not stable, limiting their universality and application value. Therefore, discovering more new SNP loci is of great significance for improving the efficiency of molecular breeding and accelerating genetic progress.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an SNP molecular marker rs637601961 related to the body weight of goats at 6 months of age and its application.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides an SNP molecular marker associated with the body weight of a 6-month-old goat, wherein the SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.01 and has a polymorphism of G / T.

[0008] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is GT or TT, corresponding to the relative weight advantage of the 6-month-old goat being tested.

[0009] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is GG, which corresponds to the relative disadvantage in body weight at 6 months of age of the goat being tested.

[0010] Secondly, the present invention provides substances for detecting the SNP molecular markers associated with the body weight of goats at 6 months of age, including PCR primers for amplifying genomic DNA fragments including the SNP molecular markers or kits containing the primers.

[0011] Thirdly, the present invention provides the application of the SNP molecular marker or the substance in at least one of the following:

[0012] (1) Application in determining the weight of goats at 6 months of age;

[0013] (2) Application in predicting the weight of goats at 6 months of age;

[0014] (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0015] Preferably, the goat breed is Dongbao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat, or Matou Goat.

[0016] More preferably, the breed of goat is Dongbao Blackhead Goat.

[0017] Fourthly, the present invention provides a method for detecting the weight of a 6-month-old goat, comprising: detecting whether the N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of the goat is G or T, and determining the weight of the goat at 6 months of age based on the detection result.

[0018] Preferably, the primers of the amplified sequence SEQ ID NO:1 are used to perform genotyping on the Dongbao Blackhead sheep materials to be tested. If the genotype is GT or TT, the relative weight advantage of the tested individual at 6 months of age is determined.

[0019] Fifthly, this invention provides a genetic breeding method to improve the growth performance of goats, which involves identifying SNP molecular markers in breeding goats within a core goat population. The SNP molecular markers are located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, with a polymorphism of G / T. Based on the goat SNP molecular markers, corresponding selections are made: in the successive breeding of breeding goats, individuals with the 51st base of the SNP marker being of the GT type and / or TT type are selected, while GG type individuals are eliminated, in order to progressively increase the frequency of the T gene at this locus, thereby improving the growth performance of offspring goats.

[0020] Beneficial effects:

[0021] This invention provides a SNP molecular marker rs637601961 associated with the 6-month-old body weight of goats and its application. The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and its polymorphism is G / T. When the genotype of the polymorphic site contained in the molecular marker is GT or TT, it corresponds to a relative advantage in the 6-month-old body weight of the goat being tested. The molecular marker provided by this invention can be applied to the identification or prediction of the growth status of goats, and can also be applied in the field of molecular breeding. Based on the analysis of the goat genotype, the genetic potential of goats can be determined. By optimizing the dominant allele of this SNP molecular marker, the 6-month-old body weight of goat offspring can be improved, which can then be used for the genetic improvement of breeding goats, effectively improving the economic benefits of meat goat farming. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0023] Figure 1 Manhattan plot of weight of 6-month-old goats. The arrow points to the molecular marker screened in this invention, which is located on the EPHA6 gene on goat chromosome 1. Detailed Implementation

[0024] The main objective of this invention is to screen out a molecular marker rs637601961 that is associated with the weight of goats at 6 months of age, and to provide the application of this molecular marker in the detection of the weight of goats at 6 months of age or in goat breeding.

[0025] First, this invention provides a goat SNP molecular marker, wherein the SNP molecular marker is rs637601961 located on the EPHA6 gene on goat chromosome 1, and the nucleotide sequence of the 50 bp upstream and downstream of this SNP site is shown below (SEQ ID NO: 1):

[0026] AGCGTCTGCCTGCAATGTGGGATACCCCAGTTCAGTCCCTGAGTT GGGAA(G / T)ATCCCCTAGAGAAGGAAATAGCAACCCACTCCAGTACTC TTGCCTGGAAA.

[0027] The N at position 51 of the above sequence represents a G51-T51 allelic mutation, which causes nucleotide polymorphism in the SEQ ID NO:1 sequence. This molecular marker can be used to detect factors associated with the body weight of goats at 6 months of age, and a T at position 51 of the sequence shown in SEQ ID NO:1 is favorable for goats to have a higher body weight at 6 months of age.

[0028] The molecular markers screened by this invention can be applied to genotypic analysis of genes related to goat growth traits or association analysis of goat growth traits, providing new molecular marker resources for marker-assisted selection of goat growth traits, especially body weight at 6 months of age.

[0029] The present invention further provides a reagent or kit comprising primers for detecting the above-mentioned SNP molecular markers. Those skilled in the art can design primers capable of amplifying the sequence shown in SEQ ID NO:1 according to primer design principles to detect the SNP marker genotypes associated with the body weight of goats at 6 months of age, thereby predicting the growth traits of goats.

[0030] The SNP molecular markers or reagents or kits described above in this invention can be applied to the detection of body weight of goats at 6 months of age or to goat breeding.

[0031] The present invention does not limit the breed of goat, and can be selected from goat breeds such as Dongbao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat and Matou Goat.

[0032] The present invention further provides a method for detecting the weight of a 6-month-old goat, and for detecting whether the N-labeled single nucleotide in the above-mentioned SEQ ID NO:1 sequence of the goat is T or G.

[0033] As a more preferred and specific implementation method, the present invention utilizes primers amplifying the sequence shown in SEQ ID NO:1 to perform genotyping on the goat material to be tested. According to the genotyping results, the TT type goats have a significantly higher body weight at 6 months of age than the GG type goats.

[0034] The present invention preferably uses the reagents or kits mentioned above for detection.

[0035] This invention also provides the application of the above-mentioned single nucleotide polymorphisms of goat SNP sites or substances (reagents or kits) for detecting single nucleotide polymorphisms of goat SNP sites in detecting or assisting in detecting the body weight of goats at 6 months of age or in goat breeding.

[0036] This invention also provides a method for screening the above-mentioned SNP molecular markers, comprising the following steps:

[0037] ① Extract goat genomic DNA and perform whole-genome low-depth and high-depth resequencing to obtain raw sequencing data;

[0038] ② Quality control of the raw sequencing data was performed, and the data was compared with the goat reference genome. The Sentieon+Beagle strategy was used to detect genetic variations and fill genotypes on all autosomes of the sample to obtain high-quality SNP locus data.

[0039] ③ Using the FarmCPU model with rMVP software, GWAS analysis was performed on SNP sites and the body weight of goats at 6 months of age to obtain the SNP molecular markers related to the body weight of goats at 6 months of age.

[0040] In step ①, the low depth is preferably 1-2×, and the high depth is preferably 15-20×. The present invention preferably uses a higher number of low depth sequencing results than high depth sequencing results to fill the genotypes of a larger number of low depth sequencing results with fewer high depth sequencing results, thereby reducing sequencing costs.

[0041] This invention also provides a genetic breeding method to improve the 6-month-old weight of goats. The method involves identifying the above-mentioned SNP molecular markers in the breeding goats in the core goat population and making corresponding selections based on the goat SNP molecular markers: in the successive breeding of breeding goats, individuals with the 51st base of the SNP marker being of the GT type and / or TT type are selected, while individuals of the GG type are eliminated, so as to increase the frequency of the T gene at this locus in each generation, thereby improving the 6-month-old weight performance of the offspring goats.

[0042] In the following embodiments, this invention resequencing the whole genome of 500 Dongbao Blackhead sheep, with 466 sheep having a low sequencing depth of 1× and 34 sheep having a high sequencing depth of 15×, aims to fill in the genotypes of the low sequencing results (which are more numerous) with the high-depth sequencing results (which are fewer), thereby reducing sequencing costs. Then, the resequencing data was aligned to the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy was used to detect genetic variations and fill in the genotypes of all autosomes in the 500 samples. SNP locus data were obtained to conduct a GWAS study related to the 6-month-old weight of the goats. Finally, an SNP (rs637601961) associated with the 6-month-old weight of the goats was screened. The SNP marker is located at nucleotide position 40,267,329 on chromosome 1 of the goat reference genome Capra hircus ARS1.2, and the base at this position is G or T. Referring to Ensembl, the nucleotide sequence of the 50 bp upstream and downstream of this SNP site was obtained. The nucleotide sequence of this fragment is shown in SEQ ID NO:1, where the T at position 51 represents the nucleotide of the allelic mutation. The specific nucleotide sequence is as follows:

[0043] AGCGTCTGCCTGCAATGTGGGATACCCCAGTTCAGTCCCTGAGTT GGGAA(G / T)ATCCCCTAGAGAAGGAAATAGCAACCCACTCCAGTACTC TTGCCTGGAAA.

[0044] The N at position 51 of the above sequence represents a G51-T51 allele mutation, which causes nucleotide polymorphism in the SEQ ID NO:1 sequence. GWAS analysis showed that rs637601961 was significantly associated with the body weight of goats at 6 months of age. Individuals with genotypes GT or TT had significantly higher body weights at 6 months of age than those with genotype GG, indicating that T is an allele that favors higher body weight at 6 months of age. This molecular marker can be used to detect the correlation between body weight at 6 months of age in goats. When the nucleotide at position 51 of the sequence shown in SEQ ID NO:1 is T, it is beneficial for goats to have a higher body weight at 6 months of age, which is of great significance for goat breeding.

[0045] This invention combines low-depth resequencing with genotype imputation and utilizes GWAS analysis to screen for significant SNP molecular markers affecting goat growth traits. These markers are then used in marker-assisted selection and genomic selection to select genotypes beneficial for improving goat growth traits for breeding. This progressively increases the gene frequency of dominant alleles, accelerating the breeding improvement process and bringing significant economic benefits to goat farming. This invention also verifies the effect of these SNP molecular markers on the 6-month-old body weight of goats, demonstrating their applicability in genetic improvement of breeding goats to increase 6-month-old body weight, thereby increasing the 6-month-old body weight of offspring and enhancing the market competitiveness of goat farming enterprises.

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0047] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0048] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0049] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0050] Example 1

[0051] This embodiment provides a whole-genome resequencing method, as detailed below:

[0052] 1. Blood sample collection and white blood cell separation.

[0053] A 5 mL blood sample was collected from the goat's jugular vein using a veterinary lancet and placed in an EDTA anticoagulant tube. The anticoagulant tube was then placed in an ice box filled with ice packs and brought back to the laboratory. These samples were stored at 4°C for leukocyte extraction, following the specific steps below:

[0054] (1) Take 2-3 mL of blood sample into a 10 mL EP tube.

[0055] (2) Add ultrapure water to EP to make the total liquid volume 9 mL.

[0056] (3) Slowly invert the EP tube up and down 20 times and let it stand for 10 minutes.

[0057] (4) Place the EP tube into a centrifuge and centrifuge at 5000 rpm for 10 min.

[0058] (5) Slowly pour out the supernatant from the EP tube.

[0059] (6) Add ultrapure water again to make the total liquid volume 9 mL.

[0060] (7) Repeat steps (3), (4), and (5).

[0061] (8) After the separated white blood cells are numbered, they are placed in a -80℃ freezer.

[0062] 2. Genomic DNA extraction and whole-genome resequencing.

[0063] DNA extraction from leukocytes was performed using the Tianmo Biotechnology Genomic DNA Mini-Extraction Kit (catalog number: d3024), following the instructions. The qualified genomic DNA was sent to Beijing Novogene Technology Co., Ltd. for secondary quality control and library construction, and then subjected to PE150 whole-genome resequencing on the BGI platform. Raw data was obtained in FASTQ format. High-depth whole-genome resequencing was performed on 34 samples, with an average sequencing depth of approximately 19.72X and a total data volume of 1.4T; low-depth whole-genome resequencing was performed on 466 samples, with an average sequencing depth of approximately 1.65X and a total data volume of 1.6T.

[0064] Example 2

[0065] This embodiment provides a method for genome alignment, genetic variation detection, and genotype imputation, as detailed below:

[0066] 1. Analysis of raw sequencing data and genome alignment.

[0067] High-depth sequencing data and low-depth sequencing data are subjected to the same quality control process.

[0068] (1) The raw data was filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value below 20 exceeding 30% were removed; reads with n bases greater than 5% were removed. After the above quality control steps, clean reads were obtained.

[0069] (2) Use BWA software to align cleanreads to the goat reference genome (Capra_hircus.ARS1.2).

[0070] (3) Use Samtools software to sort the compared BAM files.

[0071] (4) Use Picard to mark repeated reads.

[0072] (5) Use Samtools software to build indexes.

[0073] 2. Detection of variant sites and genotyping.

[0074] (1) GATKHaploytypeCaller generates gvcf files for each sample according to the autosomal number.

[0075] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0076] (3) GATKGenotypeGVCFs were used for population SNP calling based on chromosomes.

[0077] (4) GATKMergeVcfs merges the vcf files of autosomal populations.

[0078] (5) GATKSelectVariants filters SNPs in vcf files of a population.

[0079] (6) GATK Variant Filtration is used to mark false positive SNP sites.

[0080] (7) The grep command filters the marked SNP sites.

[0081] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0082] (9) Beagle software fills in the missing sites.

[0083] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and genotype population genomic genetic variations.

[0084] (11) Using Beagle for genotyping, 26,131,221 high-quality SNPs were obtained.

[0085] Example 3

[0086] This embodiment demonstrates the application of the rs637601961 molecular marker genotyping method in a weight association analysis of 6-month-old goats, as detailed below:

[0087] Association analysis between the rs637601961 molecular marker and the body weight of goats at 6 months of age.

[0088] (1) The phenotypes used for the association analysis between genotype and body weight at 6 months of age were measured by professional technicians in strict accordance with the measurement specifications. The measurement age was 360±15 days. The live weight of the sheep was measured after fasting for 12-16 hours (h) and fasting for 2 hours (kg). A total of 304 samples were collected.

[0089] (2) GWAS analysis of SNP loci and 6-month-old body weight was performed using the FarmCPU model with rMVP software.

[0090] The FarmCPU model uses both fixed-effects and random-effects models for iteration. The fixed-effects analysis model is as follows:

[0091] y = Xb + Z t ut +S i d i +e

[0092] In the formula, y is the observer vector of the trait; b is the individual fixed effects vector, including the first three principal components of the SNP, birth season, parity, and birth weight; u t The nucleotide genotype matrix of t pseudo-quantitative traits is used as a fixed effect; X and Z t They are b and u respectively t The correlation matrix; S i It is the i-th SNP marker, d i This represents the corresponding effect value; e is the random residual effect vector, which follows a normal distribution e ~ N(0, Iσ). e 2) .

[0093] GWAS analysis showed that rs637601961 was significantly associated with the body weight of goats at 6 months of age. The effects of different genotypes of this marker on the body weight of goats at 6 months of age are shown in Table 1.

[0094] Table 1. Effects of different rs637601961 genotypes on goat growth.

[0095]

[0096] Note: A significant marker is defined as a p-value of <0.05 / 26131221≈1.91E-09 (Bonferroni correction).

[0097] As shown in Table 1, for the 6-month-old weight trait of goats, individuals with genotypes GT or TT had significantly higher 6-month-old weights than individuals with genotype GG, indicating that T is an allele that is beneficial for increasing 6-month-old weight.

[0098] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of a substance detecting a SNP molecular marker associated with the 6-month weight of a goat in the identification or prediction of the 6-month weight of a goat, characterized in that, The SNP molecular marker is located at 51bp of the nucleotide sequence shown in SEQ ID NO.01, the polymorphism is G / T; the breed of the goat is Dongbao black head goat; the genotype of the polymorphism site contained in the SNP molecular marker is GT or TT, which corresponds to the relative advantage of the 6-month-old body weight of the goat to be detected; the genotype of the polymorphism site contained in the SNP molecular marker is GG, which corresponds to the relative disadvantage of the 6-month-old body weight of the goat to be detected.

2. Use according to claim 1, characterized in that, The substance is a PCR primer for amplifying the genomic DNA fragment containing the SNP molecular marker or a kit containing the primer.

3. A method for detecting the 6-month weight of Dongbao blackheaded sheep, characterized in that, It comprises: detecting whether the single nucleotide marked by N in the sequence shown in SEQ ID NO:1 is G or T, judging the 6-month-old body weight of the goat based on the detection result; if the genotype is GT or TT, judging that the 6-month-old body weight of the individual to be detected is relatively superior.

4. A genetic breeding method for improving the growth performance of Dongbao blackheaded sheep, characterized in that, Determining whether the single nucleotide marked by N in the sequence shown in SEQ ID NO:1 is G or T in the core group of the goat: selecting the individuals of GT type and / or TT type for the subsequent breeding of the breeding goat, eliminating the individuals of GG type, so as to increase the frequency of gene T at this site generation by generation, thereby increasing the 6-month-old body weight of the offspring goat.