Detection nucleotide sequence of photobacterium damsela subspecies and application of detection nucleotide sequence

Abstract

The invention belongs to the technical field of microbiological detection, and particularly relates to a detection nucleotide sequence of photobacterium damsela subspecies and application of the detection nucleotide sequence. Aiming at the ureC gene of the photobacterium damsela subspecies, the invention designs a nucleotide sequence for fluorescent quantitative PCR detection, the detection sensitivity to a target gene in detection application is 7.10 copies / reaction, and the nucleotide sequence has the advantages of specificity, rapidness and stable result.

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to the detection of the nucleotide sequence of *Bacillus mermaidus* subsp. *mermaidus* and its application. Background Technology

[0002] Mermaid bioluminescent bacteria, mermaid subspecies ( Photobacterium damselae subsp. damselae It is one of the important pathogenic bacteria in marine aquaculture, and can infect fish including the leopard gill spiny perch (Scophagus leopardus). Plectropomus leopardus Pearl Giant Grouper ( Epinephelus fuscoguttatus♀ × E.lanceolatus♂ ), Golden Tiger Hybrid Spot ( E. fuscoguttatus ♀× E. tukula ♂), Large Yellow Croaker ( Larimichthys crocea ), Xu's flatfish ( Sebastes schlegeli ) and Yellow-striped Yellowtail ( Seriola lalandi Infectable crustaceans include Litopenaeus vannamei (Penaeus vannamei), etc. Penaeus vannamei ), tiger prawn ( P. monodon ) and the burrowing blue crab ( Scylla paramamosain It can also infect echinoderms such as *Stichopus japonicus* (e.g., sea cucumbers Apostichopus japonicus In addition, this pathogen is also pathogenic to humans, causing symptoms such as wound infection. In severe cases, it can lead to sepsis or necrotizing fasciitis, which can be life-threatening.

[0003] Current molecular detection methods for *Cyclophorus melanogaster* subspecies include PCR, PCR-denaturing gradient gel electrophoresis (DGGE), random amplified polymorphic DNA (RAPD), microfluidic quantitative PCR, and recombinase polymerase amplification (RPA). However, these methods suffer from drawbacks such as long detection times, complex procedures, and low specificity or sensitivity. Given the harm this pathogen poses to marine aquaculture and the requirements for sensitive, specific, rapid, and quantitative analysis of pathogens in aquatic product safety testing, there is an urgent need to develop more effective detection products and methods. Summary of the Invention

[0004] The purpose of this invention is to provide the detection nucleotide sequence of *Bacillus melanoxylon* subspecies *Melanoxylon* and its application. Based on the sequencing and analysis results of this strain from different sources collected in the epidemiological survey from 2015 to 2021, this invention determined the conserved nucleotide sequence of the ureC gene of this bacterium. Based on this, primers and probes for real-time PCR detection based on the Taqman-MGB probe were designed. This novel probe can provide more specific and sensitive detection results in real-time PCR than the Taqman probe.

[0005] The nucleotide sequence for detecting *Bacillus mermaidus* subspecies *Mermaidus* described in this invention includes primer 1, primer 2, and a probe, and its nucleotide sequence is as follows: 1) Primer 1 ( Phdd _F): 5'-TGGAGGAATCGATACTCACATTCA-3', as shown in SEQ ID NO: 1; 2) Primer 2 ( Phdd_ R): 5'-GTTGTTAAGCCAGAACATAATCCTTCT-3', as shown in SEQ ID NO: 2; 3) Probe ( Phdd_ Probe): 5'-TGTCCTCAACAAGCCG-3', as shown in SEQ ID NO: 3.

[0006] The detection nucleotide sequence was designed from the 75bp conserved nucleotide sequence of the ureC gene of *Bacillus mermaidus* subspecies *Mermaid*. TGGAGGAATCGATACTCACATTCATTTTATCTGTCCTCAACAAGCCGAAGAAGGATTATGTTCTGGCTTAACAAC, as shown in SEQ ID NO: 4.

[0007] The aforementioned nucleotide sequence for detecting *Proteobacterium melanogaster* subsp. *mermaidum* is used for the detection of *Proteobacterium melanogaster* subsp. *mermaidum* for non-disease diagnosis and treatment purposes, including for the preparation of detection reagents or kits.

[0008] The detection method is quantitative real-time PCR. During detection, primers and probes can be used simultaneously or only primers can be used.

[0009] When using a probe, the 5' end and 3' end of the probe are labeled with a fluorescent reporter group and a fluorescent quencher group, respectively. Preferably, the probe is a Taqman-MGB probe, with the 5' end modified with 6-carboxyfluorescein (6-FAM) and the 3' end modified with MGB (Minor groove binder)-NFQ (Nonfluorescent quencher). When using primers only and no probe is used, nucleic acid dyes need to be added to the detection system, preferably various chimeric nucleic acid fluorescent dyes.

[0010] In the detection system, the final concentrations of primers and probes are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively, preferably 0.2 μmol / L and 0.2 μmol / L.

[0011] The testing procedure is as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s; 58-63℃ (preferably 60-61℃) for 30-34s, 40 cycles.

[0012] Analysis of detection results: When using a probe, positive samples show an amplification curve; when not using a probe, positive samples show an amplification curve with a single peak in their melting curve. In pathogen quantification analysis, the pathogen load in the sample can be calculated based on the linear relationship between the logarithm (x) of the target gene copy number of the constructed recombinant plasmid standard nucleic acid and its corresponding threshold cycle number Ct (y), and the Ct value of the detected sample. In the quantitative real-time PCR detection based on the Taqman-MGB probe of this invention, the linear relationship is y = -3.317x + 40.804. Compared with the prior art, the present invention has the following beneficial effects: 1. Detection Specificity: Based on sequencing analysis of strains from different sources, this invention has determined the conserved nucleotide sequence of the ureC gene in *Proteobacterium melanogaster* subsp. *mercantileveria* and designed the detection nucleotide sequence described in this invention, including two primers and one probe. The nucleotide sequence of the probe is completely consistent with the ureC gene of 37 currently disclosed strains and 17 strains of *Proteobacterium melanogaster* subsp. *mercantileveria* collected from different sources in the epidemiological survey of this invention, providing specific detection results. According to this invention, new infection hosts of *Proteobacterium melanogaster* subsp. *mercantileveria* can be discovered and the pathogen can be quantitatively analyzed.

[0013] 2. High detection sensitivity: The detection sensitivity of this invention is 7.10 copies / reaction, providing reliable early diagnosis and warning for pathogen monitoring.

[0014] 3. The invention provides rapid detection: The invention can complete detection and quantitative analysis of pathogens within 1 hour. Attached Figure Description

[0015] Figure 1 A diagram showing the 75bp nucleotide sequence alignment of the ureC gene from 54 *Bacillus mermaidus* subspecies *Mermaidus*, and the nucleotide sequence locations of primers and probes for quantitative real-time PCR detection. Figure 2 The image shows the amplification curve of real-time PCR using the plasmid standard of *Bacillus melanoxylon* subspecies as a template. Figure 3 Standard curve for quantitative real-time PCR of *Bacillus mermaidus* subsp. *mermaid*; Figure 4 Amplification curves for evaluating the sensitivity of real-time PCR detection using *Bacillus mermaidus* subsp. *mermaidensis* nucleic acid as a template; Figure 5 Gel electrophoresis image for assessing the sensitivity of routine PCR detection using *Bacillus mermaidus* subsp. *mermaidus* nucleic acid as a template; Figure 6 Amplification curves for the specific detection of *Bacillus mermaidus* subsp. *mermaidus* by real-time quantitative PCR. Detailed Implementation

[0016] To further illustrate the method and effects of the present invention, the following embodiments are provided for further explanation. Unless otherwise specified, all pharmaceuticals and materials used in the following embodiments are commercially available.

[0017] Example 1: Nucleotide sequence design for detecting *Bacillus mermaidus* subspecies *Mermaid* Strain source: From 2015 to 2022, the inventors conducted an epidemiological survey and isolated 17 strains of *Bacillus mermaidus* subspecies *Mermaidus* from different marine aquaculture organisms, including large yellow croaker and spotted sea bream. Oplegnathus punctatus ) and Litopenaeus vannamei, Litopenaeus vannamei ( Fenneropenaeus chinensis ) and three-spotted swimming crab ( Portunus trituberculatus (See Table 1 for details on the specific sources.)

[0018] Table 1. Origin of *Bacillus mermaidus* subspecies from *Mermaid*

[0019] PCR amplification and sequencing: Sequencing primers ureC_F (5'-TCCAGCCTAATGTTGATA-3', as shown in SEQ ID NO: 5) and ureC_R (5'-ATCTGCCACATTCATACA-3', as shown in SEQ ID NO: 6) were designed for the ureC gene of *Bacillus melanogaster* subspecies *Melanogaster*. The PCR product size was 401 bp. The 25 μL PCR system consisted of: 12.5 μL of 2×Premix Ex Taq Mix (TaKaRa, Dalian), 0.5 μL each of 10 μmol / L ureC_F and ureCR, 1 μL of bacterial genomic DNA, and 10.5 μL of sterile water. The PCR amplification program was: 95℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for a total of 35 cycles; extension at 72℃ for 8 min. Seventeen bacterial strains were collected and subjected to PCR amplification and nucleotide sequencing of their products (401 bp). The ureC gene nucleotide sequences of 17 strains of *Bacillus melanogaster* subspecies were obtained.

[0020] Nucleotide sequence design for detection: The ureC gene nucleotide sequences obtained from sequencing were compared and analyzed using the BLAST (Basic Local Alignment Search Tool) tool in NCBI (National Center for Biotechnology Information) to obtain 37 currently published ureC gene sequences of *Bacillus mermaidina* subspecies. Then, the aforementioned 54 ureC gene nucleotide sequences (17 obtained from sequencing + 37 currently published) were compared and analyzed to determine the conserved nucleotide sequences in the ureC gene. The detection nucleotide sequence for the quantitative real-time PCR of this invention was designed from a selected 75bp conserved nucleotide sequence. Figure 1 ), Figure 1 In the diagram, yellow represents A, red represents T, blue represents C, and green represents G. The corresponding sequences of 17 collected strains are also being published for the first time. The conserved nucleotide sequences of these 75 bp strains are as follows: TGGAGGAATCGATACTCACATTCATTTTATCTGTCCTCAACAAGCCGAAGAAGGATTATGTTCTGGCTTAACAAC.

[0021] The designed nucleotide sequence for detecting *Bacillus mermaidus* subspecies *Mermaidus*, including primer 1, primer 2, and probe, is as follows: 1) Primer 1 ( Phdd _F):5'-TGGAGGAATCGATACTCACATTCA-3', 2) Primer 2 ( Phdd_ R): 5'-GTTGTTAAGCCAGAACATAATCCTTCT-3', 3) Probe ( Phdd_ Probe): 5'-TGTCCTCAACAAGCCG-3'.

[0022] The specificity of primers and probes was confirmed by analysis using NCBI's Primer-BLAST tool. The nucleotide sequence of the probe, which plays a key role in the probe-based quantitative PCR, is completely consistent with the nucleotide sequence of the ureC gene specific to the above 54 *Bacillus mermaidus* subspecies *Mermaid*. Figure 1 The specificity of the nucleotide sequence detected by the quantitative real-time PCR of this invention has been further confirmed in the detection of different pathogens (see Example 5). Based on the detection specificity of this invention, it can be used to discover new hosts of *Proteobacterium melanogaster* subspecies, including fish and crustaceans. In practical applications, we have already discovered the detection of previously unreported hosts infected by *Proteobacterium melanogaster* subspecies.

[0023] Example 2: pMD18_ Phdd Construction of _U The 401bp PCR product obtained in Example 1 was purified by gel extraction, ligated into the pMD18-T vector (TaKaRa, Dalian), and then transformed into Escherichia coli (E. coli). Escherichia coli The recombinant plasmid standard pMD18 was extracted from DH5α competent cells (TaKaRa, Dalian). Phdd The concentration of _U was determined using a nucleic acid concentration analyzer (NanoDrop 2000c Spectrophotometer, Thermo Scientific, USA), the copy number of the target gene was calculated, and then serially diluted 10-fold using EASY Dilution (for Real Time PCR) (TaKaRa, Dalian) to obtain 7.10 × 10⁻⁶ nucleotides. 0 -7.10×10 9 Plasmid standards in copies / μL should be stored at -20℃ for later use.

[0024] Example 3: Optimization of detection primer and probe concentrations Quantitative detection was performed using the Pro Tag HS premixed probe qPCR kit (Hunan Aike Rui Biotechnology Co., Ltd.). The assay was conducted in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, USA). Primer and probe concentrations were optimized; the reaction mixture consisted of 20 μL of 2× [reagent name missing]. Pro Taq The HS ProbePremix was used to optimize the final primer concentrations to 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 μmol / L, and the final probe concentrations to 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L. 1 μL of DNA template was added, followed by ddH2O to a final volume of 20 μL. The optimized annealing temperatures were 58, 59, 60, 61, 62, and 63 °C. The initial amplification program was 95 °C pre-denaturation for 30 s; 95 °C denaturation for 5 s; and annealing at 60 °C for 30 s, for 40 cycles. Based on the analysis of quantitative detection Ct values, fluorescence intensity increase (ΔRn), and reagent costs, the suitable final primer and probe concentrations for this method were determined to be 0.2 μmol / L, and the reaction temperature to be 61 °C. The optimized detection settings of this invention are 95 ℃ for 30 s; 95 ℃ for 5 s, 61 ℃ for 30 s, for a total of 40 cycles, which are used in subsequent embodiments.

[0025] Example 4: Standard curve, detection sensitivity and repeatability evaluation of the real-time PCR method (1) Standard curve and detection sensitivity 7.10 × 10⁻⁶ was obtained by a 10-fold serial dilution. 0 -7.10×10 9 copies / μL of pMD- Phdd Using _U as a template, quantitative real-time PCR was performed, and the amplification curve is shown below. Figure 2 Wherein, 1-10: correspond to template concentrations of 7.10×10⁻⁶. 9 7.10×10 8 7.10×10 7 7.10×10 6 7.10×10 5 7.10×10 4 7.10×10 3 7.10×10 2 7.10×10 1 and 7.10×10 0 copies / μL of pMD- Phdd _U, 11: negative control, 12: blank control; the results showed that its detection sensitivity was 7.10 copies / reaction in 40 detection cycles. For pMD- Phdd Correlation analysis was performed on the logarithm of the target gene copy number (x) in _U and its corresponding threshold cycle number Ct (y), yielding a standard curve: y = -3.317x + 40.804, R0 2 =0.999, E=100.206% Figure 3 ).

[0026] (2) Detection sensitivity of quantitative real-time PCR and conventional PCR Nucleic acid was extracted from the *Bacillus melanogaster* subspecies *Melanogaster* strain using a bacterial genomic DNA extraction kit (Tiangen, Beijing). The samples were then diluted 10-fold to obtain nucleic acid samples with concentrations of 120.3 ng / μL, 12.03 ng / μL, 1.203 ng / μL, 120.3 pg / μL, 12.03 pg / μL, 1.203 pg / μL, and 120.3 fg / μL. These samples were used as templates to compare the detection sensitivity of the present invention's quantitative real-time PCR with conventional PCR. Conventional PCR was performed using primers reported by Osorio et al. (Osorio CR, Toranzo AE, Romalde JL, Barja JL. Multiplex PCR assay for ureC and 16S rRNA genes clearly distinguishes between both subspecies of Photobacterium damselae. Dis AquatOrgan. 2000.40(3):177-83.), namely Ure-5': TCCGGAATAGGTAAAGCGGG (as shown in SEQ ID NO: 7) and Ure-3': CTTGAATATCCATCTCATCTGC (as shown in SEQ ID NO: 8). Detection was performed using PCR reagents from 2×Accurate Taq premix (containing dye) (Hunan Aike Rui Biotechnology Co., Ltd.). The PCR reaction program was: 95℃ for 5 min; [94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s] × 35; 72℃ for 8 min. The comparison of detection results shows that the detection sensitivity of the present invention's quantitative real-time PCR is 100 times higher than that of conventional PCR. The detection sensitivities of the two methods for the template used are 120.3 fg / μL, respectively. Figure 4 ) and 12.03 pg / μL ( Figure 5 ). Figure 4 and Figure 5 In the table, 1-7: bacterial DNA with template concentrations of 120.3 ng / μL, 12.03 ng / μL, 1.203 ng / μL, 120.3 pg / μL, 12.03 pg / μL, 1.203 pg / μL and 120.3 fg / μL, respectively; 8: negative control; 9: blank control.

[0027] (3) Repeatability assessment With 7.10×10 0-7.10×10 9 copies / μL of pMD- Phdd Using the _U plasmid standard as a template, three replicates were set for each gradient for intra-batch and inter-batch detection, and the mean Ct, standard deviation, and coefficient of variation were calculated. The results showed that the TaqMan-MGB probe-based quantitative PCR detection method of this invention has good repeatability, with intra-batch and inter-batch coefficients of variation ranging from 0.13% to 1.78% and 0.48% to 1.46%, respectively (Table 2).

[0028] Table 2 Repeatability of Real-Time PCR Detection

[0029] Example 5: Detection of Specificity by Real-Time PCR Using nucleic acids from different pathogens (Table 3) as templates, nucleic acid from *Bacillus merantii* subspecies *Melilotus merantii* 20221229001-2 was used as a positive control, nucleic acid from healthy large yellow croaker tissue was used as a negative control, and ddH2O was used as a blank control. TaqMan-MGB probe-based quantitative PCR was performed for specificity analysis, with the detection repeated three times. The results are as follows: Figure 6 The pathogen nucleic acid templates corresponding to the amplification curves in the figure are shown in Table 3, 18: negative control, 19: blank control. The results of three tests show that this method can specifically detect *Bacillus medusa* subspecies *Medusa medusa*, and there is no cross-reaction with 10 other common pathogens in fish and crustaceans.

[0030] Table 3. Pathogens used for specific detection by quantitative real-time PCR

[0031] Example 6: Detection of Clinical Samples by Quantitative Real-Time PCR The nucleic acid of *Bacillus melanogaster* subspecies *Bacillus melanogaster* was detected in 36 large yellow croaker tissue samples collected from the Ningde sea area of ​​Fujian Province using both the TaqMan-MGB probe-based quantitative PCR method of this invention and the conventional PCR method reported by Osorio et al. (2000). Tissue nucleic acid extraction was performed using a marine animal tissue genomic DNA rapid extraction kit (Tiangen, Beijing). The results (Table 4) show that the quantitative PCR method of this invention provides more sensitive and quantitative analysis results than the conventional PCR method. The positive detection rates of the two methods were 38.89% and 19.44%, respectively, and the pathogen load in the tissues ranged from 4.02 × 10⁻⁶. 1 copies / mg - 1.41×10 3 copies / mg. Furthermore, using the detection method of this invention, we also detected *Bacillus mermaidus* subsp. *mermaid* in the tissue nucleic acid of *Gynostemma pentaphyllum*.

[0032] Table 4 Comparison of Clinical Sample Detection by Quantitative Real-Time PCR and Conventional PCR

Claims

1. A nucleotide sequence for detecting *Bacillus mermaidus* subspecies *Mermaidus*, characterized in that: The components include primer 1, primer 2, and probe, and their nucleotide sequences are as follows: 1) Primer 1: 5'-TGGAGGAATCGATACTCACATTCA-3', 2) Primer 2: 5'-GTTGTTAAGCCAGAACATAATCCTTCT-3', 3) Probe: 5'-TGTCCTCAACAAGCCG-3'.

2. The detection nucleotide sequence of *Bacillus mermaidus* subspecies *Mermaid* as described in claim 1, characterized in that: The detection nucleotide sequence was designed from the 75bp conserved nucleotide sequence of the ureC gene of *Bacillus mermaidus* subspecies *Mermaid*: TGGAGGAATCGATACTCACATTCATTTTATCTGTCCTCAACAAGCCGAAGAAGGATTATGTTCTGGCTTAACAAC.

3. The application of the detection nucleotide sequence of *Proteobacterium melanogaster* subsp. *mermaidum* as described in claim 1 in the detection of *Proteobacterium melanogaster* subsp. *mermaidum* for non-disease diagnosis and treatment purposes.

4. The application as described in claim 3, characterized in that: The detection method is quantitative real-time PCR. During detection, primers and probes can be used simultaneously or only primers can be used.

5. The application as described in claim 4, characterized in that: The probe is a Taqman-MGB probe, with the 5' end modified with a fluorescent reporter group 6-FAM and the 3' end modified with a fluorescent quencher group MGB-NFQ.

6. The application as described in claim 4, characterized in that: When using only primers, nucleic acid dyes are added to the detection system.

7. The application as described in claim 3, characterized in that: This includes products used to prepare diagnostic reagents or kits.

Images