KASP molecular marker related to oil content of gossypium barbadense and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to gossypium barbadense oil content and application, and relates to the technical field of molecular breeding, the key points of the technical scheme are that the molecular marker is at least one of the following: A / G mutation at the 51156847 base on a D07 chromosome; and / or C / T mutation at a 51250107 basic group on the chromosome D07; and / or G / C mutation at a 51248778 basic group on the D07 chromosome.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, and more specifically, to a KASP molecular marker related to the oil content of sea island cotton and its application. Background Technology

[0002] Cottonseed oil content is a complex quantitative trait, and its genetic patterns show diversity across different studies. The critical period for cottonseed oil synthesis is 20 to 40 days after flowering. During this stage, fatty acid synthesis and triglyceride assembly pathways in cottonseed are highly active, leading to a rapid increase in oil content, especially around 30 days after flowering, when oil synthesis reaches its peak and related enzyme activities also reach their highest levels. Regarding oil content, different cottonseed varieties exhibit significant variability; the average oil content of upland cotton is 30.42%, while that of island cotton averages 37.25%.

[0003] Cottonseed oil is of excellent quality and has become one of the important edible oils. Its oleic acid and linoleic acid, as unsaturated fatty acids, have significant benefits for human cardiovascular health. At the same time, cottonseed oil can also be processed into biofuels, becoming an important source of bioenergy. To meet the needs of multiple applications, increasing the oil content of cottonseed has become one of the important goals of current island cotton breeding.

[0004] Molecular markers are genetic markers based on the polymorphism of biological macromolecules. Variations in the nucleotide sequence of the genetic material between individuals can directly reveal genetic polymorphism at the DNA level. Meanwhile, marker-assisted selection based on quantitative trait loci (QTLs) has become a traditional tool in marker-assisted selection, used in crop breeding programs to accelerate and improve selection efficiency. Good molecular markers can help shorten breeding cycles; secondly, molecular markers can be detected throughout the plant's lifespan and are unaffected by external environmental factors. They can not only effectively detect locus genes for target traits and accurately analyze the genetic composition of individual plants in a population, but also help shorten the time required to construct linkage genetic maps for new populations. This is beneficial for targeted selection and the utilization of superior materials, thereby achieving the aggregation of superior agronomic traits in the same material. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the first objective of this invention is to provide a KASP molecular marker related to the oil content of sea island cotton, wherein the molecular marker is at least one of the following:

[0006] An A / G mutation at base 51156847 on chromosome D07;

[0007] And / or a C / T mutation at 51250107 bases on chromosome D07;

[0008] And / or a G / C mutation at base 51248778 on chromosome D07.

[0009] This invention provides a KASP primer for identifying the oil content of sea island cotton, wherein the primer comprises any one of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.12.

[0010] The present invention also provides a test kit for identifying the oil content of sea island cotton, the kit comprising any one of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.12.

[0011] Furthermore, the application of the aforementioned KASP primers or detection kits in identifying the oil content of island cotton involves using one or more of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.12 as primers to amplify the DNA of the sample to be tested. If the base at position 51156847 is G, it is a high-oil-content strain; if the base at this position is A, it is a low-oil-content strain. If the base at position 51250107 is T, it is a high-oil-content strain; if the base at this position is C, it is a low-oil-content strain. Similarly, if the base at position 51248778 is C, it is a high-oil-content strain; if the base at this position is G, it is a low-oil-content strain.

[0012] Furthermore, the application of the above-mentioned KASP primers or detection kits includes any one or more of the following applications:

[0013] To determine the oil content of cottonseed from island cotton;

[0014] Assisting in the breeding of island cotton.

[0015] This invention also provides a method for identifying the oil content of sea island cotton, comprising the following steps;

[0016] Extract DNA from the sample to be tested;

[0017] The extracted DNA was amplified using any of the above KASP primer sets;

[0018] The amplification results are analyzed and the genotype is identified to determine the oil content of the sample to be tested.

[0019] In summary, the present invention has the following beneficial effects:

[0020] The molecular markers and KASP primer sets provided by this invention are closely related to the oil content of cottonseed in sea island cotton and are closely associated with oil content traits. The above molecular markers or KASP primer sets can be used to quickly screen and identify samples carrying high oil content functional genes in breeding populations, shorten the breeding population size and time, significantly reduce breeding costs, and improve breeding efficiency. Attached Figure Description

[0021] Figure 1 This is a genome mapping of the QTLs for cottonseed oil content according to the present invention;

[0022] Figure 2 This is a haplotype analysis diagram of cotton seed trait association SNPs on the A07 chromosome of the present invention, wherein: a: Manhattan plot of oil content of 5 environmental BLUPs in Awat in 2022 and 2023; b: SNPs associated with the D07 chromosome; c: LD analysis of the D07 chromosome; d: haplotypes within the interval; ej: 5 environmental BLUP haplotypes in Awat in 2022, 2023, 2023, Yuepuhu, 2024, and Yuepuhu.

[0023] Figure 3 This is a significance analysis diagram of the three SNP loci of the present invention and the oil content of the RIL population of sea island cotton. Among them, a, b, and c are the phenotypic analyses of the Gbar_D07G021800-1176 SNP genotype, Gbar_D07G021850-1731 SNP genotype, and Gbar_D07G021850-402 SNP in 2023, respectively; d, e, and f are the phenotypic analyses of the Gbar_D07G021800-1176 SNP genotype, Gbar_D07G021850-1731 SNP genotype, and Gbar_D07G021850-402 SNP in 2024, respectively.

[0024] Figure 4 This is a significance analysis diagram of the three SNP loci invented and the oil content traits of 100 sea island cotton natural resource materials. Among them, a, b, and c are the phenotypic analyses of the Gbar_D07G021800-1176 SNP genotype, Gbar_D07G021850-1731 SNP genotype, and Gbar_D07G021850-402 SNP in 2022, respectively. d, e, and f are the phenotypic analyses of the Gbar_D07G021800-1176 SNP genotype, Gbar_D07G021850-1731 SNP genotype, and Gbar_D07G021850-402 SNP in 2023, respectively. Detailed Implementation

[0025] The present invention will be further described in detail below with reference to the embodiments.

[0026] All materials described in the embodiments of this invention are commercially available.

[0027] This invention uses the superior sea island cotton variety Xin Hai 21 as the female parent and the high-yielding, high-lint percentage Pima cotton variety 06E2062 from the United States as the male parent to construct 120 recombinant inbred lines (RILs). The F1 generation of this population was obtained through hybridization in 2012, and after continuous self-pollination in southern China, the F12 generation will be reached in 2024. All sea island cotton germplasm resources used in this invention were collected, preserved, and provided by the Key Laboratory of Crop Genetic Improvement and Germplasm Innovation, College of Agriculture, Xinjiang Agricultural University.

[0028] Example 1

[0029] Genetic maps were constructed using Joinmap 4.0 software. Using the R language qtl package, 93 QTLs related to cottonseed oil content in sea island cotton were detected in five environments. These QTLs were distributed on chromosomes A04, A05, A07, A08, D02, D06, D07, and D08. This invention also identified 21 QTLs that were detected simultaneously in two or more environments (Table 2). Figure 1 This explains 5.49%–17.89% of the phenotypic variation.

[0030] GWAS analysis identified 60 quantitative genetic loci associated with cottonseed oil content in sea island cotton on chromosome D07. These loci are located between 41.0 and 51.4 Mb on chromosome D07. Figure 2 ), where the 51.05-51.3Mb marked interval R 2 The mean value was greater than 0.8 (P<0.001), indicating strong linkage disequilibrium. KASP typing was performed on the SNP variant sites within the above intervals, and this invention screened three markers significantly associated with the cottonseed oil content trait of sea island cotton: Gbar_D07G021800-1176SNP (KASP1), Gbar_D07G021850-1731SNP (KASP2), and Gbar_D07G021850-402SNP (KASP3). The Gbar_D07G021800-1176SNP (KASP1) is located at position 51156847 on chromosome D07, with a genotype of A / G; the Gbar_D07G021850-1731SNP (KASP2) is located at position 51250107 on chromosome D07, with a genotype of T / C; and the Gbar_D07G021850-402SNP (KASP3) is located at position 51248778 on chromosome D07, with a genotype of G / C.

[0031] Based on the obtained SNP variant sites, PCR amplification primers were designed, and the above molecular markers and their KASP detection primers were developed. The nucleotide sequence of the Gbar_D07G021800-1176SNP (KASP1) molecular marker is shown in SEQ ID NO.1, the nucleotide sequence of the Gbar_D07G021850-1731SNP (KASP2) molecular marker is shown in SEQ ID NO.2, and the nucleotide sequence of the Gbar_D07G021850-402SNP (KASP3) molecular marker is shown in SEQ ID NO.3. For each marker, two upstream genotyping primers and one universal downstream primer were designed, as follows:

[0032] KASP1-F1: GAAGGTGACCAAGTTCATGCTGTTTATCAACCACCTCACAAAATA, SEQ ID NO. 4; KASP1-F2: GAAGGTCGGAGTCAACGGATTTTTATCAACCACCTCACAAAATG, SEQ ID NO. 5; KASP1-R: GGTGAAGATCCATTAAGGAAAGA, SEQ ID NO. 6.

[0033] KASP2-F1: GAAGGTGACCAAGTTCATGCTAAGGTTTCGAGGAGCAGATACT, SEQ ID NO.7; KASP2-F2: GAAGGTCGGAGTCAACGGATTAGGTTTCGAGGAGCAGATACC, SEQ ID NO.8; KASP2-R: CCTTAAGCAATCTCTTTGAAACC, SEQ ID NO.9.

[0034] KASP3-F1: GAAGGTGACCAAGTTCATGCTGATGCGGTCTGTTTTCTTCTAG, SEQ ID NO. 10; KASP3-F2: GAAGGTCGGAGTCAACGGATTGATGCGGTCTGTTTTCTTCTAC, SEQ ID NO. 11; KASP3-R: GTTGACAATGATGAAGCCTACCT, SEQ ID NO. 12.

[0035] The KASP reaction system is as follows:

[0036]

[0037]

[0038] The KASP reaction procedure is as follows:

[0039]

[0040] Example 2

[0041] Differential analyses were performed on the three markers Gbar_D07G021800-1176 SNP (KASP1), Gbar_D07G021850-1731 SNP (KASP2), and Gbar_D07G021850-402 SNP (KASP3) in the Awati environment in 2023 and 2024, targeting sea island cotton RIL populations. Figure 3 ), and a differential analysis was conducted on 100 sea island cotton resource populations in the Awati environment in 2022 and 2023. Figure 4 The correlation between the above KASP markers and oil properties was verified.

[0042] The results showed that the three KASP marker sites were successfully genotyped and had a significant effect on oil content screening of sea island cotton. A G-base marker at Gbar_D07G021800-1176 (KASP1) indicates a high-oil-content line, while an A-base marker indicates a low-oil-content line. A T-base marker at Gbar_D07G021850-1731 (KASP2) indicates a high-oil-content line, while a C-base marker indicates a low-oil-content line. A C-base marker at Gbar_D07G021850-402 (KASP3) indicates a high-oil-content line, while a G-base marker indicates a low-oil-content line.

[0043] Example 3

[0044] A method is provided for screening lines of sea island cotton with high cottonseed oil content, including:

[0045] Extract DNA from the sample to be tested;

[0046] The extracted DNA was amplified using any of the above KASP primer sets;

[0047] The amplification results are analyzed and the genotype is identified to determine the oil content of the sample to be tested.

[0048] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A KASP molecular marker associated with the oil content of sea island cotton, characterized in that, The molecular marker is at least one of the following: An A / G mutation at base 51156847 on chromosome D07; And / or a C / T mutation at 51250107 bases on chromosome D07; And / or a G / C mutation at base 51248778 on chromosome D07.

2. A KASP primer for identifying the oil content of sea island cotton, characterized in that, The primers are any one or more of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.

12.

3. A test kit for identifying the oil content characteristics of sea island cotton, characterized in that, The kit comprises any one of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.

12.

4. The application of the KASP primer according to claim 2 or the detection kit according to claim 3 in the identification of oil content in sea island cotton, characterized in that, Using one or more of the sequences shown in SEQ ID NO.4-SEQ ID NO.6, SEQ ID NO.7-SEQ ID NO.9, and SEQ ID NO.10-SEQ ID NO.12 as primers, the DNA of the sample to be tested is amplified. If the base at position 51156847 is G, it is a high-oil-content strain; if the base at this position is A, it is a low-oil-content strain. If the base at position 51250107 is T, it is a high-oil-content strain; if the base at this position is C, it is a low-oil-content strain. If the base at position 51248778 is C, it is a high-oil-content strain; if the base at this position is G, it is a low-oil-content strain.

5. The application of the KASP primer according to claim 2 or the detection kit according to claim 3, characterized in that, Including any one or more of the following applications: To determine the oil content of cottonseed from island cotton; Assisting in the breeding of island cotton.

6. A method for determining the oil content of sea island cotton, characterized in that, Includes the following steps; Extract DNA from the sample to be tested; The extracted DNA was amplified using any of the above KASP primer sets; The amplification results are analyzed and the genotype is identified to determine the oil content of the sample to be tested.

Images