Peanut pod cracking force site, molecular marker method and application
By locating the peanut pod-splitting force site qPD.B04 and developing corresponding molecular markers, the problem of high kernel breakage rate during mechanized peanut shelling was solved, achieving efficient and accurate breeding screening and improving the economic benefits and seed quality of the peanut industry.
Patent Information
- Application Number
- CN202511279887.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2025-10-28
AI Technical Summary
Mechanized peanut shelling results in a high rate of kernel breakage, which affects commercial value and seed germination rate. Furthermore, existing technologies lack effective genetic improvement methods to improve the peanut pod-cracking trait.
By locating the peanut pod-splitting force site qPD.B04 and developing KASP molecular markers B04-139316601F and B04-139316601R based on A/G single nucleotide polymorphisms, genotyping was performed using a BIO-RAD CFX96 real-time PCR instrument to screen suitable peanut lines.
This technology enables efficient and accurate identification of peanut pod-cracking ability, shortens the breeding cycle, reduces losses during the shelling process, improves seed germination rate, lowers breeding costs, and enhances the economic benefits of the peanut industry.
Smart Images
Figure CN120843728A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and genetic breeding technology, specifically to peanut pod splitting force sites, molecular marker methods, and their applications. Background Technology
[0002] Among the major oilseed crops in China, peanuts have the highest yield per unit area, total yield, and oil yield per unit area, making them the oilseed crop with the highest oil production efficiency and the best economic benefits.
[0003] Peanuts are non-splitting pods, and shelling is an essential step before they can be used. Manual shelling causes minimal damage to the kernels, resulting in high seed viability, a low kernel breakage rate, and good marketability. However, it is costly and inefficient, making it unsuitable for the needs of the modern peanut industry. Mechanized shelling is 20-30 times more efficient than manual shelling, but it causes significant damage to the peanut kernels. The germination rate of peanut seeds after mechanized shelling is only about 75%, far lower than the 97% germination rate achieved with manual shelling. Currently, the kernel breakage rate during mechanized shelling in my country is generally higher than 8%. This high breakage rate easily leads to aflatoxin contamination, seriously affecting the commercial value of peanut kernels and endangering public health. Therefore, there is an urgent need for genetic improvement of the pod-splitting trait in peanuts to cultivate new peanut varieties suitable for mechanized shelling for application in peanut production.
[0004] Searching revealed that the pod splitting mechanism has been extensively studied in crops such as rapeseed and soybean to reduce grain loss (Dong et al., 2014; Ballester and Ferrándiz, 2017; Chu et al., 2021). Pod splitting depends on the formation of the abscission zone. The abscission zone formation mechanism in Arabidopsis siliques is relatively well understood. SHATTERPROOF1 / 2 (Liljegrenet et al., 2000), INDEHISCENT (Liljegren et al., 2004), and ALCATRAZ (Roeder et al., 2003) are expressed at the pericarp margin and are core transcription factors regulating abscission zone development. FRUITFULL (Liljegren et al., 2000) and REPLUMLESS (Roeder et al., 2003) are expressed in the pericarp and embryo frame, respectively, strictly restricting the expression of abscission zone development-related genes to the pericarp margin and preventing the abscission zone from expanding into the pericarp and embryo frame. In addition to the aforementioned core regulatory network in the out-of-region region, many other transcription factors are involved, such as APETALA2 and SPATULA (Ballester and Ferrándiz, 2017).
[0005] Peanuts do not suffer from kernel loss due to pod cracking, and the pod-cracking trait has been largely overlooked in peanut domestication and breeding (Parker et al., 2021). However, the high kernel breakage rate during mechanized shelling is becoming increasingly prominent, highlighting the urgent need for mechanization-friendly improvements to the peanut pod-cracking trait. Current research on the mechanical characteristics of peanut pod cracking (Wang Jing, 2017; Lu Qing et al., 2020) and practical production indicate that the development of the junction (separation zone) between the two pods and the characteristics of the pod itself significantly influence peanut pod-cracking force. To date, genetic studies on peanut pod-cracking traits are scarce, necessitating the identification of a number of loci related to peanut pod-cracking force and the development of corresponding molecular markers for breeding applications. Summary of the Invention
[0006] To address the problems in the prior art, this invention provides peanut pod splitting force sites, molecular marker methods, and applications.
[0007] The technical solution adopted by the present invention to solve its technical problem is: a peanut pod splitting force site, which is qPD.B04.
[0008] On the other hand, the present invention also provides a molecular marker method for peanut pod splitting force sites, the method comprising the following steps:
[0009] S1: Phenotypic identification and QTL analysis. QTL scanning was performed using ICIMapping V4.2 software, combining existing genetic maps and population genotyping information.
[0010] S2: SNP site acquisition and marker development. Through analysis of gene annotation information within the interval and sequence difference analysis between parents, an A / G single nucleotide polymorphism was found at position 139316601 on chromosome B04 of the VX7G96 gene, which caused a termination mutation;
[0011] S3: Validation of the molecular markers linked to the pod-splitting trait, 139316601F and B04-139316601R. The qPD.B04 site was detected in the recombinant inbred line population using 139316601F or B04-139316601R.
[0012] S4. Acquire data and analyze it.
[0013] Preferably, the qPD.B04 site in S1 can explain 10.17%-13.61% of the phenotypic variation, and its enhancing allele is A, which is derived from Xuzhou 68-4.
[0014] Preferably, VX7G96 in S2 is a homologous gene of Arabidopsis thaliana SEP2. This gene is closely related to pistil development and is considered a key candidate gene for the pod-splitting force site qPD.B04.
[0015] Preferably, the molecular marker is located at nucleotide position 139316601 on the peanut B04 chromosome. The marker is developed based on the A / G polymorphism at position 139316601 on the B04 chromosome and is selected from the KASP markers B04-139316601F or B04-139316601R.
[0016] Preferably, the primer for the molecular marker B04-139316601F is:
[0017] B04-139316601F1: GAAGGTGACCAAGTTCATGCT GAGTGGTTTTATCCCTGGATG
[0018] B04-139316601F2:GAAGGTCGGAGTCAACGGATT GAGTGGTTTTATCCCTGGATa
[0019] B04-139316601-R:CCCTCCTTTTTTTGTGAGGTG.
[0020] Preferably, the primer for the molecular marker B04-139316601R is:
[0021] B04-139316601R1:GAAGGTGACCAAGTTCATGCT AGTGATGAGCTCAAAGCATCC
[0022] B04-139316601R2:GAAGGTCGGAGTCAACGGATT AGTGATGAGCTCAAAGCATCt
[0023] B04-139316601F: AATGGGGTAGGGTCAGATCAG.
[0024] Preferably, the recombinant inbred line population and lines are subjected to qPD.B04 site detection using B04-139316601F or B04-139316601R.
[0025] Preferably, DNA is extracted from peanut samples;
[0026] Using the DNA as a template, use B04-139316601F1: GAAGGTGACCAAGTTCATGCTGAGTGGTTTTATCCCTGGATG; or
[0027] B04-139316601F2: GAAGGTCGGAGTCAACGGATT GAGTGGTTTTATCCCTGGATa; or
[0028] PCR amplification was performed using any one of the primers in B04-139316601-R:CCCTCCTTTTTTTGTGAGGTG;
[0029] The amplification products were detected to determine the genotype at the qPD.B04 locus;
[0030] PCR reaction system: 1 μL DNA template, 5 μL 2×KASP Master Mix and 1.4 μL KASP PrimerMix, and finally add ultrapure water to a final volume of 10 μL. The KASP Primer Mix is prepared as follows: first dilute the primers to 100 μM, then add 15 μL of universal primers (short primers), 6 μL each of the two specific primers (two long primers), and add ultrapure water to a final volume of 50 μL to prepare the primer mixture.
[0031] Preferably, using a BIO-RAD CFX96 real-time PCR instrument, the following program was used: 95℃ thermal activation for 15 min; 95℃ denaturation for 20 s, annealing and extension at 65-55℃ for 60 s, 10 cycles, with a temperature decrease of 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, 30 cycles. Finally, the temperature was set to 37℃ for 1 min, and the fluorescence signal was read.
[0032] Preferably, the genotypes of the 195 recombinant inbred lines are identified using B04-139316601F or B04-139316601R, and the splitting ability data of each recombinant inbred line are obtained simultaneously.
[0033] On the other hand, the molecular markers of peanut pod-splitting force sites described in this invention are applied in the detection of peanut pod-splitting force or plant pod-splitting force.
[0034] The beneficial effects of this invention are:
[0035] (1) This invention precisely locates the qPD.B04 site, which explains 10.17%-13.61% of the phenotypic variation, and, combined with the functional analysis of the Arabidopsis SEP2 homolog VX7G96, clarifies the close association between key candidate genes and the pod-splitting trait. The developed KASP molecular markers 139316601F and B04-139316601R, based on A / G single nucleotide polymorphism, are highly specific and have high detection efficiency. This method does not require waiting for complete phenotypic expression and can directly screen target lines through genotyping identification, significantly shortening the breeding cycle, improving selection accuracy, and effectively solving the problems of time-consuming identification of pod-splitting ability and high susceptibility to environmental influences in traditional breeding. It provides a precise molecular tool for the targeted improvement of peanut pod-splitting ability.
[0036] (2) The molecular marker detection system established in this invention is easy to operate. With the help of the BIO-RAD CFX96 real-time PCR instrument and optimized reaction program, it can efficiently achieve genotyping of large-scale samples. The marker can stably associate with the pod-cracking ability phenotype, and can quickly screen out superior lines with suitable pod-cracking ability. This technology not only helps to breed peanut varieties with crack-resistant or crack-prone characteristics that meet production needs, reduce pod drop losses during harvesting or improve threshing efficiency, but also reduces breeding costs and accelerates the breeding and promotion of superior varieties. It is of great significance to improving the economic benefits and breeding technology level of the peanut industry. Attached Figure Description
[0037] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0038] Figure 1 This is a flowchart of the molecular marker method for peanut pod splitting force sites according to the present invention.
[0039] Figure 2 This is a map showing the location of the major locus qPD.B04, the key locus for the splitting trait of this invention, on chromosome B04. Detailed Implementation
[0040] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.
[0041] like Figure 1-Figure 2 As shown, the peanut pod splitting force site qPD.B04 of the present invention.
[0042] This invention also provides a molecular marker method for this site. The recombinant inbred line population (195 lines) of “Yuanza 9102 × Xuzhou 68-4” used in this invention was provided by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences.
[0043] I. Phenotypic Identification and QTL Analysis: From 2021 to 2023, the pod-splitting ability trait was investigated in a population of 195 recombinant inbred lines, specifically the Yuanhe 9102 × Xuzhou 68-4. Combining existing genetic maps and population genotypic information, QTL scanning was performed using ICIMapping V4.2 software, yielding repeatable QTL signals on chromosomes A05 and B04. Figure 1 The qPD.B04 locus explains 10.17%–13.61% of the phenotypic variation. Its enhancing allele is from Xuzhou 68-4, and its physical location is approximately 137.7–139.6 Mb in the Tifrunner genome.
[0044] II. SNP Locus Acquisition and Marker Development. Through analysis of gene annotation information within the interval and sequence difference analysis between parents, an A / G single nucleotide polymorphism (SNP) was found at position 139316601 on chromosome B04 in the VX7G96 gene, resulting in a termination mutation. VX7G96 is a homologous gene of Arabidopsis SEP2, which is closely related to pistil development and is considered a key candidate gene for the pod-splitting site qPD.B04. Therefore, the A / G SNP at position 139316601 on chromosome B04 was developed into two KASP markers, B04-139316601F and B04-139316601R.
[0045] The primers for the two molecular markers are as follows:
[0046] The primer for molecular marker B04-139316601F is:
[0047] B04-139316601F1: GAAGGTGACCAAGTTCATGCT GAGTGGTTTTATCCCTGGATG
[0048] B04-139316601F2:GAAGGTCGGAGTCAACGGATT GAGTGGTTTTATCCCTGGATa
[0049] B04-139316601-R:CCCTCCTTTTTTTGTGAGGTG
[0050] The primers for the molecular marker B04-139316601R are:
[0051] B04-139316601R1:GAAGGTGACCAAGTTCATGCT AGTGATGAGCTCAAAGCATCC
[0052] B04-139316601R2:GAAGGTCGGAGTCAACGGATT AGTGATGAGCTCAAAGCATCt
[0053] B04-139316601F: AATGGGGTAGGGTCAGATCAG
[0054] III. Validation of the linkage molecular markers B04-139316601F and B04-139316601R for the pod-splitting trait. The qPD.B04 locus was detected in 195 lines of the Yuanhe 9102 × Xuzhou 68-4 recombinant inbred line population using either B04-139316601F or B04-139316601R.
[0055] 1. PCR amplification and signal reading
[0056] Using genomic DNA from 195 recombinant inbred lines as templates, PCR amplification was performed using the aforementioned marker primers. The PCR reaction system and amplification procedure are as follows:
[0057] PCR reaction system: 1 μL DNA template, 5 μL 2×KASP Master Mix and 1.4 μL KASP PrimerMix, and finally add ultrapure water to a final volume of 10 μL. The KASP Primer Mix is prepared as follows: first dilute the primers to 100 μM, then add 15 μL of universal primers (short primers), 6 μL each of the two specific primers (two long primers), and add ultrapure water to a final volume of 50 μL to prepare the primer mixture.
[0058] Using a BIO-RAD CFX96 real-time PCR instrument, the following program was used: 95℃ thermal activation for 15 min; 95℃ denaturation for 20 s, annealing and extension at 65-55℃ for 60 s, 10 cycles, with a temperature decrease of 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, 30 cycles. Finally, the temperature was 37℃ for 1 min, and the fluorescence signal was read.
[0059] 2. Data Analysis
[0060] Genotyping of 195 recombinant inbred lines was performed using B04-139316601F or B04-139316601R. Simultaneously, the splitting ability data of each recombinant inbred line were obtained, as shown in Table 1. The splitting ability of the qPD.B04 line with genotype A / T (originating from Xuzhou 68-4) was significantly higher than that of the qPD.B04 line with genotype G / C (originating from Yuanza 9102).
[0061] Table 1: Relationship between qPD.B04 and pod splitting
[0062]
[0063] This invention also provides the application of a molecular marker method for peanut pod splitting force sites in the detection of peanut pod splitting force or plant pod splitting force.
[0064] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of protection claimed by the present invention. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A peanut pod-splitting force point, characterized in that: The site is qPD.B04.
2. The molecular marker method for peanut pod splitting force sites according to claim 1, characterized in that: The method includes the following steps: S1: Phenotypic identification and QTL analysis: QTL scanning is performed using software, combining existing genetic maps and population genotype information; S2: SNP site acquisition and marker development: Through analysis of gene annotation information within the interval and sequence difference analysis between parents, an A / G single nucleotide polymorphism was found at position 139316601 on chromosome B04 of the VX7G96 gene, resulting in a termination mutation; S3: Validation of the molecular markers linked to the pod-splitting trait B04-139316601F and B04-139316601R. The qPD.B04 site was detected in the recombinant inbred line population using B04-139316601F or B04-139316601R. S4. Acquire data and analyze it.
3. The molecular marker method for peanut pod splitting force sites according to claim 2, characterized in that: The qPD.B04 site in S1 has 10.17%-13.61% phenotypic variation, and its enhancing allele is A.
4. The molecular marker method for peanut pod splitting force sites according to claim 2, characterized in that: VX7G96 in S2 is a homolog of Arabidopsis thaliana SEP2.
5. The molecular marker method for peanut pod splitting force sites according to claim 4, characterized in that: The molecular marker at nucleotide position 139316601 on chromosome B04 of peanut is developed based on the A / G polymorphism at position 139316601 on chromosome B04 and is selected from KASP markers B04-139316601F or B04-139316601R.
6. The molecular marker method for peanut pod splitting force sites according to claim 5, characterized in that: The primer for molecular marker B04-139316601F is: B04-139316601F1: GAAGGTGACCAAGTTCATGCT GAGTGGTTTTATCCCTGGATG B04-139316601F2:GAAGGTCGGAGTCAACGGATT GAGTGGTTTTATCCCTGGATa B04-139316601-R:CCCTCCTTTTTTTGTGAGGTG.
7. The molecular marker method for peanut pod splitting force sites according to claim 5, characterized in that: The primers for the molecular marker B04-139316601R are: B04-139316601R1:GAAGGTGACCAAGTTCATGCT AGTGATGAGCTCAAAGCATCC B04-139316601R2:GAAGGTCGGAGTCAACGGATT AGTGATGAGCTCAAAGCATCt B04-139316601F: AATGGGGTAGGGTCAGATCAG.
8. The molecular marker method for peanut pod splitting force sites according to claim 5, characterized in that: The recombinant inbred line population and lines were tested for the qPD.B04 site using B04-139316601F or B04-139316601R.
9. The molecular marker method for peanut pod splitting force sites according to claim 8, characterized in that: DNA was extracted from peanut samples; Using the DNA as a template, PCR amplification was performed using any one of the primers in claim 6; The amplification products were detected to determine the genotype at the qPD.B04 locus; PCR reaction system: 1 μL DNA template, 5 μL 2×KASP Master Mix and 1.4 μL KASP Primer Mix, and finally add ultrapure water to make up to 10 μL; The preparation method of KASP Primer Mix is as follows: first dilute the primers to 100 μM, then add 15 μL of universal primers, 6 μL of each of the two specific primers, and add ultrapure water to 50 μL to prepare the primer mixture.
10. The molecular marker method for peanut pod splitting force sites according to claim 9, characterized in that: Using a BIO-RADCFX96 real-time PCR instrument, the following program was used: 95℃ thermal activation for 15 min; 95℃ denaturation for 20 s, annealing and extension at 65-55℃ for 60 s, 10 cycles, with the temperature decreasing by 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, 30 cycles, and finally 37℃ for 1 min, during which the fluorescence signal was read.
11. The molecular marker method for peanut pod splitting force sites according to claim 2, characterized in that: Genotyping of 195 recombinant inbred lines was performed using B04-139316601F or B04-139316601R, and pod splitting capacity data for each recombinant inbred line were obtained.
12. The application of the molecular marker method for peanut pod splitting force sites according to any one of claims 2-11 in the detection of peanut pod splitting force or pod splitting force in other plants.