Modified piezoelectric material, composite material and preparation method and application thereof

Abstract

The invention discloses a modified piezoelectric material, a composite material and a preparation method and application thereof. The modified piezoelectric material comprises sodium niobate with oxygen vacancies and cerium oxide, the sodium niobate with the oxygen vacancies and the cerium oxide form a heterojunction, and the synergistic function of sonodynamic piezoelectric catalysis, nano-enzyme and piezoelectricity can be achieved. A composite material containing the modified piezoelectric material and a bionic bone material has a piezoelectric osteogenesis effect and sonodynamic antibiosis, is used in infectious bone defect treatment, and can realize effective unification of sonodynamic antibiosis, anti-inflammation and piezoelectric osteogenesis under ultrasound of different powers.

Description

Technical Field

[0001] This invention relates to a modified piezoelectric material, a composite material, its preparation method, and its application. Background Technology

[0002] Bacterial infections continue to threaten human health, becoming one of the medical challenges facing humanity. Local infection of bone defects is a common complication, and the healing capacity of bone tissue can be severely impaired by the defect and potential bacterial infection. Antibiotics are typically used to control bacterial infection during bone implantation; however, due to the overuse of antibiotics, there is an urgent need for effective antibiotic-free treatments for infected bone defects.

[0003] Electrical signals are among the physiological signals that promote bone tissue repair and regeneration. The inherent piezoelectric properties of bone tissue help maintain its normal physiological metabolic functions. It has been reported that piezoelectric materials play an important role in promoting tissue regeneration. For example, Jacob et al. prepared a PHBV-BaTiO3 scaffold via electrospinning, which effectively promoted cartilage regeneration after corona polarization. Another example is Xu et al., who prepared a biocompatible lead-free piezoelectric ceramic K using solid-state sintering. 0.5 Na 0.5 NbO3 (KNN), after corona polarization, effectively promotes the proliferation and differentiation of BMSCs (mesenchymal stem cells).

[0004] Ultrasound-driven sonodynamic therapy, as a broad-spectrum antibacterial therapy based on reactive oxygen species (ROS), offers advantages over traditional photothermal therapy due to its higher tissue penetration and biocompatibility. Some studies have reported on ultrasonic piezoelectric catalysis for antibacterial effects, demonstrating that piezoelectric materials can generate ROS under ultrasonic conditions through piezoelectric catalysis, thereby exerting an antibacterial effect. However, the ROS generation efficiency of piezoelectric materials (such as perovskite materials like barium titanate and sodium niobate) is unsatisfactory due to the rapid recombination of electrons and holes.

[0005] Although significant progress has been made in the field of piezoelectric materials, effective strategies are still needed to improve piezoelectric catalytic performance in order to eliminate bacterial infections and promote bone regeneration. NaNbO3 (NNO), similar to KNN, belongs to the niobate-based lead-free piezoelectric ceramics and has good biocompatibility, making it highly promising in the field of piezoelectric catalysis. However, due to the easy recombination of electron-hole pairs and its wide band gap, its piezoelectric performance is poor, requiring modification to improve its piezoelectric and piezoelectric catalytic properties. Summary of the Invention

[0006] To overcome the shortcomings of existing piezoelectric materials in promoting bone regeneration and antibacterial applications due to their poor piezoelectric and piezocatalytic properties, this invention provides a modified piezoelectric material, a composite material, its preparation method, and its applications. The modified piezoelectric material and its composite material described in this invention possess excellent piezoelectric and piezocatalytic properties, effectively clearing infections and promoting bone regeneration.

[0007] To achieve the above objectives, the present invention adopts the following technical solution.

[0008] The present invention provides a modified piezoelectric material comprising sodium niobate (NNO) with oxygen vacancies and cerium oxide (CeO2), wherein the sodium niobate with oxygen vacancies and the cerium oxide form a heterojunction.

[0009] In this invention, the oxygen vacancy content in the sodium niobate with oxygen vacancies is preferably 10%-60%, more preferably 30%-40%. The oxygen vacancy content in the sodium niobate with oxygen vacancies is, for example, 10.65%, 13.88%, 34.29%, 38.94%, or 50.82%. The oxygen vacancy content is determined by XPS.

[0010] In this invention, the molar ratio of sodium niobate with oxygen vacancies to cerium oxide is preferably (2-6):1, for example 3:1, 4:1 or 5:1.

[0011] Cerium oxide is a multifunctional rare earth oxide, which undergoes valence state switching due to redox reactions (Ce... 3+ and Ce 4+ This gives it excellent enzymatic activity. Cerium oxide possesses both peroxidase (POD) and catalase (CAT) activities, exhibiting a tendency towards POD activity under acidic conditions and a tendency towards CAT activity under alkaline conditions.

[0012] This invention provides a method for preparing a modified piezoelectric material, comprising the following steps:

[0013] The mixture containing sodium niobate and cerium oxide with oxygen vacancies is ground and calcined to obtain the final product.

[0014] In this invention, the mixture preferably further comprises a grinding medium. The grinding medium allows for more uniform mixing. The grinding medium may be one or more of kerosene, engine oil, animal oil, glycerin, anhydrous ethanol, and water. In this invention, considering biosafety and the timeliness of post-processing, the grinding medium is preferably anhydrous ethanol and / or water, more preferably anhydrous ethanol.

[0015] The amount of the grinding media can be conventional in the art. Preferably, the ratio of the mass of the grinding media to the sum of the masses of the sodium niobate with oxygen vacancies and the cerium oxide is (2-5):1, for example, 4:1.

[0016] In this invention, the grinding can be performed using methods conventional in the art.

[0017] Optionally, the grinding is carried out in a mortar.

[0018] Preferably, the grinding time is 1-3 hours, for example, 2 hours.

[0019] In this invention, the calcination can be carried out in calcination equipment conventionally used in the art, such as a tube furnace.

[0020] Preferably, the calcination temperature is 300-500℃, for example, 400℃.

[0021] Preferably, the calcination is carried out under an inert atmosphere, such as an argon atmosphere.

[0022] Preferably, the calcination time is 0.5-3 hours, for example, 1 hour.

[0023] In this invention, the sodium niobate with oxygen vacancies can be treated using conventional methods in the art to form a certain amount of oxygen vacancies.

[0024] In some preferred embodiments of the present invention, the method for preparing sodium niobate with oxygen vacancies includes: calcining, washing, and drying a mixture containing sodium niobate and sodium borate to obtain the sodium niobate.

[0025] In the above embodiments, the molar ratio of sodium niobate and sodium borate can be 1:(0.5-4), for example 2:1, 1:1, 1:2 or 1:4; preferably 1:1.

[0026] In the above embodiments, the calcination can be carried out in calcination equipment conventionally used in the art, such as a tubular furnace.

[0027] Preferably, the calcination temperature is 300-500℃, for example, 400℃.

[0028] Preferably, the calcination is carried out under an inert atmosphere, such as an argon atmosphere.

[0029] Preferably, the calcination time is 0.5-2 hours, for example, 1 hour.

[0030] In the above implementation scheme, the washing operation is preferably performed by washing with water and ethanol in sequence.

[0031] In the above embodiments, the drying temperature is preferably 50-100°C.

[0032] In this invention, the sodium niobate can be prepared using methods conventional in the art. In some preferred embodiments of this invention, the preparation method of the sodium niobate includes the following steps: subjecting niobium oxide and sodium hydroxide solution to a hydrothermal reaction, washing the resulting product, and then calcining it to obtain the sodium niobate.

[0033] In the above implementation scheme, the hydrothermal reaction can be carried out in a hydrothermal reactor.

[0034] Preferably, the temperature of the hydrothermal reaction is 100-200℃, more preferably 160℃. The temperature of the hydrothermal reaction can be achieved by placing the hydrothermal reactor in an oven.

[0035] Preferably, the hydrothermal reaction time is 10-15 hours, more preferably 12 hours.

[0036] In the above embodiments, the concentration of niobium oxide is 10-30 g / L, preferably 20 g / L. The concentration of niobium oxide refers to the mass (g) of niobium oxide corresponding to 1 L of sodium hydroxide solution.

[0037] In the above embodiments, the sodium hydroxide solution refers to an aqueous solution of sodium hydroxide. The concentration of the sodium hydroxide solution can be 1-3 mol / L, preferably 2 mol / L.

[0038] In the above implementation scheme, the washing operation is preferably performed by washing with water and ethanol in sequence.

[0039] In the above embodiments, the purpose of calcination is to remove water of crystallization. The calcination can be carried out in calcination equipment conventionally used in the art, such as a muffle furnace.

[0040] Preferably, the calcination temperature is 300-500℃, for example, 400℃.

[0041] Preferably, the calcination time is 0.5-3 hours, for example, 1 hour.

[0042] In this invention, the particle size of the cerium oxide can be 50-150 nm, preferably 50 nm.

[0043] The present invention also provides a modified piezoelectric material, which is prepared by the above-described method for preparing modified piezoelectric materials.

[0044] In this invention, in the modified piezoelectric material prepared by the above method, the sodium niobate with oxygen vacancies and the cerium oxide form a heterojunction.

[0045] The present invention also provides a composite material comprising the modified piezoelectric material and the biomimetic bone material.

[0046] In this invention, the modified piezoelectric material and the biomimetic bone material are combined to endow the biomimetic bone material with acoustic-dynamic activity, thereby improving the antibacterial and anti-infection properties of the biomimetic bone material; at the same time, the biomimetic bone material is endowed with piezoelectric osteogenic activity, promoting bone tissue regeneration.

[0047] In this invention, the biomimetic bone material can be one or more of the following conventional polymeric materials used for biomimetic bone tissue: polyetherketoneketone (PEKK), polyimide (PI), polyethylene (PE), polypropylene (PP), polycaprolactone (PCL), and polylactic acid (PLA), preferably polyetherketoneketone (PEKK). The polylactic acid can be L-polylactic acid (PLLA), D-polylactic acid (PDLA), racemic polylactic acid (PDLLA), or non-optically active polylactic acid (Mseo-PLA).

[0048] In this invention, the volume ratio of the modified piezoelectric material in the composite material is 10%-50%, for example 40%, where the percentage is the percentage of the volume of the modified piezoelectric material to the total volume of the composite material.

[0049] The present invention also provides a method for preparing the composite material, which includes: calcining a mixture comprising the modified piezoelectric material and the biomimetic bone material to obtain the composite material.

[0050] In the above embodiments, the calcination can be carried out in calcination equipment conventionally used in the art, such as a tubular furnace.

[0051] Preferably, the calcination temperature is 300-500℃, for example 315℃ or 400℃.

[0052] Preferably, the calcination is carried out under an inert atmosphere, such as an argon atmosphere.

[0053] Preferably, the calcination time is 1-3 hours, for example, 2 hours.

[0054] In the above embodiment, a forming step is preferably included before calcination. The forming can be compression molding, which can be performed using a tablet press.

[0055] In the above embodiments, the process after calcination may further include polishing, cleaning, and drying. Polishing may be done using sandpaper. Cleaning is preferably done using ultrasonic cleaning.

[0056] The present invention also provides the use of the above-mentioned modified piezoelectric material or the above-mentioned composite material in the preparation of a medicament for treating infected bone defects.

[0057] In the above-described application of the present invention, the treatment is performed under ultrasound conditions.

[0058] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0059] The reagents and raw materials used in this invention are all commercially available.

[0060] The positive and progressive effects of this invention are as follows:

[0061] This invention constructs a heterojunction in a piezoelectric material in which NNO with oxygen vacancies is combined with cerium oxide. The NNO with oxygen vacancies can reduce the band gap, promote electron-hole separation, improve piezoelectric catalytic performance, and simultaneously enhance piezoelectric performance. The formed heterojunction can further improve the acoustodynamic piezoelectric catalytic performance of NNO and enhance the enzyme activity of cerium oxide by improving electron transfer capability, thereby realizing the synergistic function of acoustodynamic piezoelectric catalysis, nanozymes, and piezoelectricity.

[0062] The modified piezoelectric material obtained by this invention can be combined with biomimetic bone materials to obtain a novel bone repair material with piezoelectric osteogenic effect and sonodynamic antibacterial properties. This material can be used in the treatment of infectious bone defects and can effectively unify sonodynamic antibacterial properties, antioxidant stress resistance and piezoelectric osteogenic properties under ultrasound of different power levels. Attached Figure Description

[0063] Figure 1 SEM images of NO, NO1, NO2, NO3, and NO4 (a, scale bar: 500 nm; b, scale bar: 150 nm).

[0064] Figure 2 XRD patterns of BNNO (2θ range 10-80° (a), 2θ range 31-33° (b)), (c, d, e, f, g) O1s high-resolution XPS spectra of BNNO, (h) EPR spectra of BNNO.

[0065] Figure 3 SEM images (a, scale bar: 400 nm; b, scale bar: 150 nm) and EDS spectra (e), TEM (c) and HR-TEM images (d), XRD patterns (f) and XPS spectra (g) of NCO and BNCO, and high-resolution XPS spectra of Nb 3d (h) and Ce 3d (i) of BNCO.

[0066] Figure 4 The valence band XPS spectrum (ac), UV-Vis-NIR diffuse reflectance spectrum (d), Kubelka-Munk plot based on diffuse reflectance spectrum (e, f), electrochemical impedance spectroscopy (g), acoustic current spectroscopy (h), and heterojunction mechanism (i) of the sample are shown.

[0067] Figure 5 For the sample at US = 1.5 W / cm2 RhB degradation after 5 min of irradiation (a), time-dependent degradation of RhB (b), MB (d), and DBPF (e) of BNCO, RhB degradation of BNCO under different US irradiation powers (c), ·OH (f), and ·O2. - ESR spectrum of (g).

[0068] Figure 6 The degradation of MB in the sample at pH 5.5 and H₂O₂ = 10 mM is shown in (a), the degradation of MB in BNCO under different pH conditions is shown in (b), and the irradiation with different US powers is shown in (c), at pH 5.5 and US = 0.5 W / cm². 2 ESR spectrum of ·OH (d), oxygen production of the sample at pH = 7.4 and H2O2 = 10 mM (e), oxygen production of BNCO under different pH conditions (f) and different power US irradiation (g).

[0069] Figure 7 PFM amplitude (a) and phase diagram (b), butterfly loop (c) and hysteresis loop (d) for NO, NO2 and BNCO.

[0070] Figure 8 SEM images (a, scale bar: 6 μm; b, scale bar: 1 μm; c, scale bar: 400 nm) and EDS spectra (df) of PK, PNO, and PBNC.

[0071] Figure 9 The data include: RhB degradation by piezoelectric ultrasonic kinetics (a), RhB degradation by PBNC under different power US irradiation (b), MB degradation by POD enzyme activated in different samples (c, pH=5.5), MB degradation of PBNC under different power US irradiation (d), oxygen production by CAT enzyme activated in different samples (e, pH=7.4), oxygen production by PBNC under different pH (f) and different power US irradiation (g), as well as the d33 coefficient (h), microcurrent (i) and microvoltage (k) of different samples, and microcurrent (j) and microvoltage (l) of PBNC under different power US irradiation.

[0072] Figure 10 SEM images (a, scale bar: 30 μm) and CLSM images (b, scale bar: 20 μm) of rBMSCs on samples after 1 day and 3 days of culture, and cell proliferation on samples after 1 day, 3 days and 7 days of culture (c).

[0073] Figure 11ALP and ARS staining (a, b, scale bar: 300 μm), quantitative analysis of ALP activity (c), calcium nodules on cell samples after 7 and 14 days of culture (d), and quantitative analysis of osteogenic-related genes (OPN, OCN, ALP and Runx2) (eh).

[0074] Figure 12 CLSM images of rBMSCs after culturing samples under H2O2 conditions for 1 day with ROS fluorescence staining (scale bar: 100 μm).

[0075] Figure 13 Images of S. aureus and E. coli colonies after culturing on samples (a, b) and inhibition rates (c, d), crystal violet stained images (e, f) and biofilm residue (g, h).

[0076] Figure 14 SEM images of S. aureus and E. coli after incubation on samples (a, b), CLSM image of ROS fluorescent staining in S. aureus (c), and protein leakage of S. aureus and E. coli after culture on samples (d, e).

[0077] Figure 15 The acoustic dynamic activity of samples with different oxygen vacancies.

[0078] Figure 16 The acoustic-dynamic activity is determined by different heterojunction ratios.

[0079] Figure 17 The roughness, contact angle, and surface energy of the sample are given. Detailed Implementation

[0080] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0081] Preparation Examples

[0082] (1) Synthesis of sodium niobate NaNbO3 (NNO)

[0083] 1g of niobium oxide (Shanghai Xiaohuang Nanotechnology Co., Ltd., Shanghai, China) was added to 50ml (2mol / L) sodium hydroxide solution, poured into a hydrothermal reactor, and placed in an oven to react at 160℃ for 12h. The resulting powder was washed with water and ethanol, and then calcined in a muffle furnace at 400℃ for 1h to remove the water of crystallization, thus obtaining NNO powder.

[0084] (2) Preparation of black NNO with oxygen vacancies (BNNO)

[0085] NNO powder was blended with NaBH4 at different molar ratios (1:0, 2:1, 1:1, 1:2, 1:4) and calcined in a tube furnace at 400°C under an argon atmosphere for 1 hour. The resulting powder was washed with water and ethanol and dried to obtain black NNO (BNNO) with oxygen vacancies.

[0086] (3) Synthesis of BNNO / CeO2 heterojunction (BNCO)

[0087] BNNO (using NO2) and CeO2 (particle size 50 nm, Shanghai Xiaohuang Nanotechnology Co., Ltd., Shanghai, China) were mixed in different molar ratios (3:1, 4:1, 5:1). Anhydrous ethanol was added to a mortar to mix the powder evenly. The mass ratio of anhydrous ethanol to powder was 4:1. The mixture was ground for 2 hours and then calcined in a tube furnace at 400℃ under an argon atmosphere for 1 hour to obtain BNNO / CeO2 heterojunctions (BNCO). NNO / CeO2 heterojunctions (NCO) served as a control group, with a molar ratio of NNO to CeO2 of 4:1.

[0088] (4) Preparation of PBNC composite material

[0089] PBNC composite materials were prepared by cold pressing and sintering. BNCO powder (BNCO-4:1) was mixed with polyether ketone ketone (PEKK) powder at a volume ratio of 40%. The mixture was pressed into a tablet (Φ12mm×2mm) using a tablet press and calcined in a tube furnace at 400℃ under an argon atmosphere for 2 hours. After sintering (sintering temperatures: PK: 305℃, PBNC: 345℃), the samples were sanded, ultrasonically cleaned, and dried to obtain the PBNC samples.

[0090] The representation methods and abbreviations of each sample are shown in Table 1.

[0091] Table 1

[0092]

[0093]

[0094] Example 1: Morphological Structure and Electrochemical Properties Characterization

[0095] (1) Test method

[0096] The morphology of the samples was characterized using SEM (SEM, S-4800, Hitachi, Japan), EDS (EDS, S-4800, Hitachi, Japan) and TEM.

[0097] XRD analysis was performed using an X-ray diffractometer (XRD, D / max2550VB / PC, Japan).

[0098] XPS analysis was performed using an X-ray photoelectron spectroscopy (XPS, Thermo Scientific K-Alpha, USA) instrument.

[0099] EPR analysis was performed using an electron paramagnetic resonance spectrometer (EMX-8 / 2.7, USA).

[0100] Diffuse reflectance spectral analysis was performed using a UV-Vis-NIR (Lambda 950, USA) spectrometer.

[0101] The surface roughness of the sample was measured using a laser confocal 3D microscope (VK-X 110, Keyence, Japan).

[0102] The water / diiodomethane contact angle of the sample was determined using a contact angle meter (JC2000D1, Shanghai Zhongchen Digital Technology Equipment Co., Ltd., China), and the surface energy was calculated according to the Owen-Wendt two-liquid method.

[0103] Using a standard three-electrode system in an electrochemical workstation (PARSTAT2273, USA) at 1.5 W / cm 2 The electrochemical properties of the samples were measured under ultrasonic (US) conditions.

[0104] (2) Test Results

[0105] Figure 1 The image shows SEM images of NO, NO1, NO2, NO3, and NO4 at different magnifications. NaBH4, as a strong reducing agent, can release hydrogen gas in situ through thermal decomposition, thereby capturing lattice oxygen in NNO and generating oxygen vacancies. As shown in the figure, with increasing NaBH4 content, more defect structures appear on the NNO surface, indicating an increase in oxygen vacancies, while the particle size remains relatively unchanged at around 500 nm.

[0106] XRD pattern ( Figure 2 Part a) shows that the diffraction peaks of all samples did not differ significantly, indicating that the thermal reduction of NaBH4 did not change the crystal structure of NNO. However, the diffraction peaks around 2θ = 32.5° (…) Figure 2 The b-part gradually shifts to the left as the NaBH4 content increases, indicating that lattice distortion has occurred in the crystal structure and the interplanar spacing has increased. Figure 2 c, d, e, f, and g are the high-resolution O1s spectra of BNNO, where O1, O2, and O3 correspond to lattice oxygen, oxygen defects, and surface-adsorbed oxygen and hydroxyl radicals, respectively. Clearly, the oxygen vacancy content gradually increases with increasing NaBH4 content, indicating that the oxygen vacancy content can be controlled by adjusting the NaBH4 ratio. EPR spectra ( Figure 2 The h-part indicates that BNNO exhibits a strong amplitude around g = 2.003, which also proves the existence of oxygen vacancies.

[0107] Based on the absorbance diagram of BNNO piezoelectric catalytic degradation of RhB solution ( Figure 15 It can be seen that NO2 with an appropriate number of oxygen vacancies (oxygen vacancy content of 34.29%) exhibits the best piezoelectric catalytic performance. This is because when there are excessive oxygen vacancies, too many oxygen defects will lead to charge recombination, which will reduce the piezoelectric catalytic performance. Based on the absorbance diagram of the piezoelectric catalytic degradation of RhB solutions with different molar ratios of BNCO (…), Figure 16 It can be seen that BNCO with a molar ratio of 4:1 has the best piezoelectric catalytic performance, which is due to the fact that the appropriate ratio of NO2 and CeO2 has the most significant enhancement effect on piezoelectric catalytic performance.

[0108] Figure 3 The test was conducted based on the control group NCO and BNCO-4:1. Figure 3 Parts a and b show SEM images of NCO and BNCO at different magnifications, combined with Figure 3 The EDS spectrum of the e-part shows that CeO2 is uniformly distributed on the NO2 surface. Furthermore, through... Figure 3 HR-TEM analysis of the d-section showed that the lattice spacing of BNNO was 0.40 nm, slightly larger than the lattice spacing of the NNO(101) plane (0.39 nm) in the literature, indicating an increased interplanar spacing. Figure 3 TEM analysis of part c showed that spherical CeO2 and NO2 surfaces were uniformly bonded with each other with a lattice spacing of 0.27 nm.

[0109] XRD pattern ( Figure 3 The f-part indicates that the diffraction peaks of NO2 at 2θ = 22.7°, 32.5°, 46.5°, 52.4°, and 58.0°, and the diffraction peaks of CeO2 at 2θ = 28.5°, 33.1°, 47.5°, and 56.4°, are also present in the diffraction peaks of BNCO. Similarly, in the XPS spectrum of BNCO (… Figure 3 The detection of Ce 3d signals in the g-part of BNCO indicates the successful synthesis of the heterostructure. Figure 3 The high-resolution Ce3d spectrum (h-part) indicates that oxygen vacancies do not change the valence state of Nb ions. Figure 3 The i-part spectrum indicates the presence of Ce ions with variable valence in the heterojunction.

[0110] Figure 4 The valence bands of NO, NO2, and CeO2 were determined by XPS-VB spectroscopy, and were 2.03, 2.66, and 2.38 eV, respectively. Figure 4The d-part represents the UV-Vis-NIR diffuse reflectance spectrum, indicating that oxygen vacancies enhance visible light absorption. The band gaps of NO2 and CeO2 were determined based on the diffuse reflectance spectra. Figure 4 The e and f portions were calculated to be 3.20 and 2.59 eV respectively. Compared with the band gap of NO (3.34 eV), it can be seen that oxygen vacancies reduce the band gap. Figure 4 As can be seen from the impedance diagram (part g), BNCO exhibits the smallest semicircle, indicating the minimum impedance. Figure 4 The h-part of the transient acoustic-current curve demonstrates that BCNO possesses excellent acoustic-current density, promoting carrier separation. Comparisons with different samples show that both oxygen vacancies and heterojunctions can reduce impedance and promote electron transfer and electron-hole separation under US irradiation. Figure 4 The i-th part shows the formation mechanism of heterojunctions. Figure 4 The BNCO test results are all based on the BNCO-4:1 test.

[0111] Figure 8 The AC section shows SEM images of PK, PNO, and PBNC at different magnifications. PK exhibits a smooth surface, while PNO and PBNC show rough surfaces with NO and BNCO particles exposed. (EDS) Figure 8 The results (df part) show that Nb and Ce elements are uniformly dispersed on the PNO and PBNC surfaces, and NO and BNCO are uniformly mixed with PK on the surface.

[0112] Roughness and contact angle analysis of composite materials ( Figure 17 The results showed that the roughness of both PNO and PBNC increased after blending, reaching 5.378±0.310 μm and 6.643±0.411 μm respectively compared to PK (1.779±0.220 μm). Furthermore, the water contact angles of PK, PNO, and PBNC were 90.5°±2.30°, 55.25°±2.40°, and 51.00°±2.00°, respectively, and their surface energies were 32.23±2.12 mJ / m². 2 51.17±3.40mJ / m 2 53.94±3.15mJ / m 2 These results indicate that NO and NO2 in the blended composite material increase the water contact angle and surface energy.

[0113] Example 2: Acoustodynamic Performance Test

[0114] (1) Test method

[0115] Total ROS, ·OH, and ·O2 generated in the samples were detected using RhB (Rhodamine B, 10 mg / L), MB (methylene blue, 5 mg / L), and DPBF (1,3-diphenylisobenzofuran, a singlet oxygen indicator fluorescent probe, 5 mg / L). - 10 mg of sample was immersed in 10 mL of solution and subjected to different US conditions (1 MHz, 0, 0.3, 0.5, 0.8, 1, 1.5 W / cm²). 2 After 0, 2, 4, 6, 8, and 10 min, the absorbance of the mixed solution was measured to obtain the ROS generation efficiency. Electron paramagnetic resonance spectroscopy was used, with 5,5-dimethyl-1-pyrrolidone N-oxide (DMPO) as the ·OH and ·O2. - The trapping agent was used to obtain the ESR spectrum.

[0116] Piezoelectric properties were analyzed using piezoelectric microscopy (PFM).

[0117] The sample was corona polarized using a polarization device, and the d33 of the sample was measured using a quasi-static piezoelectric constant (d33) tester (ZJ-3AN, China).

[0118] (2) Test Results

[0119] Figure 5 Part a shows the varying abilities of different samples to degrade RhB under US irradiation. The results indicate that BNCO exhibits the best piezoelectric catalytic performance, which is attributed to the synergistic enhancement of electron transport capacity by oxygen vacancies and heterojunctions, thereby improving the separation of electron-hole pairs. Figure 5 Parts b, d, and e show that BNCO can continuously degrade RhB, MB, and DBPF with increasing US irradiation time, indicating that it can generate large amounts of ·OH and ·O2. - . Figure 5 Part c shows the degradation of biological RhB by BNCO under different power levels, demonstrating that at 0.5 W / cm²... 2 BNCO does not have acoustic properties, 0.8 W / cm². 2 The above describes how BNCO is excited to exhibit acoustic dynamic activity, with higher power resulting in stronger activity; this is demonstrated by ESR spectroscopy (…). Figure 5 The f and g parts directly verified that BNCO can generate ROS under US irradiation. The results showed that BNCO can generate ·OH and ·O2, respectively. - It also has the highest peak intensity. Figure 5 The BNCO test results are all based on the BNCO-4:1 test.

[0120] Example 3: Enzyme Activity Test

[0121] (1) POD enzyme activity test

[0122] POD enzyme activity was detected using MB. 10 mg of sample (BNCO-4:1, PBNC) was immersed in 10 mL of MB solution containing 10 mM H₂O₂. After reacting for 10 min under different US conditions and different pH conditions (4.5, 5.5, 6.5, 7.4), the absorbance of the mixture solution was measured. ESR spectra were obtained using electron paramagnetic resonance spectroscopy with DMPO as the ·OH scavenger.

[0123] (2) CAT enzyme activity test

[0124] CAT enzyme activity was detected using a dissolved oxygen meter. 50 mg of sample (BNCO-4:1, PBNC) was immersed in 50 mL of PBS solution containing 10 mM H2O2. Dissolved oxygen content (mg / L) was measured at different times (every 5 min within 1 h) under different US conditions and pH conditions.

[0125] Figure 6 Part a shows the POD enzyme activity of different samples. The results indicate that BNCO has the best POD enzyme activity. This is because oxygen vacancies reduce the band gap, while the heterojunction enhances electron transfer, thereby promoting the redox cycle of variable-valence Ce ions. Figure 6 Part b shows that POD enzyme activity gradually decreases with increasing pH, indicating that BNCO exhibits pH dependence and is more likely to exert POD enzyme activity under acidic conditions. This was confirmed by ESR spectroscopy. Figure 6 Part c) verified that BNCO has enhanced POD enzyme activity at low frequency US, which indicates that BNCO can piezoelectrically enhance POD enzyme activity at low frequency US. Figure 6 The enzyme activity of the sample was further verified by ESR in part d, indicating that BNCO has the highest POD activity and that sonication further enhances its enzyme activity. Figure 6 The e section shows the oxygen generation of different samples, and the results indicate that BNCO has the best CAT enzyme activity. Figure 6 The f part indicates that oxygen production gradually increases with increasing pH, suggesting that CAT enzyme activity is highest under neutral conditions. Figure 6 The g part indicates that under a certain power, ultrasound can enhance the CAT activity of the sample. As the ultrasound power increases, the oxygen in the system decreases because the sample exerts its acoustic dynamic properties and consumes some oxygen.

[0126] Figure 9The ag portion shows the composite material's performance in degrading RhB under US irradiation, degrading MB via POD enzyme activity, and generating oxygen via CAT enzyme activity. The results are consistent with those of the powder sample; oxygen vacancies and heterojunctions both enhance the piezoelectric catalysis of the composite material, and sonication improves the enzyme activities of POD and CAT enzymes and the pH dependence of the enzymes. Figure 9 The h-part indicates that PK itself does not possess piezoelectric properties. However, after blending with modified NNO, PNO, PBNO, and PBNC all exhibit piezoelectric properties, with d33 coefficients of 1.2±0.1 pC / N, 1.8±0.2 pC / N, and 3.1±0.2 pC / N, respectively. This is because PEKK is a non-conductive material, which hinders electron transport, thus reducing the d33 coefficient. Studies have shown that due to the different piezoelectric properties of different parts of natural bone, the d33 of natural bone ranges from 0.7 to 2.3 pC / N, while the d33 of BNCO matches that of natural bone, which has a positive impact on osteogenic activity.

[0127] Example 4: Piezoelectric properties

[0128] Powder piezoelectric properties were analyzed using piezoelectric microscopy (PFM).

[0129] The sample was corona polarized using a polarization device, and the d33 of the sample was measured using a quasi-static piezoelectric constant (d33) tester (ZJ-3AN, China).

[0130] An oscilloscope and amplifier were used to measure the performance of samples under different ultrasonic conditions (0.5 W / cm²). 2 The open-circuit voltage and short-circuit current of the PBNC were measured, and the voltage and current of the PBNC under different ultrasonic powers were determined.

[0131] Test results: Figure 7 The BNCO test results are all based on the BNCO-4:1 test. Figure 7 Parts a and b are the amplitude and phase images of the piezoelectric response induced by PFM, indicating that the sample exhibits a piezoelectric effect. From the butterfly hysteresis loop ( Figure 7 As shown in part c), compared to NO, a smaller voltage change can cause NO2 and BNCO to produce higher amplitudes. The piezoelectric coefficients (d33) of NO, NO2, and BNCO, calculated according to PFM, are 36.58 pm / V, 44.55 pm / V, and 65.14 pm / V, respectively. The hysteresis loop ( Figure 7 The d-section shows that the hysteresis loop of BNCO is significantly narrower than that of NO and NO2, indicating that a small voltage change can cause a phase reversal. These results demonstrate that both oxygen vacancies and heterojunctions can improve piezoelectric properties. Figure 9 The results for the il section are consistent with those for d33. PBNC has the highest ultrasonic response open-circuit voltage and short-circuit current, and the ultrasonic power increases the electrical signal.

[0132] Example 5: In vitro cell experiments

[0133] Rat bone marrow mesenchymal stem cells (rBMSCs) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. They were cultured in α-MEM medium supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin / streptomycin (P / S, TBD, China) at 37°C under a 5% CO2 atmosphere. The medium was changed every 3 days, and cell experiments were conducted using 3-5 passages of rBMSCs.

[0134] (1) Cell proliferation and morphology

[0135] Samples (PK, PNO, and PBNC) were sterilized using 75% ethanol and UV irradiation. Cell proliferation on the samples was assessed using a cell counting kit. rBMSCs (density 3 × 10⁻⁶) were also analyzed. 4 The samples (Φ12×2mm) were cultured in wells for different times (1d, 3d, 7d). After 24h of culture, the samples were treated daily with 1MHz, 0.5W / cm² water. 2 rBMSCs in the US treatment group were irradiated for 20 seconds every 6 hours. Subsequently, CCK-8 solution (100 μL) was added to the culture medium. After incubation for 4 hours, 100 μL of culture medium from each sample was transferred to a new 96-well plate, and the absorbance (OD value) of the culture medium was measured at 450 nm using a microplate reader (SpectraMax iD5, Molecular Devices, Austria).

[0136] Cell morphology was observed using SEM and CLSM. After 1 and 3 days of culture, the culture medium was removed, and cells were fixed with 2.5% glutaraldehyde (TBDScience, China) for 4 hours, dehydrated with graded ethanol solutions, and observed using SEM. Actin filaments and nuclei were stained with FITC-Phalloidin (400 μL, Yeasen Biotech, China) for 45 min and 2-(4-amidinylphenyl)-6-indolamidine dihydrochloride (200 μL, Beyotime Biotech, China) for 10 min, respectively. Actin filaments were stained green, and nuclei were stained blue. The stained cells were observed using CLSM.

[0137] The proliferation of rBMSCs in vitro was evaluated using the CCK-8 assay. SEM images ( Figure 10 Part a) shows the morphology of cells after 1 and 3 days of culture on the samples. Cells on PK are oval, while cells with filamentous pseudopodia are flattened and well-dispersed on PNO and PBNC surfaces. CLSM images ( Figure 10 Part b) further demonstrates that, compared to PK, cells with a stretched morphology diffuse better on PNO and PBNC. For example... Figure 10 As shown in section c, the cell proliferation capacity on the sample increased with prolonged culture time. Compared with PK, PNO and PBNC containing NO and BNCO enhanced the proliferation of rBMSCs, while PBNC containing CeO2 further enhanced cell proliferation. Furthermore, low-frequency US irradiation induced microcurrents in PNO and PBNC through piezoelectric response, further promoting cell proliferation.

[0138] (2) Alkaline phosphatase (ALP) staining and quantitative analysis of ALP activity

[0139] ALP staining and quantitative analysis of ALP activity were used to assess osteogenic differentiation of cells. After 7 and 14 days of culture, cells were fixed with 4% paraformaldehyde (PA, Beyotime, China), and stained with 5-bromo-4-chloro-3-indolyl phosphate / nitrotetrazole chloride blue solution. The stained cells were observed using an optical microscope. To quantify ALP activity, cells were lysed in wells of a plate with 1% Nonidet P-40 solution for 1 h, followed by centrifugation (2000 rpm) for 10 min. The supernatant was then added to the plate with p-nitrophenyl phosphate (Sangon, China) substrate solution (containing MgCl2·6H2O (1 mmol / L) and glycine (0.1 g / mL)), incubated at 37°C for 1 h, and the reaction was terminated by adding NaOH solution (0.2 mol / L). The absorbance (OD value) was measured at 405 nm using a microplate reader. Total protein content was determined using a BCA protein assay kit, and ALP activity was calculated by dividing the absorbance at 405 nm by the total protein content.

[0140] (3) Alizarin Red (ARS) staining and quantitative analysis of calcium nodules

[0141] Alizarin Red (ARS) staining and quantitative analysis of calcium nodules were used to assess osteogenic differentiation of cells. After 14 and 21 days of culture, cells were fixed with 4% PA and stained with 1% ARS solution (Servicebio, China). The stained cells were observed using an optical microscope. For ARS quantitative analysis, samples were immersed in 10% hexadecylpyridine chloride solution (Servicebio, China) for 1 hour. The absorbance of the solution was measured at 620 nm.

[0142] (4) Expression of osteogenic genes

[0143] After 7 and 14 days of culture, the expression of osteogenic genes (ALP, OPN, OCN, Runx2) in the sample cells was detected by RT-PCR. In short, total RNA was extracted from the cells using Trizol reagent (Invitrogen, CA), and then transcribed into cDNA using the PrimeScript RT kit (Takara, Japan). Quantitative gene expression analysis was performed using the ABI SyBr Green system. Gene expression was normalized to GADPH (housekeeping genes). Table 2 lists the forward and reverse primer sequences.

[0144] Table 2

[0145] Gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) ALP CGTCTCCATGGTGGATTATGCT CCCAGGCACAGTGGTCAAG OPN CCAAGCGTGGAAACACACAGCC GGCTTTGGAACTCGCCTGACTG OCN GCCCTGACTGCATTCTGCCTCT TCACCACCTTACTGCCCTCCTG Runx2 TCTTCCCAAAGCCAGAGCG TGCCATTCGAGGTGGTCG GAPDH GGAATCCACTGGCGTCTTCA GGTTCACGCCCATCACAAAC

[0146] ALP and ARS staining images as follows Figure 11 As shown in parts a and b, PNO and PBNC staining are stronger than PK, and the staining effect of PNO and PBNC is further enhanced after low-frequency US irradiation. Quantitative analysis of ALP and ARS ( Figure 11 As can be seen from parts c and d, PBNC has the highest ALP activity and calcium content in both the non-US and US groups. Figure 11 The eh section indicates that the expression of PNO and PBNC osteogenic genes (OPN, OCN, ALP, and Runx2) increases over time, while PK expression is not significant. The expression levels of PBNC osteogenic genes were highest in both the non-US and US groups. This is because CeO2 contained in PBNC has an osteogenic-promoting effect, and the binding of oxygen vacancies and heterojunctions gives it a stronger piezoelectric effect under US conditions, thereby generating more microcurrents to promote osteogenic differentiation.

[0147] (5) Detection of intracellular reactive oxygen species (ROS)

[0148] After co-culturing the samples with cells, 10 μL of 0.1 mM H2O2 solution was added to the culture medium to examine the samples' ability to scavenge intracellular ROS. After 1 day of co-culturing, the culture medium was removed, and the cells were fixed with 4% PA. The samples were then stained with intracellular ROS using the DCFH-HA fluorescent probe (Beyotime, China). The stained cells were observed using CLSM. The ROS fluorescence intensity was quantitatively analyzed using ImageJ software.

[0149] Depend on Figure 12It was found that PK and PNO exhibited abundant ROS fluorescence in the surface cells of both the non-US and US groups, indicating that they lacked the ability to scavenge ROS. In contrast, the ROS fluorescence in the surface cells of PBNCs containing CeO2 was significantly reduced, suggesting that the CAT enzyme activity of CeO2 consumed H2O2. The ROS fluorescence in the surface cells of PBNCs in the US group was the weakest, and the cells maintained good morphology, indicating that ultrasonic piezoelectricity promoted CAT enzyme activity and consumed more H2O2.

[0150] Example 6: In vitro antibacterial effect determination

[0151] The in vitro antibacterial effects of Staphylococcus aureus (ATCC 29213) and Escherichia coli (ATCC 25922) on the samples were determined. Staphylococcus aureus and Escherichia coli were cultured in tryptone soybean broth (TSB) and lysogenized broth (LB), respectively, at 37°C for 12 h. The samples were then divided into 9 groups: PK, PNO, PBNC, PK+US, PNO+US, PBNC+US, PK+H2O2, PBNC+H2O2, and PBNC+US+H2O2. The US power was 1.5 W / cm². 2 The H2O2 concentration was 2 mM, and the treatment lasted for 20 min.

[0152] Experiments were conducted independently in at least three replicates, and results are expressed as mean ± standard deviation. All data were analyzed using one-way ANOVA and Tukey's post-hoc test. *P < 0.05 was considered statistically significant.

[0153] (1) Determination of antibacterial rate

[0154] The inhibition rate was determined by colony counting. The samples were disinfected with ultraviolet light for 12 hours. A concentration of 1×10⁻⁶ was used. 6 A bacterial suspension of CFU / mL (1 mL) was co-cultured with the sample in a 24-well plate at 37°C with a shaking incubator for 6 h. The sample was then removed and resuspended in 1 mL of sterile PBS. Bacteria on the sample surface were separated by shaking (150 W, 50 Hz) for 5 min. After a 10-fold dilution, the bacterial suspension (20 μL) was spread onto a nutrient agar plate and incubated at 37°C for 24 h. Colonies were photographed and counted. The inhibition rate was calculated using the following formula:

[0155] Antibacterial rate (%) = (CS) / C × 100%

[0156] C and S represent the colony counts of the control group (with PEKK as the control) and the sample group, respectively.

[0157] Figure 13Parts a and b show photographs of S. aureus and E. coli colonies isolated from the samples after incubation on agar plates. Without the treatment of US and H2O2, abundant S. aureus and E. coli colonies were found on PK, PNO, and PBNC. Under US treatment, the number of colonies on PNO decreased slightly, indicating lower antibacterial activity. However, under the combined treatment of US and H2O2, PBNC exhibited the best antibacterial performance, which is attributed to the synergistic antibacterial effect of piezoelectric catalysis and POD enzyme. Figure 13 Parts c and d show that the PBNC+H2O2+US group achieved antibacterial rates of 95.7±0.8% and 98.1±0.7% against S. aureus and E. coli, respectively.

[0158] (2) Inhibitory effect of composite materials on bacterial biofilm

[0159] 100 μL of bacterial suspension (1 × 10⁸ CFU / mL) was mixed with 900 μL of bacterial culture medium (TSB and LB for S. aureus and E. coli, respectively) and incubated in 24-well plates at 37 °C for 48 h. Samples were added to the 24-well plates and treated under different conditions before incubation at 37 °C for 12 h. The plates were then washed twice with PBS, fixed with 500 μL of anhydrous ethanol, and incubated at 4 °C for 15 min. Subsequently, 300 μL of 1% crystal violet dye was added to each well and incubated for another 30 min. After rinsing three times with PBS, images of the bacterial biofilm in each well were recorded using a digital camera. After drying the 24-well plates, 100 μL of 33% glacial acetic acid solution was added to each well and incubated at 37 °C for 30 min to dissolve the crystal violet. The absorbance at 590 nm was measured using a microplate reader to assess the degree of biofilm damage caused by the material.

[0160] Figure 13 Parts e and f show the biofilm stained with crystal violet, indicating that PK and PNO groups had no significant biofilm removal effect. However, under the combined action of US and H2O2, PBNC significantly removed biofilms from S. aureus and E. coli. Figure 13 The g and h portions indicate that the biofilm residue rates of S. aureus and E. coli in the PBNC+H2O2+US group were 3.6±1.0% and 3.2±1.4%, respectively.

[0161] (3) Observation of extracellular morphology

[0162] After co-culturing the samples with bacteria, the bacterial suspension was centrifuged (8000 rpm, 5 min), the supernatant was removed, and the precipitate was resuspended in sterile water. 2-3 μL of the suspension was dropped onto a clean silicon wafer, dried, and then fixed with 1% glutaraldehyde PBS solution for 12 h. Finally, the samples were dehydrated using a gradient of ethanol solutions (10%, 20%, 30%, 50%, 70%, 85%, 90%, and 100%), dried, and the bacterial damage was observed using SEM.

[0163] Figure 14 Parts a and b show the surface morphology images of *S. aureus* and *E. coli* after culturing on the samples. It can be seen that the bacterial morphology in the PK group showed no significant change, while a small number of bacteria in the PNO group were broken up under US irradiation. PBNC, under the combined action of US and H2O2, significantly disrupted the structure of *S. aureus* and *E. coli*, causing intracellular substances to leak out.

[0164] (4) Determination of bacterial protein leakage

[0165] After co-culturing the samples with bacteria, the bacterial suspension was centrifuged (8000 rpm, 5 min) to obtain the supernatant. Protein concentration was measured using the BCA Protein Assay Kit (Cat#PC0020, Solarbio). 25 μL of the supernatant was added to the kit's working buffer (200 μL), vortexed for 30 s, and the mixture was incubated at 37°C in a shaker for 30 minutes. Finally, the OD562 of each mixture was recorded.

[0166] Figure 14 Parts d and e indicate that under US and H2O2 conditions, PK and PNO only exhibit trace amounts of protein leakage. However, the PBNC+H2O2+US group showed significant protein leakage, suggesting that PBNC, through piezoelectric catalysis and the synergistic action of heterojunction nanozymes, can disrupt bacterial structure, leading to protein leakage.

[0167] (5) Detection of bacterial reactive oxygen species (ROS)

[0168] The bacterial suspension, after co-culturing with the sample, was incubated with 100 μL of 2′,7′-dichlorofluorescein diacetate (DCFH-DA) (10 μM) in the dark for 30 min. After washing with PBS, the relative fluorescence intensity was measured by fluorescence spectroscopy (excitation / emission wavelengths: 350 / 461 nm). ROS levels in *S. aureus* were observed using a CLSM at Ex / Em = 488 / 525 nm.

[0169] Figure 14Part c shows the intracellular ROS fluorescence of *S. aureus* after culturing on the sample. It can be seen that under US and H2O2 conditions, PK and PNO only produce trace amounts and small amounts of ROS. The PBNC+H2O2+US group produces the highest ROS content, indicating that PBNC can generate a large amount of ROS under the synergistic effect of piezoelectric catalysis and heterojunction.

Claims

1. A modified piezoelectric material, characterized in that, It includes sodium niobate with oxygen vacancies and cerium oxide, wherein the sodium niobate with oxygen vacancies and the cerium oxide form a heterojunction.

2. The modified piezoelectric material according to claim 1, characterized in that, The oxygen vacancy content in the sodium niobate with oxygen vacancies is 10%-60%, preferably 30%-40%. And / or, the molar ratio of the sodium niobate with oxygen vacancies to the cerium oxide is (2-6):1, for example 3:1, 4:1 or 5:

1.

3. A method for preparing a modified piezoelectric material, characterized in that, It includes the following steps: The mixture containing sodium niobate and cerium oxide with oxygen vacancies is ground and calcined to obtain the final product.

4. The method for preparing the modified piezoelectric material according to claim 3, characterized in that, The method for preparing sodium niobate with oxygen vacancies includes: calcining a mixture containing sodium niobate and sodium borate, washing, and drying to obtain the product; The molar ratio of sodium niobate to sodium borate can be 1:(0.5-4), for example 2:1, 1:1, 1:2 or 1:4, preferably 1:1; Preferably, the calcination satisfies one or more of the following conditions ①-④: ①The calcination is carried out in a tube furnace; ② The calcination temperature is 300-500℃, for example 400℃; ③ The calcination is carried out under an inert atmosphere, such as an argon atmosphere; ④ The calcination time is 0.5-2 hours, for example, 1 hour; Preferably, the washing operation involves washing with water and ethanol sequentially. The drying temperature is preferably 50-100℃.

5. The method for preparing the modified piezoelectric material according to claim 3, characterized in that, The mixture also contains abrasive media; The grinding medium is, for example, one or more of kerosene, machine oil, animal oil, glycerin, anhydrous ethanol and water; preferably anhydrous ethanol and / or water, more preferably anhydrous ethanol; Preferably, the ratio of the mass of the grinding media to the sum of the masses of the sodium niobate with oxygen vacancies and the cerium oxide is (2-5):1, for example, 4:1; And / or, the grinding time is 1-3 hours, for example 2 hours; And / or, the calcination satisfies one or more of the following conditions ①-④: ①The calcination is carried out in a tube furnace; ② The calcination temperature is 300-500℃, for example 400℃; ③ The calcination is carried out under an inert atmosphere, such as an argon atmosphere; ④ The calcination time is 0.5-3 hours, for example, 1 hour; And / or, the cerium oxide has a particle size of 50-150 nm, preferably 50 nm.

6. A modified piezoelectric material, characterized in that, It is prepared using the method for preparing modified piezoelectric materials as described in any one of claims 3-5.

7. A composite material, characterized in that, It includes modified piezoelectric materials and biomimetic bone materials as described in any one of claims 1, 2 and 6.

8. The composite material according to claim 7, characterized in that, The biomimetic bone material is one or more of polyetherketoneketone, polyimide, polyethylene, polypropylene, polycaprolactone, and polylactic acid, preferably polyetherketoneketone; And / or, in the composite material, the volume ratio of the modified piezoelectric material is 10%-50%, for example 40%, where the percentage is the percentage of the volume of the modified piezoelectric material to the total volume of the composite material.

9. A method for preparing the composite material as described in claim 7 or 8, characterized in that, It includes: The mixture comprising the modified piezoelectric material and the biomimetic bone material is calcined to obtain the final product. Preferably, the calcination satisfies one or more of the following conditions ①-⑥: ①The calcination is carried out in a tube furnace; ② The calcination temperature is 300-500℃, for example 315℃ or 400℃; ③ The calcination is carried out under an inert atmosphere, such as an argon atmosphere; ④ The calcination time is 1-3 hours, for example, 2 hours; ⑤ The process before calcination also includes a forming step; wherein, the forming is preferably compression molding; ⑥ After calcination, the process also includes grinding, cleaning, and drying.

10. The use of a modified piezoelectric material as described in any one of claims 1, 2 and 6 or a composite material as described in claim 7 or 8 in the preparation of a medicament for treating infected bone defects.

Images