Preparation method and application of potatoes with low glycoalkaloid content
By using CRISPR/Cas9 gene editing technology to specifically edit the StSSR2 gene in potatoes, the problem of high glycoalkaloid content in existing technologies has been solved, enabling the preparation of potatoes with low glycoalkaloid content, thus improving food safety and storage efficiency.
Patent Information
- Application Number
- CN202510860565.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-25
- Publication Date
- 2025-10-31
AI Technical Summary
Existing technologies are insufficient to effectively reduce the content of glycoalkaloids in potatoes. Conventional breeding, mutation breeding, and gene editing technologies are either inefficient or complex to operate and cannot meet international food safety standards.
Using CRISPR/Cas9 gene editing technology, recombinant plasmids containing specific gRNA and Cas9 protein were constructed, and Agrobacterium-mediated transformation was used to achieve site-specific editing of the StSSR2 gene in potato callus tissue, thereby reducing the content of glycoalkaloids.
It significantly reduces the content of glycoalkaloids in potato leaves, meeting international food safety standards, extending shelf life, reducing production costs, and driving changes in storage methods.
Smart Images

Figure CN120866313A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant breeding technology, specifically relating to a method for preparing potatoes with low glycoside alkaloid content and its application. Background Technology
[0002] Potatoes (Solanum tuberosum L.), as one of the world's major crops, provide humans with energy and nutrients, including carbohydrates, proteins, and vitamins. However, potatoes also contain some toxic substances, the most important of which are glycoalkaloids (SGAs). SGAs are nitrogenous secondary metabolites naturally produced in several Solanaceae plants, such as eggplant (Solanum melongea), tomato (Solanum lycopersicum), and potato. In potato tubers, approximately 95% of SGAs are α-theophylline and α-solanine. SGAs possess antibacterial and antiviral activity, antifungal activity, and insect resistance in potato production. Low concentrations of SGAs in prepared potato products can produce desirable flavors, but when the concentration of SGAs in potato tubers exceeds 200 mg / kg fresh weight (FW), SGAs become toxic to humans. The study found that the food safety standard of SGAs is 20mg / 100g FW (EFSA CONTAM Panel (EFSA Panel on Contaminants in the Food Chain), Schrenk D, Bignami M, Bodin L, Chipman JK, del Mazo J, Hogstrand C, Hoogenboom LR, Leblanc JC, Nebbia CS, Nielsen E, Ntzani E, Petersen A, Sand S, Schwerdtle T, Vleminckx C, Wallace H, Brimer L, Cottrill B, Dusemund B, Mulder P, Vollmer G, Binaglia M, Ramos Bordajandi L, Riolo F, Roldán-Torres R and Grasl-Kraupp B, 2020. Scientific Opinion–Risk assessment of glycoalkaloids in feedand food,in particular in potatoes and potato-derived products.EFSAJournal2020;18(8):6222,190pp.https: / / doi.org / 10.2903 / j.efsa.2020.6222).
[0003] The commonly used potato cultivation techniques currently include the following:
[0004] (1) Conventional breeding: Conventional breeding lacks low SGAs-specific potato resources, and cultivated potato varieties are usually autotetraploids with highly heterozygous genomes. Therefore, it is difficult to create target trait resources using traditional hybridization breeding methods.
[0005] (2) Mutation breeding: Mutation breeding is highly random. Cultivated potatoes are mostly propagated asexually, so the efficiency of mutation breeding is extremely low. It is difficult to obtain homozygous recessive mutation sites and it is impossible to obtain the target trait.
[0006] (3) Gene-specific editing technology: Zinc finger nuclease (ZFN) and TALEN genome editing technology can change the natural genome sequence of plants by precisely editing the DNA sequence. However, ZFN and TALEN technologies are complex, difficult to operate, and have limited mutation efficiency, so they are rarely used.
[0007] (4) Chimerism of regenerated plants: Most of the regenerated plants are chimeras, and the recessive mutant phenotype is difficult to be fully expressed, resulting in insignificant changes in the target traits of the created resources.
[0008] The CRISPR system is a single-guided RNA-mediated nuclease system. It guides the Cas9 protein to a specific cleavage site by base pairing a specific CRISPR sequence with the target sequence. Repair is then achieved through intracellular repair mechanisms such as HDR (Highly Adaptive Hypergenetic Extraction) or NHEJ (Neuro-Highly Adaptive Hypergenetic Extraction), with NHEJ repair being the predominant method. NHEJ repair may result in small insertions, deletions, and substitutions, thus achieving gene editing. CRISPR technology can precisely identify and cut target DNA sequences with high specificity, enabling gene editing in large numbers of cells in a short time. It can be applied to various organisms and, compared to ZFN and TALEN editing technologies, is simpler to operate, more efficient, and relatively cheaper.
[0009] Zheng et al. (2021). Editing sterol side chain reductase 2 gene (StSSR2) via CRISPR / Cas9 reduces the total steroidal glycoalkaloids in potato. All Life, 14(1), 401–413. https: / / doi.org / 10.1080 / 26895293.2021.1925358) obtained potato leaves with SGAs concentration of 44% of WT level by editing the sterol side chain reductase 2 gene (StSSR2) via CRISPR / Cas9. The SGAs content in potatoes obtained by this method still exceeded the international food safety standard (20 mg / 100g FW). Therefore, developing a method to significantly reduce the SGAs content in potatoes is of great significance for potato breeding and food safety. Summary of the Invention
[0010] In order to solve the above-mentioned problems in the existing technology, the purpose of this invention is to provide a method for preparing potatoes with low glycoside alkaloid content and its application.
[0011] To achieve the above objectives, the present invention adopts the following technical solution:
[0012] The present invention provides a gene fragment set, which consists of a gene fragment with a nucleotide sequence as shown in SEQ ID No. 1 and a gene fragment with a nucleotide sequence as shown in SEQ ID No. 2.
[0013] The present invention also provides a recombinant plasmid comprising the above-mentioned gene fragment group.
[0014] Furthermore, the resistance marker gene of the recombinant plasmid is a hygromycin gene, and the promoter of the resistance marker gene is the CaMV35S promoter.
[0015] Furthermore, the promoter of the gene fragment group is the Arabidopsis thaliana U6 promoter AtU6.
[0016] Furthermore, the recombinant plasmid contains a gene encoding the Cas9 protein; the promoter of the Cas9 is the maize promoter Ubi.
[0017] The present invention also provides a recombinant bacterium, which is obtained by transforming the above-mentioned recombinant plasmid into Agrobacterium.
[0018] Furthermore, the transfer is performed via electroporation or freeze-thaw transfer.
[0019] The present invention also provides a method for preparing potatoes with low glycoside alkaloid content, wherein the preparation method is obtained by transforming the above-mentioned recombinant bacteria with potato callus tissue by Agrobacterium tumefaciens transformation.
[0020] Furthermore, the potato variety is Atlantic.
[0021] This invention also provides the application of the preparation method in potato breeding.
[0022] The present invention has achieved the following beneficial effects:
[0023] This invention provides a method for preparing potatoes with low glycoside alkaloid content. The new potato resource obtained according to this invention has low SGA content in its leaves, making it suitable for edible or feed use and improving the overall utilization efficiency of the entire potato plant. It is well known to those skilled in the art that, generally, the SGA content in potato leaves is much higher than in tubers, and the SGA content in the green potato peel is comparable to that in the leaves. Therefore, it can be inferred that the SGA content in the tubers of the potato provided by this invention is extremely low, and the SGA content after exposure to light and sprouting is lower than international food safety standards. The method of this invention will significantly extend the shelf life of fresh potatoes, ensuring food safety; at the same time, it will promote a revolution in storage methods, allowing potatoes to be stored at room temperature without being protected from light, significantly reducing energy consumption and production costs, and possessing good application prospects.
[0024] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0025] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0026] Figure 1 A schematic diagram of the CRISPR / Cas9 vector for site-directed mutagenesis of the StSSR2 gene.
[0027] Figure 2 Analysis of CRISPR / Cas9-mediated StSSR2 gene editing types. WT: wild-type potato; -: base knockout; +: gene insertion; >: base substitution. Detailed Implementation
[0028] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0029] The following experiments, where no temperature is specified, are reactions conducted under normal temperature conditions, which is room temperature, or 25±5℃.
[0030] Example 1: Preparation of potatoes with low glycoside alkaloid content
[0031] I. Construction of Transgenic Potatoes
[0032] 1. Carrier Construction
[0033] Following the instructions of the Plant Cas9 / gRNA Plasmid Construction Kit (Catalog. No. VK005-14) from Beijing Weishang Lide Biotechnology Co., Ltd., the gRNA1 and gRNA2 sequences were inserted into the Cas9 / gRNA plasmid, resulting in the structure shown below. Figure 1 The carrier shown.
[0034] AtU6: The Arabidopsis U6 promoter drives the transcription of gRNA1 and gRNA2;
[0035] Ubi: Corn-based starter, driving dpCas9;
[0036] 35S: The CaMV35S promoter drives the expression of hygromycin (Hyg) resistance markers;
[0037] RB: Right boundary of T-DNA;
[0038] LB: Left border of T-DNA.
[0039] gRNA1 (SEQ ID No.1): ACGATGAGAATGTTAAAGAGG
[0040] gRNA2 (SEQ ID No. 2): AGGATGGTCTTGTCTGCACGG
[0041] 2. Construction of transgenic potatoes
[0042] Using the Atlantic potato variety (DXY) as the transformation recipient material (i.e. wild-type potato), transgenic potato plants were obtained by Agrobacterium-mediated transformation using the vector constructed above.
[0043] Figure 2 The experimental results show that the CRISPR / Cas9 multiple gRNA system constructed in this invention can effectively edit the StSSR2 gene in potato and achieve site-directed mutation.
[0044] Construction of gene-edited lines with mutations in all four StSSR2 alleles.
[0045] The above-mentioned transgenic potato plants were planted in a greenhouse, and through two generations of self-pollination, two gene-edited lines (-7bp) with mutations in all four alleles of the StSSR2 gene were obtained from the T2 generation self-pollination population.
[0046] II. Detection of SGAs Content in Genetically Modified Potatoes
[0047] The content of glycoalkaloids (SGAs) in the leaves of the two gene-edited lines was detected by liquid chromatography-mass spectrometry (LC-MS / LC). The SGA content in the leaves of one line was 3.4 mg / 100g FW, and the SGA content in the leaves of the other line was 5.4 mg / 100g FW. The SGA content in the leaves of the transgenic recipient material Atlantic (DXY) was 488.6 mg / 100g FW.
[0048] The above results indicate that the present invention provides a new potato resource with significantly reduced SGAs content, and the SGAs content in the leaves is significantly lower than the potato food safety standard of 20 mg / 100g FW, providing a valuable resource for the development and utilization of the whole potato plant.
[0049] In summary, this invention provides a method for preparing potatoes with low SGA content. The new potato resource with low SGA content obtained according to this invention has low SGA content in its leaves, making it suitable for edible or feed use and improving the overall utilization efficiency of the entire potato plant. The method of this invention will significantly extend the shelf life of fresh potatoes, ensuring food safety; simultaneously, it will drive changes in storage methods, allowing potatoes to be stored at room temperature without being protected from light, greatly reducing energy consumption and production costs, and possessing promising application prospects.
Claims
1. A gene fragment set, comprising a gene fragment with a nucleotide sequence as shown in SEQ ID No. 1 and a gene fragment with a nucleotide sequence as shown in SEQ ID No.
2.
2. A recombinant plasmid, characterized in that, The recombinant plasmid comprises the gene fragment group described in claim 1.
3. The recombinant plasmid according to claim 2, characterized in that, The resistance marker gene of the recombinant plasmid is the hygromycin gene, and the promoter of the resistance marker gene is the CaMV35S promoter.
4. The recombinant plasmid according to claim 2, characterized in that, The promoter of the gene fragment group is the Arabidopsis thaliana U6 promoter AtU6.
5. The recombinant plasmid according to claim 2, characterized in that, The recombinant plasmid contains a gene encoding the Cas9 protein; the promoter of the Cas9 is the maize promoter Ubi.
6. A recombinant bacterium, said recombinant bacterium is obtained by transforming the recombinant plasmid of any one of claims 2 to 5 into Agrobacterium.
7. The recombinant bacteria according to claim 6, characterized in that, The transfer is performed by electroporation or freeze-thaw.
8. A method for preparing potatoes with low glycoside alkaloid content, characterized in that, The preparation method is to prepare the recombinant bacteria of claim 6 or 7 and potato callus by Agrobacterium transformation.
9. The preparation method according to claim 8, characterized in that, The potato variety mentioned is Atlantic.
10. The application of the preparation method according to claim 8 or 9 in potato breeding.