Rice essential gene ELD1 and application thereof in aspect of adjusting heading period

By cloning and manipulating the rice gene ELD1, and using CRISPR cytosine base editor and RNA interference technology to regulate the heading date of rice, the problem of delayed heading date in high-latitude rice varieties was solved, achieving early heading and high yield.

CN120866337APending Publication Date: 2025-10-31NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510556962.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

When existing rice varieties are introduced to high-latitude regions, the heading period is delayed, leading to an earlier arrival of cold air and preventing normal grain filling, resulting in a decrease in yield and quality. Furthermore, when introduced to low-latitude regions, the heading period is shortened, wasting light and temperature resources and causing a decrease in yield.

Method used

By cloning and manipulating the essential rice gene ELD1, the heading time of rice was regulated using CRISPR cytosine base editor and RNA interference technology, including the construction of interference vectors and targeted editing vectors, to achieve targeted editing and expression regulation of ELD1 protein.

Benefits of technology

New heading date materials were successfully created, enabling superior varieties to head earlier in high-latitude regions, reducing the risk of cold stress, maintaining high yields, and providing strategies for variety promotion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866337A_ABST
    Figure CN120866337A_ABST
Patent Text Reader

Abstract

The invention discloses a rice essential gene ELD1 and application of the rice essential gene ELD1 in the aspect of adjusting the heading period. A new gene ELD1 for regulating and controlling the heading stage of rice is cloned through a forward genetics means. The ELD1 has the effect of inhibiting rice heading under the long-day condition, and early heading is caused by amino acid mutation. Although ELD1 knockout homozygosis causes embryo lethal, the yield of a plot is only reduced by 5.9% and the daily average yield is not obviously changed under the condition that the eld1 mutant is 10 days early in heading. According to the invention, directed evolution of the ELD1 is successfully realized by using a CRISPR-based cytosine base editor, a new heading stage material is created, and it is indicated that application of the ELD1 to rice heading stage breeding is feasible. Therefore, the invention provides a valuable target spot for regulating and controlling the heading period of the rice so as to improve the regional adaptability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to the application of regulating the heading stage of rice by manipulating the activity of a protein. Background Technology

[0002] The flowering time of rice, also known as the heading stage, is a crucial yield trait. It not only determines the seasonal and regional adaptability of a variety but also affects its utilization of natural light and temperature resources. Therefore, a suitable heading stage is a prerequisite for high, stable, and high-quality yields. The heading stage is a complex quantitative trait, controlled by both exogenous environmental signals and endogenous genetic background. Rice is a typical short-day, warm-season crop; under suitable temperature conditions, short days promote heading, while long days inhibit it. This characteristic of regulating the heading stage in response to photoperiod is also known as rice photoperiod sensitivity (PS). Rice photoperiod sensitivity significantly limits the promotion of varieties. When superior photosensitive varieties are introduced to high-latitude regions, the heading stage is often delayed, and the earlier arrival of cold air from the north can prevent normal grain filling and even heading, ultimately leading to a severe decline in yield and quality. Similarly, introducing varieties to low-latitude regions often shortens the heading stage, greatly wasting light and temperature resources and also resulting in a decrease in yield. Therefore, discovering and cloning new heading period genes and elucidating their mechanisms of action are of great theoretical significance and play an important role in guiding breeding practices, variety selection, and variety promotion. Summary of the Invention

[0003] To address the aforementioned technical problems in the existing technology, this invention provides an essential rice gene, ELD1, and its application in regulating heading date.

[0004] The first objective of this invention is to provide a gene ELD1 that regulates the heading stage of rice, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0005] A second object of the present invention is to provide a protein encoded by the gene ELD1, the amino sequence of which is shown in SEQ ID NO.2.

[0006] A third object of the present invention is to provide a mutant eld1 of the gene ELD1, whose nucleotide sequence differs from SEQ ID NO.1 by changing the base at position 116 from C to T. The nucleotide sequence of the mutant eld1 is shown in SEQ ID NO.10.

[0007] A fourth object of the present invention is to provide a protein sequence encoded by the mutant eld1, wherein the amino acid sequence is different from that in SEQ ID NO.2, the amino acid at position 39 is changed from proline to leucine. The amino acid sequence of the mutant eld1 is shown in SEQ ID NO.11.

[0008] A fifth object of the present invention is to provide the aforementioned RNA interference target, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0009] The interference target regulates the heading period of rice by reducing the expression level of ELD1.

[0010] The sixth objective of this invention is to provide an interference vector constructed based on the aforementioned target.

[0011] A seventh objective of this invention is to provide a gene ELD1 targeted editing target based on a CRISPR cytosine base editor, the sequence of which is shown in SEQ ID NO.4.

[0012] This invention also provides a method for restoring eld1 to wild type using the base editor ABE system, the base editing target sequence of which is shown in SEQ ID NO.5.

[0013] This invention also provides a method for regulating the heading stage of rice by using the base editor CBE system to directionally edit the ELD1 protein, the base editing target sequence of which is shown in SEQ ID NO.4.

[0014] The eighth object of the present invention is to provide a targeted editing vector constructed based on the aforementioned targets.

[0015] The ninth objective of this invention is to provide four alleles generated by targeted editing of ELD1 using the base editor CBE system, the nucleotide sequences of which are shown in SEQ ID NO.6-SEQ ID NO.9.

[0016] The tenth objective of this invention is to provide primer sequences for amplifying or knocking out the gene ELD1.

[0017] The knockout target primer sequence is:

[0018] ELD1-CR-F: GGCATGTTGTTCTCCGGGGCGTAG (SEQ ID NO. 20);

[0019] ELD1-CR-R: AAACCTACGCCCGGAGAACAACA (SEQ ID NO. 21);

[0020] The eleventh objective of this invention is to provide the application of the aforementioned mutant eld1, or the aforementioned protein sequence, or the aforementioned RNA interference target, or the aforementioned interference vector, or the aforementioned targeted editing target, or the aforementioned targeted editing vector, or the aforementioned allele, or the aforementioned primer sequence for knocking out the gene ELD1, in advancing the heading stage of rice.

[0021] Beneficial effects:

[0022] Because rice is a typical short-day plant, the heading period is usually delayed when superior varieties are introduced to high-latitude regions. Cold air masses tend to arrive earlier in high-latitude regions each year, increasing the risk of low-temperature stress for these varieties. Therefore, shortening the heading period is often necessary when cultivating superior varieties in high-latitude areas. This study cloned a novel gene, ELD1, that regulates the heading period of rice using forward genetics. Although homozygous ELD1 knockout leads to embryo lethality, the eld1 mutant, with a single amino acid change, survives and exhibits early heading. Compared to the wild type, the eld1 mutant, with a 10-day earlier heading, showed only a 5.9% reduction in plot yield and no significant change in average daily yield. Therefore, ELD1 may be a valuable target for regulating the heading period of rice to improve regional adaptability and yield. This invention also successfully achieved targeted editing of the ELD1 protein using a CRISPR cytosine base editor, creating new heading period materials and providing a new strategy for superior varieties to overcome cold stress and achieve high-yield potential when expanding to higher latitudes. Attached Figure Description

[0023] Figure 1 Phenotypic identification of eld1 mutants, including:

[0024] Figure 1 A shows the phenotypic figures of the eld1 mutant and wild type at the heading stage and the seed maturity 40 days after heading under field conditions in Nanjing.

[0025] Figure 1 B represents the heading date data for wild-type and mutant strains in Nanjing;

[0026] Figure 1 C represents the heading date data for wild-type and mutant strains in Hainan;

[0027] Figure 1 D、 Figure 1 E and Figure 1 F represents the expression level analysis of flowering-related genes Hd3a, RFT, and Ehd1.

[0028] Figure 2 A clone of ELD1, wherein:

[0029] Figure 2 A is a histogram showing the distribution of heading date frequency in the F2 population of eld1 and Ningjing 4 backcross;

[0030] Figure 2 B represents candidate genes for BSA analysis;

[0031] Figure 2 C represents the specific information of five SNPs that are highly associated with the early heading phenotype.

[0032] Figure 3 For the functional verification of ELD1, the following is included:

[0033] Figure 3 A and Figure 3 B represents the phenotypic diagrams and heading data of the wild type, mutant, and three complementary families under natural long-day conditions in Nanjing.

[0034] Figure 3 C represents the phenotypic identification of transgenic families that restored mutation sites to wild-type using the base editor ABE;

[0035] Figure 3 D and Figure 3 E represents the heading date data and sequencing identification near the edit site for the restored mutant family.

[0036] Figure 4 ELD1 knockout homozygous lethality, where:

[0037] Figure 4 A represents the editing type and genotypic segregation of the offspring in the knockout heterozygous family CR#1;

[0038] Figure 4 B represents the seed setting rate statistics for wild-type and knockout heterozygous family CR#1;

[0039] Figure 4 C represents pollen staining to observe pollen viability in wild-type and knockout heterozygous families CR#1. Figure 4 D represents the phenotypic diagram of the wild type and three independent disturbance families; Figure 4 E represents the heading date of the wild type and three independent disturbance families; Figure 4 F represents the ELD1 transcriptional levels in wild-type and three independent interference families.

[0040] Figure 5 The investigation focused on agronomic traits (Nanjing), including:

[0041] Figure 5 A represents the statistical analysis of agronomic traits in wild-type, eld1 mutant, and three disturbance families;

[0042] Figure 5 B represents the field phenotype of wild type and eld1 mutant;

[0043] Figure 5 C represents the yield statistics for wild-type and eld1 mutant plots;

[0044] Figure 5 D represents the daily average yield statistics for wild type and eld1 mutant.

[0045] Figure 6 To edit ELD1 using the base editor, where:

[0046] Figure 6 A represents the phenotype at the heading stage of the wild type and four directional edited families;

[0047] Figure 6 B represents heading date data for the wild type and four directional edited families;

[0048] Figure 6 C represents the editing method for four targeted edited families near the target site. Detailed Implementation

[0049] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0050] Example 1: Identification of the eld1 mutant

[0051] This invention uses the japonica rice variety "Ningjing 4" as a background and screens an early heading mutant through EMS (ethyl methanesulfonate) mutagenesis, which is named eld1 (early in long day 1). The mutant eld1 heads approximately 10 days earlier than the wild type under natural long-day conditions in Nanjing, but shows no obvious phenotype under natural short-day conditions in Hainan. Figure 1 A-1C). Quantitative analysis of flowering-related genes using specific primers revealed that three genes promoting rice flowering—Hd3a, RFT, and Ehd1—were upregulated to varying degrees in the eld1 mutant. Figure 1 D-1F).

[0052] The method for detecting the expression levels of flowering-related genes by RT-qPCR is as follows:

[0053] (1) Extraction and reverse transcription of total RNA from plants

[0054] RNA samples were collected from leaf tissues 40 days before flowering under artificial long-day conditions (14 hours light, 10 hours darkness). RNA was extracted using the Plant Total RNA Extraction Kit (DP432) from Beijing Tiangen Biotech Co., Ltd. 1 μg of total RNA was taken and reversed using the Takara Reverse Transcription Kit (RR036A) to generate 20 μl of cDNA stock solution. The stock solution was diluted 10-fold to prepare the working solution and stored at -20℃ for later use.

[0055] (2) Real-time PCR analysis

[0056] The real-time PCR instrument used was the ABI 7500 quantitative PCR system (Applied Biosystems). The reagent was TB Green Premix Ex Taq II (Tli RNaseH Plus) premix solution from Takara Bio.

[0057] PCR system (20 μl):

[0058]

[0059] PCR program: 95℃, 30s; 95℃, 5s; 60℃, 34s; 39 cycles to step two; melting curve from 65℃ to 95℃. Each experimental group had three biological replicates and three technical replicates. The rice UBQ gene was used as an internal control gene, and the quantitative primers were as follows:

[0060] RT-Hd3a-F:GCTCACTATCATCATCCAGCATG (SEQ ID NO. 12);

[0061] RT-Hd3a-R: CCTTGCTCAGCTATTTAATTGCATAA (SEQ ID NO. 13);

[0062] RT-RFT-F:TGACCTAGATTCAAAGTCTAATCCTT (SEQ ID NO. 14);

[0063] RT-RFT-R: TGCCGGCCATGTCAAATTAATAAC (SEQ ID NO. 15);

[0064] RT-Ehd1-F: CCTACAGTGATTATGGCTTCA (SEQ ID NO. 16);

[0065] RT-Ehd1-R:GTGCTGCCAAATGTTGCTC (SEQ ID NO. 17).

[0066] Example 2: BSA analysis of candidate genes

[0067] The eld1 mutant was crossed with the wild-type "Ningjing 4" to construct an F2 segregating population. An investigation of the heading date in the F2 population revealed that the ratio of early-heading plants to normal-heading plants was approximately 1:3 (χ2=0.193, P>0.05). Figure 2A). In the F2 population, 30 early-heading extreme individuals and 30 late-heading extreme individuals were selected to construct early-flowering mixed ponds and late-flowering mixed ponds, respectively. 0.1g of fresh leaves were collected from each extreme individual, totaling 3g per mixed pond. After quick-freezing in liquid nitrogen and thorough grinding, genomic DNA was extracted from each mixed pond using the CTAB method. Second-generation whole-genome sequencing was performed on each mixed pond, with the sequencing data exceeding 8G per pond. The sequencing data were then mapped to the rice reference genome (IRGSP4.0) to analyze mutation sites highly associated with the early-heading phenotype. According to the rice MSU-RGAP reference genome annotation, 5 SNPs were located on 2 retrotransposons and 3 expressed proteins. One SNP occurred in the coding region of the gene LOC_Os09g01640, where the 116th base of its CDS sequence was mutated from C to T, resulting in a mutation of proline to leucine at the 39th amino acid of its encoded protein. This gene was selected as a candidate gene. Figure 2 B and 2C). The nucleotide sequence of the gene ELD1 in the japonica rice variety “Ningjing 4” is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, the amino acid sequence of the mutant eld1 is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12.

[0068] Genomic DNA was extracted using the CTAB method. The specific steps are as follows:

[0069] 1. A total of 3g of fresh leaves were collected from each mixing tank. After being flash-frozen in liquid nitrogen, the leaves were ground into powder using a mortar and pestle and collected in 50ml centrifuge tubes.

[0070] 2. Add 5 mL of CTAB extraction solution and incubate in a 65°C water bath for 30 min.

[0071] 3. Add 5 mL of chloroform:isoamyl alcohol (24:1), mix thoroughly by inverting, and let stand for 5 minutes.

[0072] 4. Centrifuge at 8000 rpm for 10 min (4℃).

[0073] 5. Transfer the supernatant to a new 50mL centrifuge tube, add 0.7 times the volume of the supernatant in isopropanol, mix well, and incubate at -20℃ for at least 1 hour.

[0074] 6. Centrifuge at 8000 rpm for 10 min (4℃) and discard the supernatant.

[0075] 7. Wash the precipitate twice with 75% ethanol and then let it air dry.

[0076] 8. Dissolve the DNA precipitate in 500 μL of double-distilled water and store at -20℃ until needed.

[0077] Example 3: Functional Verification of ELD1

[0078] To verify that a single amino acid change in the LOC_Os09g01640 gene is the cause of early heading in the eld1 mutant, a 4.5 kb LOC_Os09g01640 genome sequence was amplified using the wild-type 'Ningjing 4' genome as a template. This sequence included a 2.3 kb promoter, a 1.4 kb transcript, and a 0.8 kb downstream sequence, and was cloned into the pCAMBIA 1390 vector. The constructed expression vector was transformed into the EHA105 strain, and the callus tissue of the eld1 mutant was infected using Agrobacterium-mediated transformation. After stable genetic transformation, transgenic plants were identified, and the heading date of positive plants was counted in the T1 generation. The heading date of positive families was found to be consistent with that of the wild type, proving that the mutation in LOC_Os09g01640 is the cause of early heading in the mutant. Figure 3 (A and 3B).

[0079] This invention also utilizes the CRISPR-based base editor ABE system to restore the mutation site. The base editing target sequence SEQ ID NO.5: TTGTTCTCCAGGGCGTAGGG was cloned into the pH-ABE8e-SpRY vector (the pH-ABE8e-SpRY vector was previously constructed by the applicant (Wang et al., Cell, 2023, DOI: 10.1016 / j.cell.2023.06.023), which has the ability to accurately and efficiently edit A>G at atypical PAM sites). After stable genetic transformation, when the mutation site is restored to the wild type, i.e., the sequence shown in SEQ ID NO.1, the heading date is consistent with the wild type. Figure 3 C-3E).

[0080] The primers for constructing the complementary vector are as follows:

[0081] 1390-ELD1-F:CCGGCGCGCCAAGCTTGGGGAACAATATGTAGGTCG (SEQ ID NO. 18);

[0082] 1390-ELD1-R:GAATTCCCGGGGATCCTTCTGGTCAACAAGGAACAC (SEQ ID NO. 19).

[0083] Transformation of competent cells in Escherichia coli

[0084] The ligation product was transformed into competent E. coli (DH5α) cells using a heat shock method. The basic steps are as follows:

[0085] (1) Take 10 μL of the ligation product and transfer it into 50 μL of Escherichia coli competent cells DH5α. Incubate on ice for 30 min, heat shock at 42℃ for 60 s, and place on ice for 2 min to terminate the heat shock reaction.

[0086] (2) Add 800 μL of antibiotic-free LB liquid culture medium to a clean bench and place it in a shaker (set program: 37℃, 250 rpm) for about 1 hour to recover.

[0087] (3) Spread the bacterial culture evenly on LB solid medium containing kanamycin resistance, seal the plate with sealing film and invert it in an incubator at 37°C overnight.

[0088] (4) After the bacteria have grown, single clones are picked in a clean bench for PCR identification and sequencing detection.

[0089] Transformation of Agrobacterium-competent cells

[0090] The plasmid was transformed into Agrobacterium competent cells (EHA105). The basic steps are as follows:

[0091] (1) Take 1 μg of plasmid and add it to 50 μL of Agrobacterium EHA105. Then, in the following order, add liquid nitrogen for 5 min, water bath at 37℃ for 5 min, and ice bath for 5 min.

[0092] (2) Add 800 μL of antibiotic-free LB liquid culture medium and place it in a shaker (program settings: 28℃, 220 rpm) for about 2 hours to recover.

[0093] (3) Spread the bacterial culture evenly on LB solid medium containing kanamycin and rifampicin resistance, seal the plate with sealing film, and invert it in an incubator at 28°C for about 2 days.

[0094] (4) After the bacteria have grown, select a single clone for PCR identification.

[0095] Example 4: ELD1 knockout homozygous lethality; interference resulted in early heading.

[0096] This invention designs sgRNAs based on gene sequences in the rice genome database using the CRISPR-P online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). Highly specific sgRNAs located in the CDS region are selected. The knockout primer design principle is as follows: the knockout F primer is an sgRNA sequence with 'GGCA' added to the 5' end; the knockout R primer is an sgRNA sequence with reverse complementation and 'AAAC' added to the 5' end.

[0097] Stable genetic transformation failed to identify a homozygous knockout family in the T0 generation. The heterozygous knockout family CR#1 had one allele identical to the wild type, but the other allele had a one-base insertion at the knockout target site, causing a frameshift and premature termination of the encoded protein. Genotyping of the CR#1 line progeny using first-generation sequencing revealed 30 wild-type and 65 heterozygous progeny out of 95 progeny; a homozygous knockout line was not obtained. Figure 4 A). The pollen viability of the CR#1 strain was normal, but the seed setting rate was only 71.7%, compared to 92.5% for the wild type. Figure 4 B-4C).

[0098] These results indicate that ELD1 is an essential gene, and knockout of homozygous ELD1 leads to embryonic lethality.

[0099] This invention also utilizes RNA interference technology to obtain transgenic plants with ELD1 transcriptional knockdown. The specific interference sequence is shown in SEQ ID NO.3:

[0100] CGGAGAACAACAAGCACCAGCCTCCCTCCTCCTCCGTCTCCGCCAACGCCGCCGCCGCC

[0101] AACGCCGCCGCCGCATCCGCCCCATCCGCCTCCGCTCCTTCCTCCTCCTCCGCCCGCC

[0102] TCCTCCGACAACGCCTATACCAGCTTCCAGGGCCTCCTCGCGCTCGCCCGCATCACCGG

[0103] CTCCAACTCCGACGAGACCCGCGGCGCCTGCAGGAAGTGCGGCCGCGTCGGCCACCTCACCTTCCAGTG.

[0104] Compared to the wild type, the ELD1 transcription levels in the three independent interference families were reduced by 94%-70%, and the heading date was advanced by about 5-10 days. Figure 4 D-4F).

[0105] The primer sequences for knocking out the target site are as follows:

[0106] ELD1-CR-F: GGCATGTTGTTCTCCGGGGCGTAG (SEQ ID NO. 20);

[0107] ELD1-CR-R: AAACCTACGCCCGGAGAACAACA (SEQ ID NO. 21);

[0108] The primers for ELD1 knockout identification are as follows:

[0109] ELD1-CRYZ-F:ACCCTCGATCCAAAATCCCCAA (SEQ ID NO. 22);

[0110] ELD1-CRYZ-R:GAAGTTGCGGCACTGGAAGGT (SEQ ID NO. 23);

[0111] The primers for constructing the interference vector are as follows:

[0112] ELD1-RNAI-BamH1F:CGTAGTCGACGGATCCTTCCTCTGATTCGGACATCGA(SEQ IDNO.24);

[0113] ELD1-RNAI-BamH1R: GAATTCCCGGGGATCCTGTCCTTGCTCCTCTCTTCCTC (SEQ IDNO.25);

[0114] ELD1-RNAI-Kpn1F: TTACTTCTGCACTAGGTACCTGTCCTTGCTCCTCTCTTCCTC (SEQ IDNO.26);

[0115] ELD1-RNAI-Kpn1R: TAGAGCTCAGGCCTGGTACCTTCCTCTGATTCGGACATCGA (SEQ ID NO. 27);

[0116] The ELD1 quantitative primers are as follows:

[0117] RT-ELD1-F: GGAGCACCAAGAGGAGTGAT (SEQ ID NO. 28);

[0118] RT-ELD1-R: ACTCTCCGTGTCCTCATCTG (SEQ ID NO. 29).

[0119] Example 5: Investigation of agronomic traits

[0120] To test the potential value of ELD1 in rice breeding, this invention investigated the agronomic traits of wild-type rice, the eld1 mutant constructed in Example 1, and three RNA interference families established in Example 4 under field conditions in Nanjing. Compared to the wild-type, the eld1 mutant and interference families showed no change in seed setting rate, but significantly reduced plant height and number of grains per panicle, while significantly increasing grain length and thousand-grain weight. Figure 5A). Yield measurements revealed that even with 10 days of earlier heading, the final yield of the eld1 plot decreased by only 5.9% ( Figure 5 B).

[0121] When analyzing agronomic traits, 10 individual plants were randomly selected from each genotype.

[0122] When determining the yield of each plot, six plots were planted for each genotype, with 20 plants in each plot.

[0123] Example 6: Base Editor Directed Editing of ELD1

[0124] To explore the feasibility of applying the ELD1 gene to rice breeding, this invention utilizes a CRISPR-based cytosine base editor (CBE) to directionally edit the ELD1 protein in wild-type rice. The base editing target sequence is shown in SEQ ID NO.4: CCCTACGCCCCGGAGAACAA. The sgRNA covering the ELD1 mutation site was cloned into the pH-A3A-CBE-SpRY vector to construct the directionally edited vector. The pH-A3A-CBE-SpRY vector was modified by introducing a point mutation (Walton et al., science, 2020, DOI:10.1126 / science.aba8853) into the pH-A3A-PBE vector (Zong et al., Nature Biotechnology, 2018, DOI:10.1038 / nbt.4261) into the Cas9 PAM-less variant SpRY, enabling it to recognize atypical PAMs.

[0125] Through genetic transformation, four transgenic families CBE#2-CBE#5 with different editing types were identified. The nucleotide sequences of their ELD1 gene are shown in SEQ ID NO.6 to SEQ ID NO.9, respectively, resulting in two types of amino acid variations.

[0126] Four transgenic families exhibited phenotypes similar to the eld1 mutant, with earlier heading date and normal seed setting rate. Figure 6 (A-6C). Therefore, manipulating ELD1 activity holds promise for improving crops and providing new insights into the function of essential genes.

[0127] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0128] SEQ ID NO.1

[0129]

[0130] SEQ ID NO.2

[0131] MPATAGRVRMPANNRVHSSAALQTHGIWQSAIGYDPYAPENNKHQPPSSSVSANAAAANAAAASAPSASAPSSSAAASSDNAYTSFQGLLALARITGSNSDETRGACRKCGRVGHLTFQCRNFLSVKEDLDMEDDIDAGIRAASQANAQAKLDEFRKKTSGGKDADEGSDDEDEDDEEDSDDSSDSDSDSPELERIIAERERAKSGRKHSRDEEKKTSRHRSSSRGRSKHRRSTKRSDTEDDLEEERSKDKKKKSRRKRRHERSDEDSESDSDKKRHRKSRKDRKRRRSHRRSDDTSDEDESGGEDRRRRHRKRQHHHRKGASDGDSGSGASDSADRKRSRRRHRKSESSGSDGDERHGQGAKRSKEKRGKEEC

[0132]

[0133] SEQ ID NO.7

[0134]

[0135] SEQ ID NO.8

[0136]

[0137] SEQ ID NO.9

[0138]

[0139] SEQ ID NO.10

[0140]

[0141] SEQ ID NO.11

[0142] MPATAGRVRMPANNRVHSSAALQTHGIWQSAIGYDPYALENNKHQPPSSSVSANAAAANAAAASAPSASAPSSSAAASSDNAYTSFQGLLALARITGSNSDETRGACRKCGRVGHLTFQCRNFLSVKEDLDMEDDIDAGIRAASQANAQAKLDEFRKKTSGGKDADEGSDDEDEDDEEDSDDSSDSDSDSPELERIIAERERAKSGRKHSRDEEKKTSRHRSSSRGRSKHRRSTKRSDTEDDLEEERSKDKKKKSRRKRRHERSDEDSESDSDKKRHRKSRKDRKRRRSHRRSDDTSDEDESGGEDRRRRHRKRQHHHRKGASDGDSGSGASDADDRKRSRRRHRKSESSGSDGDERHGQGAKRSKEKRGKEEC

Claims

1. A gene ELD1 that regulates the heading date of rice, characterized in that, The nucleotide sequence of the gene ELD1 is shown in SEQ ID NO.

1.

2. The protein encoded by the gene ELD1 according to claim 1, characterized in that, The amino sequence of the protein encoded by the gene ELD1 is shown in SEQ ID NO.

2.

3. The mutant eld1 of the gene ELD1 according to claim 1, characterized in that, Compared to SEQ ID NO.1, the base at position 116 of this nucleotide sequence is changed from C to T.

4. The protein sequence encoded by the mutant eld1 according to claim 3, characterized in that, Compared to SEQ ID NO.2, the amino acid at position 39 of this sequence is changed from proline to leucine.

5. The RNA interference target according to claim 1, characterized in that, The nucleotide sequence of the RNA interference target is shown in SEQ ID NO.

3.

6. An interfering vector constructed based on the target described in claim 5.

7. A gene ELD1 targeted editing target based on a CRISPR cytosine base editor, characterized in that, The targeted editing sequence is shown in SEQ ID NO.

4.

8. A directional editing vector constructed based on the target described in claim 7.

9. The allele generated by targeted editing of ELD1 using the gene ELD1 targeted editing target as described in claim 7, characterized in that, The nucleotide sequence of the allele is one of SEQ ID NO.6-SEQ ID NO.

9.

10. Primer sequences for amplifying or knocking out the gene ELD1 of claim 1.

11. The application of the mutant eld1 of claim 3, the protein sequence of claim 4, the RNA interference target of claim 5, the interference vector of claim 6, the targeted editing target of claim 7, the targeted editing vector of claim 8, the allele of claim 9, or the primer sequence for knocking out gene ELD1 of claim 10 in advancing the heading stage of rice.