Cotton verticillium wilt resistance gene Gbar4CL1 and application thereof

By identifying and overexpressing the cotton Verticillium wilt resistance gene Gbar_4CL1, the problem of lack of resistance to cotton Verticillium wilt was solved, the disease resistance of cotton was significantly improved, and the breeding of highly resistant cotton varieties was promoted.

CN120866348APending Publication Date: 2025-10-31HUAZHONG AGRI UNIV +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511099155.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-08-26
Filing Date
2025-09-22
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

The lack of effective resistance genes for cotton Verticillium wilt in existing technologies leads to severe cotton Verticillium wilt disease, reducing fiber yield and quality. Physical, chemical and biological control methods can only temporarily control the spread of the disease, and there is a lack of germplasm and genes for highly resistant cotton varieties.

Method used

The disease resistance gene Gbar_4CL1 carried by cotton material M34 resistant to Verticillium wilt was discovered and identified. Map-based cloning technology confirmed that it regulates cotton resistance to Verticillium wilt. Overexpression of this gene in cotton significantly improved cotton resistance to Verticillium wilt.

Benefits of technology

It significantly improves cotton's resistance to Verticillium wilt, showing fewer symptoms and a lower disease index, providing a theoretical basis and material support for the breeding of highly resistant cotton varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866348A_ABST
    Figure CN120866348A_ABST
Patent Text Reader

Abstract

The invention relates to a verticillium wilt resistance gene Gbar4CL1 of cotton and application of the verticillium wilt resistance gene Gbar4CL1. The gene of a cotton verticillium wilt resistance material M34 is subjected to map-based cloning, the cotton verticillium wilt resistance gene Gbar4CL1 is identified for the first time, the Gbar4CL1 gene is proved to be highly expressed after being induced by verticillium wilt, and further the gene is over-expressed in cotton to verify that the gene can obviously enhance the verticillium wilt resistance of the cotton, so that the cotton verticillium wilt resistance of the cotton can be obviously enhanced. The gene has important value for theoretical researches such as analysis of molecular mechanisms of cotton verticillium wilt resistance and the like. The Gbar4CL1 gene can improve the resistance of cotton to verticillium wilt, and has important practical application significance for cotton verticillium wilt resistant breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a cotton Verticillium wilt resistance gene Gbar_4CL1 and its application. Background Technology

[0002] Cotton is an important economic crop, providing essential natural fiber raw materials for the textile industry and playing a vital role in national defense, medicine, and the automotive industry, thus holding an irreplaceable position in national economic development. The discovery of cotton Verticillium wilt can be traced back to the early 19th century in the United States, and since then, cotton-producing regions worldwide have suffered greatly from it. In my country, the earliest Verticillium wilt pathogen was discovered in introduced American cottonseed varieties, and its spread was exacerbated by introduction and breeding programs in various regions. According to precise statistics from plant protection departments, the disease has completely covered all cotton-producing areas in my country, with the northern cotton-producing regions suffering the most severe economic losses.

[0003] Verticillium wilt, often called the "cancer" of cotton, is present in major cotton-producing regions worldwide. The wilt pathogen can infect cotton throughout its entire growth cycle, with main symptoms including yellowing and chlorosis of leaves, wilting, drying and shedding, stunted growth, smaller bolls, and even death of the cotton plant. On average, Verticillium wilt reduces cotton yield by 10-35%. In recent years, Xinjiang cotton-growing areas have accounted for over 90% of China's cotton production; however, due to long-term continuous cropping and the practice of returning cotton stalks to the field, the severity of Verticillium wilt in Xinjiang cotton-growing areas has increased year by year. Currently, over 40% of my country's cotton-growing areas are affected by Verticillium wilt, resulting in direct economic losses of approximately 2 billion RMB.

[0004] Verticillium wilt is a major disease currently affecting cotton production, severely reducing fiber yield and quality. Physical, chemical, and biological control methods can only temporarily control the spread of Verticillium wilt and reduce its damage. Cultivating and promoting highly resistant cotton varieties is currently the most fundamental and effective control measure. Using segregating populations to map Verticillium wilt resistance-related traits and identifying genes associated with resistance will provide theoretical guidance for the breeding or improvement of highly resistant cotton varieties. Summary of the Invention

[0005] This invention provides cotton Verticillium wilt-resistant material M34 and its carried resistance gene Gbar_4CL1 for regulating cotton Verticillium wilt resistance, solving the germplasm and gene deficiency problems encountered in the existing technology for breeding upland cotton varieties with Verticillium wilt resistance. This invention discovered cotton Verticillium wilt-resistant material M34 and identified its carried gene Gbar_4CL1, which regulates cotton Verticillium wilt resistance, using map-based cloning technology. It confirmed that the Gbar_4CL1 gene is highly expressed after Verticillium wilt induction. In cotton, VIGS significantly reduces cotton Verticillium wilt resistance. Further overexpression of this gene in cotton significantly enhances cotton's resistance to Verticillium wilt, exhibiting fewer disease symptoms and a significantly reduced disease index compared to the wild type, indicating that this gene plays an important role in regulating cotton Verticillium wilt resistance.

[0006] This invention provides a gene, Gbar_4CL1, that regulates resistance to Verticillium wilt in cotton, the nucleotide sequence of which is shown in SEQ ID NO.1. This invention also provides the protein encoding the aforementioned gene regulating resistance to Verticillium wilt in cotton, the CDS sequence of which is shown in SEQ ID NO.2, and the amino acid sequence of which is shown in SEQ ID NO.3.

[0007] It should be understood that, considering the gene expression regulatory region and the degeneracy of codons, modifying the Gbar_4CL1 gene sequence without changing the amino acid sequence also falls within the scope of protection of this invention.

[0008] The present invention also provides the application of the cotton Verticillium wilt resistance gene Gbar_4CL1, or the expression cassette encoding the Gbar_4CL1 gene, recombinant vector, and recombinant microorganism in enhancing cotton resistance to Verticillium wilt, preparing products that enhance cotton resistance to Verticillium wilt, or breeding cotton varieties resistant to Verticillium wilt, wherein the nucleotide sequence of the Gbar_4CL1 gene is shown in SEQ ID NO.2.

[0009] Furthermore, the sequence containing the Gbar_4CL1 gene and its promoter is shown in SEQ ID NO.1.

[0010] Furthermore, the amino acid sequence encoded by the Gbar_4CL1 gene is shown in SEQ ID NO.3.

[0011] Furthermore, by overexpressing the Gbar_4CL1 gene in cotton or enhancing the functional activity of its encoded protein, cotton resistance to Verticillium wilt can be enhanced or Verticillium wilt-resistant cotton varieties can be bred.

[0012] The present invention also provides a method for enhancing cotton resistance to Verticillium wilt or for breeding Verticillium wilt-resistant cotton varieties, comprising the step of increasing the expression level or protein activity of the Gbar_4CL1 gene in recipient cotton, wherein the nucleotide sequence of the Gbar_4CL1 gene is shown in SEQ ID NO.2.

[0013] Furthermore, a Gbar_4CL1 gene overexpression vector was constructed and introduced into recipient cotton to obtain transgenic overexpression cotton material.

[0014] Further, the Gbar_4CL1 gene was ligated into the pK2GW7 vector to obtain the overexpression vector.

[0015] Furthermore, the overexpression vector was transformed into recipient cotton using Agrobacterium-mediated transformation.

[0016] Furthermore, the transgenic overexpression cotton material exhibited higher resistance to Verticillium wilt than the recipient cotton.

[0017] Furthermore, the transgenic overexpression cotton material exhibits higher resistance to Verticillium wilt than the recipient cotton, as demonstrated in any one of the following a1)-a3): a1) The susceptibility rate of transgenic overexpressing cotton materials was lower than that of recipient cotton; a2) The disease index of transgenic overexpression cotton material was lower than that of recipient cotton; a3) The onset of disease in transgenic overexpressing cotton materials was later than that in recipient cotton.

[0018] Beneficial Effects: This invention utilizes map-based cloning of genes from the cotton Verticillium wilt-resistant material M34, and for the first time identifies the cotton Verticillium wilt resistance gene Gbar_4CL1. Differences were found between this gene in M34 and E22 materials, primarily in promoter sequences, leading to differences in gene expression levels between the two materials. High expression of the Gbar_4CL1 gene in M34 resulted in resistance to Verticillium wilt. Further overexpression of this gene in cotton significantly enhanced cotton's resistance to Verticillium wilt, exhibiting fewer disease symptoms and a significantly lower disease index compared to the wild type. This gene is of significant value for theoretical research on the molecular mechanisms of cotton Verticillium wilt resistance. The materials and genes of this invention can significantly improve cotton's resistance to Verticillium wilt, and have important practical application significance for cotton Verticillium wilt-resistant breeding. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The Verticillium wilt resistance of the introduced sea island cotton line M34 in greenhouse cultivation was superior to that of the upland cotton line Emian 22 (E22). A: The state of E22 on day 14 after inoculation with V991; B: The state of M34 on day 14 after inoculation with V991; C: Disease index survey and significance analysis of E22 and M34; D: Recovery culture of epicotyl stem segments of E22 and M34; E: Bacterial content detection of E22 and M34.

[0021] Figure 2 Map-based cloning of Gbar_4CL1. A: Preliminary location of Gbar_4CL1; B: Island cotton import fragment in Island cotton import line M34.

[0022] Figure 3 Fine mapping of Gbar_4CL1. A: Frequency histogram of disease resistance in F2 population; B and C: Fine mapping of Gbar_4CL1; D: Venn diagram of differentially expressed genes in pairs between different time periods of the same parent and between different parents at the same time period; E: Transcriptome data on differentially expressed genes present in candidate regions.

[0023] Figure 4 The expression patterns of the Gbar_4CL1 gene in response to Verticillium wilt infection in E22 and M34. A: Tissue expression patterns of Gbar_4CL1 in E22 and M34; B: Changes in Gbar_4CL1 expression levels at different time points after inoculation in E22 and M34; C: Changes in Gbar_4CL1 expression levels in E22 and M34 without V991 inoculation.

[0024] Figure 5 The sequence differences between the promoter and CDS regions of the Gbar_4CL1 gene at E22 and M34 are shown.

[0025] Figure 6 The phenotypic effect of silencing the Gbar_4CL1 gene on resistance to Verticillium wilt in cotton. A: Albinism phenotype of TRV:CLA on day 14 after infection with V991; B: Disease phenotypes of TRV:00 and TRV:Gbar_4CL1 on day 14 after infection with V991.

[0026] Figure 7The effect of silencing the Gbar_4CL1 gene on resistance to Verticillium wilt in cotton. A: Expression level of Gbar_4CL1 in TRV:00 and TRV:Gbar_4CL1; B: Disease index survey of TRV:00 and TRV:Gbar_4CL1; C: Plant stem segment culture 14 days after V991 infection; D: Bacterial content detection of plant stem segments 14 days after V991 infection; E: Vascular bundle browning of plant stem segments 14 days after V991 infection.

[0027] Figure 8 To silence Gbar_4CL1, which disrupts lignin deposition and reduces resistance to Verticillium wilt in cotton. A: Paraffin sections of TRV:00, from top to bottom, are the same image at magnifications of 40X, 100X, and 200X; B: Paraffin sections of TRV:Gbar_4CL1, from top to bottom, are the same image at magnifications of 40X, 100X, and 200X.

[0028] Figure 9 The pK2GW7 vector map.

[0029] Figure 10 The expression levels of the Gbar_4CL1 gene were compared between wild-type YE3 and two overexpression lines (Gh4CL1-OE1 and Gh4CL1-OE2). Figure 11 The effect of silencing the Gbar_4CL1 gene on resistance to Verticillium wilt in cotton. a: Disease phenotypes of two overexpression lines (Gh4CL1-OE1 and Gh4CL1-OE2) and wild-type YE3 on day 10 of V991 infection; b: Disease index of two overexpression lines (Gh4CL1-OE1 and Gh4CL1-OE2) and wild-type YE3 on day 10 of V991 infection. Detailed Implementation

[0030] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0031] Example 1: Greenhouse disease resistance assessment of E22 and M34 against V991 (1) Source of plant materials and planting method: The parental materials used in this experiment were Emian22 (hereinafter referred to as E22), an upland cotton, and M34, a chromosome segment substitution line material of sea island cotton constructed in the laboratory in the early stage. The parental materials E22 and M34 were planted in the experimental field of Huazhong Agricultural University in April 2022 and harvested through self-pollination. 200 large and plump seeds of E22 and M34 were selected from each seedling tray, and germination treatment was performed. The seeds were sown in seedling trays, with 30 seeds sown evenly in each seedling tray. Cotton seeds with white sprouts and uniform germination were selected. After sowing, the seeds were covered with vermiculite and covered with plastic wrap to keep them moist and warm. After the cotyledons were flattened, the film was removed, the cotton seedlings were washed to remove the vermiculite, transferred to 1 / 2 MS nutrient solution, and then transferred to an artificial climate chamber (28℃, 16 H light, 8 H dark) for culture. After 4-5 days of culture, V991 inoculation treatment was performed.

[0032] (2) Activation and culture of Verticillium wilt: After transferring the above materials to 1 / 2 MS nutrient solution, 100 μL of V991 spore suspension stored at -70℃ in our research group was evenly spread onto PDA (potato dextrose agar) medium in a clean bench. After complete air drying, it was incubated upside down in a 25℃ incubator for 3-5 days. An appropriate amount of mycelial block was inoculated into an appropriate amount of Czapek medium and cultured in a shaker at 25℃ and 180 rpm for 3-5 days. The spore suspension was filtered through two layers of gauze and thoroughly mixed and diluted 10 times. Using a 5-point sampling method, the number of spores was counted under an optical microscope using a hemocytometer to calculate the spore suspension concentration. The spore suspension concentration was then diluted with distilled water to 5 × 10⁻⁶. 5 The concentration of cells / mL was mixed and then used for Verticillium wilt inoculation.

[0033] (3) Verticillium wilt inoculation: Select cotton seedlings with uniform growth and inoculate them with Verticillium wilt V991 using the root dip method with spore suspension. Mock: Soak the roots of the treated seedlings in 500 mL of distilled water for 2 min; Inoculation treatment: Soak the roots of the cotton seedlings in 500 mL of water with a concentration of 5×10⁻⁶ spore suspension. 5 Prepare a spore suspension of spores / mL, gently agitate the spore suspension, and soak the roots for 2 min.

[0034] Seedlings from both the MOCK and inoculated groups were planted in nutrient soil (nutrient soil: vermiculite = 1:1, V:V) and placed in a light and culture room at 25℃ with a photoperiod of 16 hours of light and 8 hours of darkness. Disease incidence was recorded when Verticillium wilt symptoms appeared in cotton seedlings 9–12 days after inoculation. Disease indices for each treatment were calculated based on plant symptoms such as leaf dehydration, wilting, drying, yellowing, and leaf drop.

[0035] Disease Index (DI): The statistical method refers to the "Technical Specification for Identification of Resistance to Verticillium Wilt in Cotton" (NY / T2952-2016), which classifies the severity of Verticillium wilt in plants into 5 disease levels: 0, 1, 2, 3, and 4. The disease index calculation formula is: Disease Index (DI) = 100 × ∑ (number of diseased leaves at each level × representative value of each level) / (total number of leaves surveyed × highest representative value).

[0036] Table 1. Criteria for Classifying the Disease Level of Cotton Verticillium Wilt (4) Recovery culture of Verticillium wilt: Take the stems of cotton seedlings from the same part (hypocotyl / first internode) about 16 days after inoculation. Dilute "84 disinfectant" (Lova, effective chlorine content 8000mg / L~10000mg / L) with sterile water in a laminar flow hood. Immerse the stems in the diluted disinfectant for 5 minutes, gently shaking the disinfectant during the process. Then rinse the stems 3-4 times with sterile distilled water to remove excess disinfectant. Place the stems on sterile filter paper in a laminar flow hood. After drying the stems, cut them into 2-3 mm segments with a sterile knife. Arrange the cut stem segments on PDA medium according to the material area and invert them in a 25℃ incubator for 2-4 days. Observe the mycelial growth and take pictures.

[0037] (5) Determination of Verticillium wilt content: Approximately 16 days after inoculation, the first internode of inoculated cotton seedlings was taken and quickly placed in liquid nitrogen, stored at -80℃ for later use. After thorough grinding in liquid nitrogen, DNA was extracted using a DNA extraction kit (FastPure Plant DNAIsolation Mini Kit, Vazyme, DC401-01, see product instructions for usage). After determining the concentration, the template was diluted to 10 ng / µL as the template. GhUBQ7 (Ghir_A11G011460) was used as an internal reference gene. ITS1-F and ST-VE1-R were fungal-specific primers for Verticillium wilt. The fungal biomass in the stems was detected by qRT-PCR. Among them, ITS1-F: AAAGTTTTAATGGTTCGCTAAGA, ST-VE1-R: CTTGTGTCATTTAGAGGAAGTAA.

[0038] (6) Greenhouse Verticillium Wilt Resistance Identification of E22 and M34: E22 and M34 were infected with deciduous V991 and planted in a greenhouse. The susceptibility of both was observed 10 days after inoculation. The results are shown in […]. Figure 1 A and Figure 1B. The disease symptoms differed significantly between the two groups. Plants in the E22 experimental group exhibited widespread yellowing, dehydration, and wilting, while M34 showed milder yellowing, dehydration, and wilting. The disease index, obtained using the disease severity index, was analyzed for significant differences using a t-test. The results are shown below. Figure 1 C. The results showed that the disease index of E22 reached nearly 70%, while the disease index of M34 was in stark contrast, less than 40%, showing a significant difference between the two. After observing the plant's disease resistance and investigating the disease index, the epicotyl of the cotton plant was removed for recovery cultivation, and the results were as follows: Figure 1 As shown in Figure D, the results indicate that many stem segments of E22 have regrowed V991, while M34 has many normal stem segments. Hypocotyls of infected plants were removed, DNA was extracted, and bacterial count was detected using qRT-PCR. Difference significance was analyzed using a t-test. The results are shown in Figure D. Figure 1 E. By Figure 1 The results show a significant difference in bacterial count between E22 and M34, with a difference of more than double. E22 had a bacterial count of approximately 0.75, while M34 had a count of approximately 0.35. Data analysis and phenotypic investigation indicate that E22 exhibits significantly lower disease resistance than M34.

[0039] Example 2: Location and Map Cloning of Gbar_4CL1 (1) Initial localization of Gbar_4CL1: Using tetraploid, highly resistant Verticillium wilt-resistant island cotton variety 3-79 as the donor parent and Verticillium wilt-susceptible upland cotton variety E22 as the recipient parent, the F1 generation was first obtained by crossing E22 as the female parent with island cotton 3-79. Then, E22 was used as the recurrent male parent for six consecutive backcrosses, followed by one self-cross, ultimately yielding a 3-79 introgression line population containing 148 multi-segment introgression lines and 177 single-segment introgression lines. Using genome resequencing, the introgression fragments in these 325 3-79 introgression lines were identified, revealing two 3-79 chromosome introgression fragments located on chromosomes A05 and D12, respectively. Figure 2 B). Field identification and screening of the introduced line revealed the disease-resistant introduced line M34.

[0040] The introduced line M34 (resistance level 1) carrying the corresponding Sea Island cotton 3-79 introduced fragment was crossed with the recurrent parent E22 (resistance level 3) and self-crossed to obtain an F2 generation segregating population (1964 individual plants). The disease resistance level of each individual plant was investigated at maturity. The results showed that most individual plants in the F2 population had a disease resistance level between 1 and 2, exhibiting a skewed distribution. Figure 3(A) Among them, there were 310 plants with grade 0 resistance, 690 plants with grade 1 resistance, 407 plants with grade 2 resistance, 297 plants with grade 3 resistance, and 260 plants with grade 4 resistance. This indicates that the resistance to Verticillium wilt in M34 is controlled by a major gene.

[0041] Based on previous resequencing data, InDel markers were designed and developed for the insertion fragments on chromosomes A05 and D12. A total of 300 InDel marker pairs were designed and developed on chromosome A05, with an average distance of one marker per 0.1 Mb. Using parental screening, 40 pairs of usable polymorphic markers were identified. Through continuous acquisition of genotype data and combined with F2 phenotypic data, chromosomal crossing over was found between markers above and below K175 and K268, and high-density marker development was carried out at this location. Fifty pairs of InDel markers were developed on chromosome D12, but no InDel markers with linkage effects to the population could be developed. Ultimately, the focus shifted to chromosome A05. Through the development of InDel molecular markers, acquisition of genotypes, and combined with phenotypic survey data of the F2 population, it was determined that this QTL exists on chromosome A05. Figure 2 A) The physical location is between markers K183 and K208 (K183_F: 5'AGATACAAAGAGTAAGGGATAGGG 3', K183_R: 5'TGACTTGAATGATAGTAGTTAAAGTTCT3'; K208_F: 5'AAAAATTGACGTGGTTGATAGAATA 3', K208_R: 5'TTTTTGTAGTGGTTCATGTAGGTTAA 3'), with a LOD value of approximately 11.

[0042] The interval was eventually reduced from the original 6.2 Mb to 129 kb. There are 11 candidate genes in this interval, namely: Gbar_A05G000520, Gbar_A05G000530, Gbar_A05G000540, Gbar_A05G000550, Gbar_A05G000560, Gbar_A05G000570, Gbar_A05G000580, Gbar_A05G000590, Gbar_A05G000600, Gbar_A05G000610, Gbar_A05G000620, Gbar_A05G000630, Gbar_A05G000640, Gbar_A05G000650, and Gbar_A05G000660. Many genes involved in plant stress resistance exist within this group. For example, Gbar_A05G000520 (Gbar_SYP61) is involved in osmotic stress tolerance and the regulation of stomatal responses to abscisic acid (ABA), and together with Gbar_SYP12, it regulates the transport of aquaporin PIP2-7 to the post-Golgi apparatus of the plasma membrane, thereby modulating cell membrane permeability. Gbar_A05G000580 (Gbar_4CL1) occupies a key position in the phenylpropanoid metabolic pathway, controlling the synthesis of flavonoids and lignin. Gbar_A05G000660 (Gbar_MYB36), when combined with PR1, regulates the drought resistance and Verticillium wilt resistance of cotton.

[0043] (2) Fine-grained localization and map cloning of Gbar_4CL1: Analysis of F using QTL Icimapping 4.0 software 2:3 Based on the genotype data of the population and the phenotypic data of the F2 generation, 11 candidate genes were initially identified within a specific region. To further narrow down this region, 30 recombinant single plants from the selected F2 population were planted as F2... 2:3 The recombinant lines, with at least 50 individual plants per line, totaling 1500 individual plants, were used to investigate disease resistance in mid-August 2023. Fine-grained localization analysis was performed using the same software described above. A very high LOD peak was elicited between markers K183 and K191 (K183_F: 5'AGATACAAAGAGTAAGGGATAGGG 3', K183_R: 5'TGACTTGAATGATAGTAGTTAAAGTTCT 3'; K191_F: 5'TCTTTTTACGAATATGCTAGCTAAA 3', K191_R: 5'ATTCCAAAAAAAATCAATTTGTTT 3'). Figure 3(B) The reason for this is that the selected recombinant single plants underwent exchange near the initial localization region. The remaining candidate genes are: Gbar_A05G000560, Gbar_A05G000570, Gbar_A05G000580 and Gbar_A05G000590.

[0044] To further improve the accuracy of the localization results, manual analysis was performed using genotype and phenotypic data to verify consistency with the software's fine-grained localization. Nine C1 recombinant plants showed generally weak disease resistance, ranking at level 3, indicating the target gene should be located after K175, not between K130 and K175. The C3 recombinant plants exhibited strong overall disease resistance, ranking at level 1, suggesting the target gene is not between the K191 and K215 markers. Combining this with C7, C8, and C9, the target gene region is at least between K175 and K191, indicating consistency with the software's algorithm and the reliability of the software results. Figure 3 C).

[0045] Transcriptome data from (Li et al 2023. Comparative transcriptome analysis of interspecific CSSLs reveals candidate genes and pathways involved inverticillium wilt resistance in cotton (Gossypium hirsutum L.). IndustrialCrops&Products, 2023, 197) were used (the former used the upland cotton reference genome from Wuhan University, and it only focused on highly differentially expressed genes; this analysis also considered low-expression differentially expressed genes). The whole genome sequence and gene annotation files of the TM-1 genome from Huazhong Agricultural University were used for comparison. Pairwise comparisons were performed using Deseq 2 (4.2) to identify differentially expressed genes, with parameters set to Padj < 0.05 and |log2FoldChange| > 1. The comparison groups set are: E22 0 H VS E22 24 H, E22 0 H VS E22 48 H, E22 0 H VS E22 72 H, M34 0 H VS M34 24 H, M34 0 H VS M34 48 H, M34 0 H VS M34 72 H, E22 0 H VS M34 0 H, E22 24 H VS M34 24 H, E22 48 H VS M34 48 H, E22 72 H VS M34 72 H. Using R language (4.2.3), a volcano plot was created to view the number of differentially expressed genes in each control group. The number of differentially expressed genes found in each control group were 1869, 4476, 3679, 5928, 1967, 4439, 2258, 4162, 5119, and 1640, respectively. A Venn diagram was also created using R language. Figure 3 D), differentially expressed genes (genes within candidate intervals) present in each control group were identified. The differentially expressed genes within these candidate intervals were: Gbar_A05G000520, Gbar_A05G000580, Gbar_A05G000600, and Gbar_A05G000660. Volcano plots were constructed using transcriptome data to observe the expression changes of these four genes at different time points after inoculation. Figure 3(E) It was found that the expression level of Gbar_A05G000580 was significantly higher in M34 than in E22, and the expression trend of both genes was an inflection point at 24 hours, first increasing and then decreasing. The expression level of Gbar_A05G000660 in E22 was slightly higher than that in M34, and the overall trend of the inflection points of the two genes was inconsistent. The former reached its peak at 24 hours, while the latter reached its peak at 48 hours, also showing an initial increase followed by a decrease. The expression level of Gbar_A05G000520 was also slightly higher in E22 than in M34. The former reached its peak at 24 hours, first increasing and then decreasing, while the latter reached its lowest value at 48 hours, first decreasing and then increasing. The expression level of Gbar_A05G00060 in both parents was slightly higher in E22 than in M34. The expression pattern of the former was not fixed in the four time periods, showing a decrease, increase, decrease, while the latter showed an inflection point at 24 hours, first decreasing and then increasing. Analysis showed that the expression trend of Gbar_A05G000580 (Gbar_4CL1) was more in line with expectations. This gene peaked at 24 hours in response to V991 infection, and its expression level at M34 was higher than that at E22. Therefore, Gbar_4CL1 was ultimately identified as the target gene.

[0046] Example 3: Gbar_4CL1 gene response to Verticillium wilt infection at E22 and M34 (1) Plant material source and planting method: Select 200 large and plump E22 and M34 seeds, germinate them, transfer them to 1 / 2 MS nutrient solution, and transfer them to an artificial climate chamber (28℃, 16 H light, 8 H darkness) for cultivation and equilibration for 4-5 days (the specific planting method is the same as in Example 1).

[0047] (2) Activation, culture, inoculation and disease index statistics of Verticillium wilt: The specific operation method is the same as in Example 1.

[0048] (3) RNA extraction and expression level detection: RNA was extracted from the roots of E22 and M34 inoculated with V991 and uninoculated with V991 at 0 H, 4 H, 8 H, 12 H, 24 H, 48 H and 72 H, and the expression level of the gene was observed.

[0049] (4) Analysis of Gbar_4CL1 response to V991 infection: To identify the dominant expression sites of Gbar_4CL1 and obtain the tissue expression pattern of this gene, RNA was extracted from the root, stem, and leaf tissues of the two-leaf-one-heart stage parents E22 and M34. The differences in expression levels in different tissues were observed, and the results are shown in […]. Figure 4 A. By Figure 4As shown in Figure A, the expression level is highest in the stem, followed by the root and leaf. The expression level of this gene in M34 is around 1.2, while the expression level in E22 is around 0.7, with the expression level in M34 being significantly higher than that in E22. The purpose of determining the tissue expression pattern is to detect whether the expression level of this gene in the early stage of cotton seedlings is also lower in E22 than in M34, and whether V991 is causing the difference in expression levels between the two parents. The results are... Figure 4 As can be seen from A, even if Gbar_4CL1 is not infected by V991, the expression level of M34 itself is significantly higher than that of E22.

[0050] To verify whether Gbar_4CL1 responds to Verticillium wilt infection, RNA was extracted from the roots of E22 and M34 plants inoculated with V991 and uninoculated plants at 0 H, 4 H, 8 H, 12 H, 24 H, 48 H, and 72 H. The expression trend of this gene was observed to examine its response. The results are shown below. Figure 4 B and Figure 4 C. By Figure 4 B and Figure 4 As shown in Figure C, the expression level of Gbar_4CL1 gradually increased from 0 to 24 hours and gradually decreased from 24 to 72 hours. In contrast, the expression level in the uninoculated control group showed no significant trend. Comparison of each time period between inoculated and uninoculated individuals revealed that the expression level was higher at each time point after inoculation than in the uninoculated group. In conclusion, this indicates that Gbar_4CL1 is induced by Verticillium wilt.

[0051] Example 4: Sequence differences between the promoter and CDS regions of Gbar_4CL1 in E22 and M34 (1) Plant material source and planting method: Select 20 large and plump E22 and M34 seeds, germinate them, transfer them to 1 / 2 MS nutrient solution, and transfer them to an artificial climate chamber (28℃, 16 H light, 8 H darkness) for cultivation and equilibration for 4-5 days (the specific planting method is the same as in Example 1).

[0052] (2) DNA extraction from E22 and M34: Extract approximately 0.1g of young leaves from E22 and M34 at the two-leaf-one-heart stage into 2 mL centrifuge tubes and place them in an ice box or liquid nitrogen. After placing them on ice, add steel balls and 200 μL of extraction buffer one by one, and grind them with a grinder for 60 s at a frequency of 60 Hz. At this time, the water bath can be adjusted to 65℃. Add 800 μL of preheated DNA extraction lysis buffer and shake well to ensure that the sample and lysis buffer are fully and evenly contacted. Incubate at 65℃ for 30 min, and gently invert the tube several times every 10 min. Avoid violent shaking at this time and in subsequent steps. Add 800 μL of chloroform, shake gently, and extract for 20 min at room temperature and 11000 rpm. Centrifuge for 10 minutes; the centrifugation speed with steel balls should not be too high at this time; transfer the supernatant to a new tube, add an equal volume of isopropanol and mix well. The white flocculent precipitate that forms at this time is the crude DNA extract; discard the supernatant, wash the flocculent precipitate twice with 75% alcohol and blow dry, then dissolve it with an appropriate amount of ddH2O; generally, only 20-100 ng of DNA is needed as template in PCR.

[0053] (3) RNA extraction from E22 and M34: RNA was extracted from the root, stem and leaf tissues of the parental E22 and M34 at the two-leaf-one-heart stage (each tissue was taken in 3 replicates).

[0054] (4) Amplification of the actual sequences of the promoter and CDS region of Gbar_4CL1 at E22 and M34: Using the website (https: / / cottonfgd.net / ) and with the upland cotton TM-1 genome from Huazhong Agricultural University as the reference genome, primers for the promoter and CDS region of Gbar_4CL1 were designed and amplified simultaneously. Sequencing was then performed. The primers are shown below: CDS-Gbar_4CL1_F:ATGGAGGCCGATCAACACCAGC CDS-Gbar_4CL1_R:CTAGTTGGCTACATCTGCAGCGAGC PRO- Gbar_4CL1_F:CTTCATCACTTGATTGCATGAATAT PRO-Gbar_4CL1_R: ACATTGGCTATGTTGTTGAATCCCT (5) Analysis of sequence differences between the promoter and CDS regions of Gbar_4CL1 at E22 and M34: The results are shown in the figure below, based on the comparison and analysis of sequencing data. Figure 5 .

[0055] The nucleotide sequence of Gbar_4CL1 in M34 (as shown in SEQ ID NO.1, where wavy lines indicate promoters and underlines indicate exons) is as follows: The CDS sequence of the Gbar_4CL1 gene in M34 is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.3.

[0056] The nucleotide sequence of Gbar_4CL1 in E22 is shown in SEQ ID NO.4. The following only shows the promoter sequence of Gbar_4CL1 in E22: The CDS sequence of the Gbar_4CL1 gene in E22 is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6.

[0057] Depend on Figure 5 It was found that in the CDS region base sequences of both parents, only one base change (a transversion between T and A) was observed, resulting in the change of phenylalanine to tyrosine. However, the promoter sequences of E22 and M34 showed base deletions at 800bp, 752bp, and 150bp, along with multiple base substitutions. Figure 4 B and Figure 4 The expression levels of the Gbar_4CL1 gene in different materials (C) confirmed that the base changes in the promoter region affected the expression of the Gbar_4CL1 gene in E22 and M34, thus causing phenotypic differences between E22 and M34. The naturally high expression of the Gbar_4CL1 gene in M34 significantly enhanced its disease resistance.

[0058] Example 5: Silencing of Gbar_4CL1 in Cotton (1) Construction of VIGS vector: Based on the nucleic acid sequence information of the CDS region of the candidate gene of TM-1 reference genome from cottonfgd (https: / / cottonfgd.net / ), blastn alignment was performed. Primers were designed using the target gene-specific segment as the reference sequence. The target fragment was controlled to be 300~500 bp. A KpnI restriction site adapter (5'-GCGTGAGCTCGGTACC-3') was added to the 5' end of the forward primer, and a BamHI restriction site adapter (5'-GCCTCCATGGGGATCC-3') was added to the 5' end of the reverse primer. cDNA from the stem of material M34 was used as a template for amplification. After electrophoresis to confirm that the PCR product size was correct, the PCR product was purified. The primer sequences are as follows: VIGS-Gbar_4CL1_F:AATTTCCTAGTTTGAGAATGTTTCCCAGTTTAAAG; VIGS-Gbar_4CL1_R:GTACCGGATCGAAACTCTTCACTTTCTCCGCAT.

[0059] The purified PCR product and the TRV:00 plasmid, which was double-digested with BamHI and KpnI, were ligated using In Fusion (Clonetch) enzyme and transformed into competent E. coli TOP10. The specific ligation system was as follows: Exase II 1.0 uL, 5×Buffer 2.0 uL, double-digested TRV:00 plasmid 100 ng, purified PCR product 10 ng, and ddH2O to a final volume of 10 μL. The prepared InFusion system was incubated in a water bath at 37°C for 30 min, then in an ice bath for 5 min. The cells were then transferred to thawed competent TOP10 cells, incubated in an ice bath for 20 min, and then incubated at 42°C for 90 s. The cells were then quickly placed on ice, and after 2 min, transferred to 200 µL of LB medium. The cells were shaken at 37°C and 180 rpm for 40 min. 100 µL of the culture was then spread evenly on a dish of LB solid medium (containing 0.1% kanamycin), and the dish was inverted and incubated at 37°C for about 12 h. Single clones were picked and PCR amplified using Gene-F and TRV:00-F primers for positive detection. Positive strains were sent to a biotechnology company for sequencing. For correctly sequenced single-clone cultures, plasmids were extracted and transferred to competent Agrobacterium GV3101 via electroporation. After electroporation, the bacterial culture was transferred to 2 mL of LB broth and incubated at 28°C and 180 rpm for 1 hour. 100 µL of the bacterial culture was then spread onto solid LB broth containing 0.1% kanamycin and 0.1% rifampin, and incubated upside down at 28°C for 2 days. PCR was performed using Gene-F and TRV:00-F primers for positive detection. Positive strains were diluted with glycerol to a final glycerol concentration of 20% and stored at -80°C for later use.

[0060] (2) Activation, culture, inoculation and disease index statistics of Verticillium wilt: The specific operation method is the same as in Example 1.

[0061] (3) VIGS bacterial culture handling and treatment: Strain activation: One day before VIGS treatment, 20 μL of the constructed strain containing the target fragment, the indicator control strain TRV:CLA, the negative control strain TRV:00, and the helper vector strain TRV1 were inoculated into 500 µL of liquid LB medium (0.1% RIF and 0.1% kan) (2 mL centrifuge tubes). The culture was activated and multiplied at 28℃ and 180 rpm for about 10 hours on a shaker. An appropriate amount of activated strain was then transferred to 5 mL of liquid LB medium (containing 0.1% RIF and 0.1% kan) and multiplied overnight at 28℃ and 180 rpm on a shaker. Collection and activation of bacterial cells: The overnight culture was transferred to 10 mL centrifuge tubes and centrifuged at 4000 rpm for 15 min at room temperature. The supernatant was discarded, and the culture was resuspended in suspension (final concentration 200 μM acetylsalicylic acid, 10 mM MES, 10 mM MgCl2). The OD of each bacterial culture was measured. 600The absorbance value was adjusted by adjusting the OD. 600 To a concentration of 0.6-0.8, mix the bacterial cells with an equal volume of TRV1 and incubate at 28°C and 180 rpm for 1 hour, or at room temperature for 3-5 hours. VIGS treatment: Discard weak seedlings and select cotton seedlings with thick cotyledons and uniform growth. Using a 1 mL pipette tip, gently make a swirl mark on the back of the cotton cotyledon (be careful not to penetrate the cotyledon). Then, using a 1 mL syringe with the needle removed, evenly fill the back of the leaf with the bacterial suspension at the swirl mark. To prevent excessive water loss from the cotton seedlings after treatment and to reduce the damage caused by the treatment, cover the treated seedlings with a black plastic film and incubate in the dark for 24 hours. After incubation, remove the film and place the seedlings in an artificial climate chamber at 25°C for 16 hours of light and 8 hours of darkness.

[0062] (4) Silencing effect detection: Generally, 10-14 days after treatment, the true leaves of the indicator control material TRV:CLA will show obvious albinism. When the true leaves of TRV:CLA treatment show obvious albinism, take leaves or stems (corresponding parts of the whitening of TRV:CLA material) from 5 plants of silence treatment and negative control TRV:00 respectively, quickly place them in liquid nitrogen, transfer them to a -80℃ freezer for short-term storage for later use in RNA extraction, reverse transcription, and qRT-PCR detection of the expression level of the target gene. Compared with the negative control TRV:00, evaluate the silencing efficiency of the target gene. If the silencing effect is obvious, subsequent experiments can be carried out.

[0063] Specific steps for reverse transcription: After RNA extraction, RNA quality was assessed by agarose gel electrophoresis, and RNA concentration was measured using a NanoDrop 2000 micro spectrophotometer. 3 μg of RNA was used for reverse transcription into cDNA using PROMEGA reagents. In a 0.5 mL enzyme-free centrifuge tube, 3 μg RNA and 1 μL oligo(dT) were added, and DEPC water was added to a final volume of 15 μL. After mixing, the tube was incubated at 70°C for 5 min, followed by 10 min on ice. Then, 5 μL of 5× MLV buffer, 1.25 μL of 10 mmol / L dNTPs, 1 μL of Rnasin (40 U), 1 μL of M-MLV RTase (200 U), and 1.75 μL of RNase-free H2O were added, for a total volume of 25 μL. After mixing, place the mixture in a reverse transcription apparatus and incubate at 42℃ for 60 min, then at 70℃ for 15 min. The resulting cDNA is diluted to 250 μL with ddH2O and can be stored at -20℃. The cDNA is then diluted 10-fold as a template for subsequent expression analysis.

[0064] The specific procedure for qRT-PCR is as follows: 7.5 μL cDNA template, 7 μL SybrGreen-mix (BIO-RAD), and 0.25 μL forward and reverse primers are mixed and placed in a real-time quantitative PCR instrument (ABI Prism 7500 system). The program is set as follows: Stage 1, 95℃ for 30 s, 1 cycle; Stage 2, 95℃ for 5 s + 60℃ for 35 s, 40 cycles. The fluorescence intensity value is read at the end of each cycle, and then... -ΔΔCT The relative expression levels of the gene were calculated, and GhUBQ7 (Ghir_A11G011460) was used as an internal reference gene. The significance of the difference in gene expression levels in different materials was determined by t-test.

[0065] (5) Recovery culture of Verticillium wilt: Take the stems of cotton seedlings from the same part (hypocotyl / first internode) about 16 days after inoculation. Dilute "84 disinfectant" (Lova, effective chlorine content 8000 mg / L~10000 mg / L) with sterile water in a clean bench. Immerse the stems in the diluted disinfectant for 5 minutes, gently shaking the disinfectant during the process. Then rinse the stems 3-4 times with sterile distilled water to remove excess disinfectant. Place the stems on sterile filter paper in a clean bench. After drying the stems, cut them into 2-3 mm segments with a sterile knife. Place the cut stem segments on PDA medium according to the material area and invert them in a 25℃ incubator for 2-4 days. Observe the mycelial growth and take pictures.

[0066] (6) Determination of Verticillium wilt content: About 16 days after inoculation, take the first internode of the inoculated cotton seedling, quickly place it in liquid nitrogen, and store it in a -80℃ refrigerator for later use. After thorough grinding in liquid nitrogen, extract DNA using a DNA extraction kit (FastPure Plant DNAIsolation Mini Kit, Vazyme, DC401-01, see product instructions for usage). After determining the concentration, dilute the template to 10 ng / µL as the template, use GhUBQ7 (Ghir_A11G011460) as the internal reference gene, and use ITS1-F and ST-VE1-R as fungal-specific primers for Verticillium wilt. Detect the fungal biomass in the stem using qRT-PCR.

[0067] (7) Preparation of stem sections for VIGS experimental group and negative control group: When conducting the silencing effect test, the stems of the plant experimental group and control group were randomly cut (on the 14th day after V991 infection), and three replicates were taken from each group and photographed.

[0068] (8) Analysis of results after silencing Gbar_4CL1: Gbar_4CL1 was silenced using the VIGS technique, and V991 was administered simultaneously to observe whether M34 showed phenotypic differences. When the TRV:CLA showed an albino phenotype (approximately 10 days later), the blank control group TRV:00 and the experimental group TRV:Gbar_4CL1 were compared. The results are shown in […]. Figure 6 A and Figure 6 B. By Figure 6 A and Figure 6 As shown in B, the control group exhibited leaf drop, partial yellowing, and wilting, while the experimental group showed extensive leaf drop, yellowing, and wilting, demonstrating a significant phenotypic difference. The silencing effect of Gbar_4CL1 and the investigation of pathological indicators were also examined; the results are shown below. Figure 7 A and Figure 7 B. By Figure 7 A and Figure 7 B indicates that the Gbar_4CL1 gene silencing effect reached 50%, demonstrating a good gene silencing effect. After silencing this gene, a significant difference in the disease index was observed between the TRV:00 and TRV:Gbar_4CL1 groups, with the disease index of M34 increasing threefold. After 3 days of recovery culture in a biochemical incubator, the recovery culture status and bacterial content of the recovered stem segments were investigated. The results are shown below. Figure 7 C and Figure 7 D. By Figure 7 C and Figure 7 As shown in D, a small number of diseased stem segments appeared in TRV:00, while more diseased stem segments appeared in TRV:Gbar_4CL1. Relative bacterial count testing revealed that TRV:00 had a relative bacterial count of approximately 0.35, while TRV:Gbar_4CL1 reached approximately 1.25, showing a significant difference. On the 14th day after V991 infection, stems from the same location were cut from both TRV:00 and TRV:Gbar_4CL1, and longitudinal sections were taken. The results are shown below. Figure 7 E. By Figure 7 E indicates that the TRV: Gbar_4CL1 specimens showed severe blackening and browning, while the control group had milder symptoms.

[0069] In conclusion, silencing Gbar_4CL1 significantly weakens the disease resistance of M34.

[0070] Example 6: Silencing Gbar_4CL1 disrupts lignin deposition and reduces cotton Verticillium wilt resistance. (1) Material source: The stems of the negative control TRV:00 and the experimental group TRV:Gbar_4CL1 of Example 3 were cut into approximately 3 cm long (3 stems were randomly cut from each group).

[0071] (2) Observation of lignin deposition in paraffin sections: Immerse the above materials in 70% FAA fixative and then prepare sections. The specific steps for paraffin sections are as follows: Take out the prepared hypocotyl sample from the 4℃ refrigerator, pour out the fixative in the centrifuge tube, rinse the sample twice with water, embed the stem segment in 1.5 mL centrifuge tube with 4%~5% agarose, cool to room temperature, and let the agarose solidify completely. Use a utility knife to cut the centrifuge tube, carefully remove the embedded block, cut off the excess agarose, and after trimming, glue the embedded block firmly to the sample stage of the vibratory microtome (Leica, VT1000S) with 502 glue. Adjust the position of the sample stage and the blade, fix the sample stage, set the parameters such as the section thickness (75-90 µm), the total section thickness, and the section vibration frequency, and start sectioning. During this period, use a fine soft brush to gently transfer the cut sections to a 1.5 mL centrifuge tube containing distilled water. After sectioning, gently aspirate the distilled water from the centrifuge tube, add 500 µL of 3% phloroglucinol solution (dissolved in 100 mL of 95% ethanol) for staining. After staining for 10 min, discard the staining solution, add an appropriate amount of 18% HCl (phloroglucinol can react with lignin in the cell wall under acidic conditions, showing a brick-red or purplish-red color) for color development. Invert the centrifuge tube several times, and after about 30 s of color development, quickly transfer the section to a glass slide and place it under a stereomicroscope (Nikon, SMZ25). (3) Analysis of lignin deposition in paraffin sections: On day 14 of V991 infection of M34, stem segments of TRV:00 and TRV:Gbar_4CL1 were cut and stained with phloroglucinol-hydrochloric acid. This reagent combines with lignin to form a pink organic substance, thus allowing observation of lignin deposition in both. Since the cut TRV:00 and TRV:Gbar_4CL1 stem segments came from cotton seedlings of M34 approximately 14 days old, at this stage, the cotton seedlings are in the initial growth stage of the vascular bundles. To maintain their own water and nutrient supply, the plant will preferentially deposit lignin near the vascular bundles for its own survival, so the vascular bundle part is stained darker. Figure 8 It was found that the red color of the vascular bundles in paraffin sections of TRV:Gbar_4CL1 stem segments was lighter than that of TRV:00. This gene is located upstream in the phenylpropanoid metabolic pathway and determines the metabolism of flavonoids and lignin. Silencing the Gbar_4CL1 gene disrupts the lignin metabolic pathway, leading to less or no lignin accumulation, thus disrupting the plant's own feedback regulation system. Therefore, the vascular bundles of TRV:Gbar_4CL1 show less lignin accumulation and a lighter red color.

[0072] In conclusion, Gbar_4CL1 is a key gene in the lignin metabolism pathway, and silencing Gbar_4CL1 disrupts the lignin metabolism pathway.

[0073] Example 7: Overexpression of the Gbar_4CL1 gene enhances cotton resistance to Verticillium wilt. (1) Preparation of overexpression lines Overexpression vector construction was performed using Gateway technology. First, the full-length CDS of Gbar_4CL1 (SEQ ID NO.2) was amplified by PCR. After successful amplification, a BP reaction was performed to construct it into the pDONER221 intermediate vector. This vector was then transformed into *E. coli* strain TOP10 using heat shock transformation. After the strain had grown, plaques were detected by PCR and single-clone sequencing. After confirming the sequencing results were correct, the plasmid was extracted and constructed into the pK2GW7 vector using the same LR reaction. The pK2GW7 vector map is shown below. Figure 9 As shown.

[0074] The constructed overexpression vector plasmid was electroporated into Agrobacterium strain GV3101. After selecting PCR-positive clones, the hypocotyls of cotton line YE3 were infected using Agrobacterium-mediated transformation. The cotton genetic transformation method was based on Jin Shuangxia's doctoral dissertation (Jin Shuangxia 2007).

[0075] Among them, cotton line YE3 is a cotton recipient material with high genetic transformation efficiency obtained by crossing the high-yielding broad-leaved variety 'Emian 22' (E22) of Hubei Province as the female parent and the chicken-foot leaf variety 'Yuzao 1' (YZ-1) with high regeneration ability as the male parent, and then constructing a genetically stable F9 generation recombinant inbred line through multiple generations of self-pollination.

[0076] (2) Materials and planting methods The control group in this experiment was YE3, and the experimental groups were two strains of 4CL1 overexpression, Gh4CL1-OE1 and Gh4CL1-OE2 (the results of the expression level comparison are shown in the figure). Figure 10 (As shown). Select 200 large, plump seeds from each seedling tray and perform germination treatment (bury the seeds in a damp towel, the towel absorbs 40℃ warm water, bury for 4-5 hours, then place in a 28℃ biochemical incubator for 48 hours in the dark). Sow 40 seeds evenly in each seedling tray, selecting cotton seeds that have sprouted white leaves and germinated uniformly. After sowing, cover the seeds with vermiculite and cover with plastic wrap to retain moisture and increase temperature. After the cotyledons have flattened, remove the film, wash the cotton seedlings to remove the vermiculite, transfer them to 1 / 2 MS nutrient solution, and then transfer them to a light culture room (28℃, 16 hours light, 8 hours dark) for culture. After 4-5 days of culture, inoculate with Vd.991 (hereinafter referred to as V991).

[0077] (3) Activation, culture, inoculation and disease index statistics of Verticillium wilt: The specific operation method is the same as in Example 1.

[0078] (4) Experimental results like Figure 11 As shown, on the 10th day after V991 inoculation, most of the leaves of the control group YE3 had turned yellow, wilted and fell off, while the two overexpression lines of Gh4CL1 (Gh4CL1-OE1 and Gh4CL1-OE2) showed no obvious disease. In addition, the disease index of the overexpression was significantly lower than that of the control group. Therefore, the two overexpression lines of Gh4CL1 showed the trait of increased resistance to Verticillium wilt.

[0079] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A nucleic acid molecule, and the use of an expression cassette, recombinant vector, or recombinant microorganism containing said nucleic acid molecule in any of the following, characterized in that, The nucleic acid molecule includes the Gbar_4CL1 gene as shown in SEQ ID NO.

2. A1) Enhance resistance to Verticillium wilt in cotton; A2) Prepare products that enhance resistance to Verticillium wilt in cotton; A3) Develop cotton germplasm resistant to Verticillium wilt; A4) Prepare and cultivate cotton germplasm products resistant to Verticillium wilt.

2. The application according to claim 1, characterized in that, The amino acid sequence encoded by the Gbar_4CL1 gene is shown in SEQ ID NO.

3.

3. The application according to claim 1, characterized in that, The nucleic acid molecule is a nucleic acid containing a promoter and the Gbar_4CL1 gene, and its nucleotide sequence is shown in SEQ ID NO.

1.

4. The application according to any one of claims 1-3, characterized in that, Overexpression of the Gbar_4CL1 gene in cotton or enhancement of the functional activity of its encoded protein can enhance cotton resistance to Verticillium wilt or cultivate Verticillium wilt-resistant cotton germplasm.

5. A method for enhancing cotton resistance to Verticillium wilt or cultivating Verticillium wilt-resistant cotton germplasm, characterized in that, The method includes the step of increasing the expression level or protein activity of the Gbar_4CL1 gene in recipient cotton, wherein the nucleotide sequence of the Gbar_4CL1 gene is shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that, A Gbar_4CL1 gene overexpression vector was constructed and introduced into recipient cotton to obtain transgenic overexpression cotton material.

7. The method according to claim 6, characterized in that, The Gbar_4CL1 gene was ligated into the pK2GW7 vector to obtain the overexpression vector.

8. The method according to claim 6, characterized in that, The overexpression vector was transformed into cotton callus tissue via Agrobacterium-mediated transformation.

9. The method according to any one of claims 6-8, characterized in that, The transgenic overexpression cotton material exhibited higher resistance to Verticillium wilt than the recipient cotton.

10. The method according to claim 9, characterized in that, The transgenic overexpression cotton material exhibits higher resistance to Verticillium wilt than the recipient cotton, as demonstrated by any one of B1)-B3): B1) The susceptibility rate of transgenic overexpressing cotton material was lower than that of recipient cotton; B2) The disease index of transgenic overexpressing cotton material was lower than that of recipient cotton; B3) The onset of disease in transgenic overexpressing cotton materials was later than that in recipient cotton.

Citation Information

Cited By

  • Gene GhTLP1b for improving verticillium wilt resistance of cotton and application of gene GhTLP1b

    CN122012603A