SNP molecular marker related to weight character of mytilus coruscus and application of SNP molecular marker

Abstract

The invention belongs to the technical field of biological application, and particularly relates to a mytilus coruscus body weight character related SNP molecular marker and application thereof. The nucleotide sequence of the SNP molecular marker related to the weight of mytilus coruscus is as shown in SEQ ID NO: 1, and the mutation type is A / G mutation. The development method of the molecular marker comprises the following steps: collecting a mytilus coruscus sample, measuring weight phenotype data of the sample, combining whole genome association analysis, screening out SNP candidate sites obviously associated with the weight character, designing specific primers, and finally determining the associated SNP marker through two-stage analysis of primary screening and cross-population verification by utilizing PCR amplification and a first-generation sequencing technology. The invention focuses on the development of practical molecular markers of weight traits, constructs a multi-geographical population joint analysis population, establishes a standardized weight monitoring specification, and adopts an extreme phenotype grouping strategy to enhance the detection efficacy, thereby identifying the weight trait SNP marker of mytilus coruscus with breeding application value. And core technical support is provided for breeding of high-yield new varieties of mytilus coruscus.

Description

Technical Field

[0001] This invention belongs to the field of bioapplication technology, specifically relating to SNP molecular markers related to the weight trait of thick-shelled mussels and their applications. Background Technology

[0002] Thick-shelled mussels (Mytilus coruscus) are a core economic species in my country's aquaculture industry, and their weight directly determines the yield and economic benefits. Unlike shell length, which only reflects linear growth, weight comprehensively reflects an individual's biomass accumulation and meat development level, making it a key indicator affecting meat yield and commercial value. In large-scale aquaculture, increasing the rate of weight gain can effectively shorten the farming cycle, reduce the feed conversion ratio, and significantly improve farming profitability.

[0003] Current breeding methods primarily rely on traditional approaches: regularly weighing and selecting large individuals, accumulating growth advantages through multiple generations of breeding. This method faces three major challenges: firstly, weight measurements are easily affected by accidental factors such as feeding status and reproductive cycles, resulting in poor data stability; secondly, the unstable farming environment, such as sudden temperature changes and fluctuations in feed, reduces phenotypic reproducibility; and thirdly, the breeding cycle for thick-shelled mussels is as long as 3-5 years, which cannot meet the industry's urgent need for superior breeds.

[0004] The development of SNP molecular marker technology has opened up new avenues for the genetic analysis of body weight traits. Compared to traditional morphological markers, SNPs have advantages such as uniform distribution across the genome and co-dominant inheritance, making them particularly suitable for analyzing complex quantitative traits like body weight that are regulated by multiple genes. Although there have been successful cases in shellfish such as oysters and scallops, research on SNPs related to body weight in thick-shelled mussels still has significant gaps. Existing results are mostly based on small-sample initial screening of single populations, lacking cross-regional validation systems, and reported markers are difficult to apply in practical breeding scenarios due to low effect values ​​or high environmental sensitivity.

[0005] Genome-wide association studies (GWAS) hold promise for overcoming these bottlenecks. This technology, through a combination of high-throughput genotyping and refined phenotypic acquisition, can systematically uncover key genetic loci regulating body weight. However, research on thick-shelled mussels still faces unique challenges. Body weight formation in thick-shelled mussels involves the coordinated action of multiple pathways, including nutrient metabolism and energy allocation, resulting in a more complex genetic structure. Furthermore, the interaction between the aquatic environment and genotype is strong, requiring research designs that encompass diverse aquaculture ecosystems.

[0006] This study focuses on the development of practical molecular markers for body weight traits. By constructing a multi-geographical population co-analysis group, standardized body weight monitoring procedures were established, and an extreme phenotypic grouping strategy was employed to enhance detection efficacy. The goal is to identify SNP markers for body weight traits in thick-shelled mussels with breeding application value, providing core technical support for the breeding of high-yielding new varieties of thick-shelled mussels. Summary of the Invention

[0007] To overcome the shortcomings of existing technologies, the present invention aims to provide a technical solution for SNP molecular markers related to the weight trait of thick-shelled mussels and their applications, which can be applied to aquaculture and other fields. The specific technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides a molecular marker for SNPs related to the weight trait of thick-shelled mussels, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the mutation type is A / G mutation.

[0009] SEQ ID NO of the present invention: 1: 250ATTATGTCTAGTATCTGAGCTTAACTCA CTATCTTTGTTTACCTCATTTGAAACAGATTTTAACTGTACATGTTTCATAAA CCTTTCCCCTTTTCTAGCAACACTAA / GCTGTTGACTGTTCAACTCTAGCTTC GCTCTCATTGTCTGACT400.

[0010] Secondly, this invention provides the application of SNP molecular markers related to the weight trait of thick-shelled mussels in the breeding of thick-shelled mussels.

[0011] Thirdly, this invention provides the application of SNP molecular markers related to the weight trait of thick-shelled mussels in screening individuals with weight trait phenotypes.

[0012] Fourthly, a method for developing SNP molecular markers related to the weight trait of thick-shelled mussels, characterized by comprising the following steps:

[0013] S.1. Collect thick-shelled mussel samples;

[0014] S.2. Measure the sample weight phenotypic data;

[0015] S.3 Combined with genome-wide association analysis (GWAS), candidate SNPs significantly associated with body weight traits were screened out;

[0016] S.4. Design specific primers and utilize PCR amplification and first-generation sequencing technology;

[0017] S.5. The associated SNP markers were finally determined through a two-stage analysis of initial screening and cross-population validation.

[0018] In step S.1 of this invention, a total of 120 thick-shelled mussel samples were collected from four sea areas: Shengsi in Zhejiang, Lianjiang in Fujian, Lianyungang in Jiangsu, and Xiamen in Fujian.

[0019] In step S.2 of this invention, the weight data of 120 samples are accurately measured using an electronic balance. The data are then arranged and divided into four groups using the quartile method. The samples in the lower quartile are the low-somatic group, and the samples in the upper quartile are the high-somatic group, which are used for subsequent statistical analysis and genome-wide association analysis.

[0020] In step S.3 of this invention, DNA was extracted from the adductor muscle tissue of the sample, and genome resequencing technology was used to perform whole-genome SNP genotyping to obtain SNP variant sites. The variant site vcf files, combined with phenotypic data, were used to perform genotype-phenotype association analysis using a mixed linear model (MLM) to obtain candidate SNP sites and mutation types (A / G) for the weight trait of thick-shelled mussels.

[0021] After gel electrophoresis detection as described in step S.4 of this invention, the SNP locus genotype is obtained as AA / AG / GG.

[0022] Furthermore, the nucleotide sequences of the specific primers in S.4. are shown in SEQ ID NO: 2-3.

[0023] The forward primer of the specific primers described in this invention is: F: ACAGATTTCGACGCAAGGTCT; the reverse primer is: R: TGGCCCATGGTTCTTTCTCA, the amplified fragment length is 487bp, and the annealing temperature is 57℃.

[0024] Furthermore, the identification primers for the SNP molecular markers related to the weight trait of the thick-shelled mussel are shown in SEQ ID NO: 2-3.

[0025] Furthermore, the application of the identification primers in identifying SNP molecular markers related to the weight trait of thick-shelled mussels was investigated. The nucleotide sequence of the SNP molecular markers related to the weight trait of thick-shelled mussels is shown in SEQ ID NO: 1.

[0026] The beneficial effects of this invention are mainly reflected in:

[0027] (1) This invention establishes for the first time a low-cost genotyping system for SNP markers of the weight trait in thick-shelled mussels, which significantly reduces the cost compared to traditional chip detection and eliminates false positive interference through large-sample verification. This marker can be directly used for marker-assisted breeding to accelerate the selection of fast-growing superior varieties of thick-shelled mussels and provide technical support for the analysis of the genetic mechanism of growth traits in thick-shelled mussels.

[0028] (2) This invention focuses on the development of practical molecular markers for weight traits. By constructing a multi-geographic population joint analysis group, establishing standardized weight monitoring specifications, and adopting an extreme phenotype grouping strategy to enhance detection efficacy, it has identified SNP markers for the weight trait of thick-shelled mussels with breeding application value, providing core technical support for the breeding of high-yield new varieties of thick-shelled mussels.

[0029] (3) The method described in this invention is simple to operate, convenient to use, and has low cost, which is conducive to its widespread use in production practice. Attached Figure Description

[0030] Figure 1 gel electrophoresis was performed to validate the PCR amplification products; 1: Target gene; M: 5000bp DNA Marker.

[0031] Figure 2 Weight data and anatomical diagram of thick-shelled mussels.

[0032] Figure 3 This is a frequency histogram of body weight data for 120 samples.

[0033] Figure 4 Manhattan plot for GEMMA model of association analysis of weight trait.

[0034] Figure 5 This is a reverse sequencing peak diagram of SNP sites. Detailed Implementation

[0035] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0037] Example 1: Sample Collection and Weight Data Acquisition

[0038] 1. Sample collection and preprocessing

[0039] Sampling areas: A total of 120 adult thick-shelled mussels were collected from four sea areas: Shengsi in Zhejiang, Lianjiang in Fujian, Lianyungang in Jiangsu, and Xiamen in Fujian. They were preserved in ice boxes and transported to the laboratory.

[0040] 2. Phenotypic Recording: The weight of each sample was measured (electronic balance, accuracy 0.01g).

[0041] Grouping criteria: The weight data of the 120 samples were arranged and divided into four groups using the quartile method. The 30 samples in the lower quartile were selected as the low-weight group, and the 30 samples in the upper quartile were selected as the high-weight group.

[0042] 3. Data Recording

[0043] Phenotypic control and statistics: The measured weight data were statistically analyzed (Table 1).

[0044] Table 1. Statistical results of SNP loci genotypes at low-recombinant and high-recombinant levels during the initial screening stage (with chi-square test results).

[0045]

[0046] Example 2: Resequencing and extraction from thick-shelled mussels

[0047] Step 1: Sample lysis

[0048] (1) Add pre-cooled lysis buffer GHA and proteinase K sequentially to the sample powder that has been ground with liquid nitrogen, and immediately mix thoroughly for 15 seconds using a vortex mixer.

[0049] (2) Transfer the mixture to a centrifuge tube and incubate it in a 65°C constant temperature water bath for 15 minutes. During this period, gently invert the centrifuge tube 3-5 times every 5 minutes to promote full tissue lysis.

[0050] Step 2: Impurity Separation

[0051] (1) Centrifuge the centrifuge tube at 12,000 rpm (approximately 13,400 × g) for 5 minutes to promote the precipitation of unlysed tissue fragments and impurities.

[0052] (2) Use a pipette to aspirate the supernatant and transfer it to the corresponding well of the 96-well deep well plate (marked as plate A) in the order of sample number.

[0053] (3) Inject equal volumes of isopropanol and pyrolysis enhancement fluid GHL into each well of plate A in sequence (isopropanol and GHL can be premixed in proportion before being added).

[0054] Step 3: System Construction

[0055] (1) Prepare board B and board E respectively.

[0056] Plate B: Add GDZ binding buffer quantitatively according to the well order (confirm that anhydrous ethanol has been added in the correct proportion before use); Plate E: Simultaneously inject GDZ buffer of the same formulation, and cover with a sealing film after completion for later use.

[0057] (2) Prepare magnetic bead purification plates:

[0058] C plate: Add PWD elution buffer containing ethanol to each well in sequence (shake the magnetic bead suspension for 30 seconds before use to ensure uniformity), and insert the magnetic sleeve; F plate: Inject PWD elution buffer of the same formulation, seal and store for later use; D plate: Add elution buffer TB quantitatively to each well, cover with a sealing film and wait for use.

[0059] Step 4: Fully Automated Purification Operation

[0060] (1) Place plates A, B, C, D, E, and F in the designated slots of the Tiangen S96 nucleic acid purification instrument in sequence; start the preset program to complete the DNA binding, rinsing, and elution steps in sequence (the system automatically controls liquid transfer and magnetic bead adsorption).

[0061] Step 5: Product preservation and recording

[0062] (1) After elution, transfer the DNA solution in the D plate to a sterile EP tube and label it with the following information: abbreviation of project name; last three digits of project number; sample batch code; extraction date (year, month, day).

[0063] (2) Store the DNA sample in a special storage box for ultra-low temperature freezer at -80℃ (as shown in Table 2) for a long period of time.

[0064] (3) Fill in the experimental record form and record the processing parameters and quality control results of each batch of samples in detail.

[0065] Table 2. Kit Composition

[0066]

[0067]

[0068] Example 3: Standardized Operating Procedures for Resequencing Library Construction

[0069] I. Genomic DNA Fragmentation

[0070] (1) Start-up of the precooling system

[0071] Before the experiment, turn on the circulating water cooling device and set the temperature to 4℃. Once the water temperature has stabilized, it is ready for use.

[0072] (2) DNA mechanical shearing

[0073] Take a quantitative amount of genomic DNA (accurately measured by Qubit), add it to a 0.6 mL imported centrifuge tube, and bring the volume up to 100 μL using 1×TE buffer (operate on ice throughout).

[0074] Insert the centrifuge tubes symmetrically into the 0.65mL adapter and tighten them. Start the ultrasonic disruptor to fragment the DNA according to the preset program (based on the target fragment of 350bp).

[0075] (3) Fragment distribution detection

[0076] The fragmented product was collected by short-term centrifugation, and 1 μL of the product was subjected to agarose gel electrophoresis (1.5% gel, 120V, 20min) to confirm that the main band was concentrated in the 300-400bp range.

[0077] (4) Magnetic beads for DNA fragment purification

[0078] Arrange the Novizan DNA purification magnetic beads at room temperature for equilibration 30 minutes in advance.

[0079] Transfer the remaining fragments to a 1.5 mL centrifuge tube, add an equal volume of magnetic bead suspension, and gently mix by blowing and aspirating.

[0080] Mix by rotating at room temperature for 5 minutes, centrifuge briefly, then let stand on a magnetic rack for 5 minutes and discard the supernatant.

[0081] Add 200 μL of freshly prepared 80% ethanol (pre-cooled), let stand for 30 seconds, then discard the liquid and repeat the washing once.

[0082] After a brief centrifugation, remove any residual ethanol and allow to dry at room temperature until the surface of the magnetic beads has a matte, micro-cracked appearance.

[0083] Add 20 μL of 0.1×TE buffer, resuspend the magnetic beads by blowing and aspiration, let stand for 5 min, then magnetically separate and transfer the supernatant to a new PCR tube.

[0084] II. DNA end repair and dA tail addition

[0085] (1) Add End Repair Reaction Buffer and End Repair Enzyme Mix to the purified product in sequence, vortex to mix and then centrifuge.

[0086] (2) Place the reaction tube in the PCR instrument and follow the program (20℃ 30min → 65℃ 30min → 4℃ hold) to complete the end repair and dA tailing, and then proceed to the next step immediately.

[0087] III. Sequencing adapter ligation

[0088] (1) Inject the premixed adapter and T4 DNA ligase into the repair product, mix thoroughly and then centrifuge.

[0089] (2) Incubate in a metal bath at 20°C for 15 minutes to complete the joint connection reaction.

[0090] IV. Sorting and Purification of Ligation Product Fragments

[0091] (1) Initial magnetic bead screening

[0092] Add 0.65 times the volume of magnetic bead suspension, mix well, let stand at room temperature for 5 minutes, and then magnetically separate and discard the supernatant.

[0093] Wash twice with 80% ethanol (200 μL each time), and after drying, elute the DNA with 20 μL of 0.1×TE.

[0094] (2) Secondary magnetic bead sieving

[0095] Add 0.15 times the volume of magnetic beads to the eluent, mix well, let stand for 5 minutes, and then magnetically separate and discard the supernatant.

[0096] Repeat the ethanol washing and drying steps, and finally elute the target DNA (350±50bp) with 15μL 0.1×TE and transfer it to a new tube.

[0097] V. Library PCR Amplification

[0098] (1) Construction of the reaction system

[0099] Mix high-fidelity DNA polymerase, dNTPs, amplification primers and template DNA in the specified proportions, vortex to mix and then centrifuge.

[0100] (2) Amplification program settings

[0101] PCR instrument operating conditions: 98℃ for 30s → [98℃ for 10s, 60℃ for 30s, 72℃ for 30s] × 8 cycles → 72℃ for 5 min → Store at 4℃.

[0102] VI. Purification of Amplification Products

[0103] (1) Enrichment of target DNA with magnetic beads

[0104] Add 0.8 times the volume of magnetic bead suspension to the PCR product, mix well, let stand at room temperature for 5 minutes, and then magnetically separate and discard the supernatant.

[0105] (2) Wash twice with 80% ethanol, dry, and then elute the library DNA with 20 μL 0.1×TE.

[0106] (3) Transfer the purified product to a 1.5 mL centrifuge tube and store at -20 °C for testing.

[0107] VII. Document Quality Assessment

[0108] (1) Segment distribution verification: 1 μL of the library was analyzed by an Agilent 2100 bioanalyzer, and the main peak was confirmed to be located at 350bp±10%.

[0109] (2) Quantification and dilution: The library concentration was determined using Qubit and diluted to 1-2 ng / μL according to the sequencing platform requirements.

[0110] Example 4: Sequencing and Data Analysis

[0111] 1. Sequencing strategy: Illumina NovaSeq platform, PE150 paired-end sequencing, with each sample having a data volume of ≥1Gb.

[0112] 2. SNP typing process:

[0113] (1) Data filtering: Remove low-quality reads (Q20 < 90%) and reads containing N ratio > 5%.

[0114] (2) Alignment with reference genome: BWA software was used to align reads to the thick-shelled mussel reference genome.

[0115] (3) SNP Calling: GATK HaplotypeCaller identifies SNP sites with the following filtering criteria: depth ≥10×, MAF ≥0.05, and missing rate ≤10%.

[0116] 3. Correlation analysis:

[0117] (1) Phenotypic data: Import phenotypic data of weight traits.

[0118] (2) Model selection: Mixed linear model (MLM) is used to correct for population structure (PCA results) and kinship (K matrix).

[0119] (3) Significance determination: A fixed threshold of -log10(p) = 5 is used as the significance threshold, and the Manhattan plot is used for visualization. Figure 4 ).

[0120] Example 5: Genome-wide association study (GWAS)

[0121] Genome-wide association studies (GWAS) were performed using GEMMA (lm and lmm models), FaST-LMM, and EMMAX software, combined with phenotypic and genotypic data. The p-values ​​calculated from GWAS were further used to plot Manhattan and QQ quantile maps. Candidate thresholds were selected using 0.1 divided by the number of valid marker loci after quality control. To uncover more potential candidate regions, values ​​within -log10(p) = 5 were further fixed as candidate regions. Functional annotations were performed on the candidate genes selected using the above thresholds.

[0122] Weight trait association analysis: One trait-associated gene locus was obtained by analysis with a given threshold, and the mutation type of the variant site was A / G.

[0123] Example 6: DNA Extraction

[0124] The tissue used for this DNA extraction was the adductor muscle of a thick-shelled mussel. The extraction was performed using the TIANamp Genomic DNA Kit (blood / cell / tissue genomic DNA extraction kit, centrifuge column type). Before use, please add anhydrous ethanol to the buffer GD and wash buffer PW. Please refer to the label on the bottle for the volume to be added.

[0125] Operating steps

[0126] 1. Sample pretreatment: Preparation of tissue homogenate

[0127] (1) Take an appropriate amount of animal tissue sample, grind it with liquid nitrogen, add 1 mL of physiological saline, and vortex to prepare a single cell suspension.

[0128] (2) Transfer the suspension to a 1.5 mL centrifuge tube, centrifuge at 10,000 rpm (approximately 11,200 × g) for 1 minute, discard the supernatant, and retain the precipitate.

[0129] 2. Cell lysis and digestion

[0130] (1) Construction of lysis system: Add 200 μL of lysis buffer GA to the precipitate and vortex until the precipitate is completely resuspended.

[0131] (2) Inject 20 μL of proteinase K solution (20 mg / mL), vortex to mix, and incubate in a water bath at 56°C for 30 minutes, gently inverting and mixing every 10 minutes until the tissue is completely dissolved.

[0132] (3) Briefly centrifuge (5 seconds) to remove droplets from the tube cap.

[0133] 3. Protein denaturation removal

[0134] (1) Denaturation reaction: Add 200 μL denaturing buffer GB, vortex mix, and incubate at 70°C for 10 minutes. The solution will change from turbid to clear.

[0135] (2) Briefly centrifuge to remove droplets from the tube cap.

[0136] 4. DNA binding and purification

[0137] (1) Ethanol precipitation: Add 200 μL of pre-cooled anhydrous ethanol, vortex for 15 seconds, and flocculent DNA-protein complexes will be precipitated.

[0138] (2) After a short centrifugation, transfer all the mixture to the adsorption column CB3 (which has been loaded into a 2mL collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0139] 5. Cleaning impurities

[0140] (1) Add 500 μL of washing buffer GD (containing ethanol) to the CB3 column, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.

[0141] (2) Inject 600 μL of rinsing solution PW (containing ethanol), centrifuge under the same conditions and discard the liquid, and repeat this step once.

[0142] (3) Centrifuge the empty column at 12,000 rpm for 2 minutes to completely remove residual ethanol, and then dry at room temperature for 5 minutes after opening the lid.

[0143] 6. DNA elution and collection

[0144] (1) Elution and recovery: Transfer the CB3 column to a clean 1.5 mL centrifuge tube, add 50-200 μL of elution buffer TE (pH 8.0) to the center of the adsorption membrane, and let it stand at room temperature for 3 minutes.

[0145] (2) Centrifuge at 12,000 rpm for 2 minutes, collect the DNA solution in the tube, which is the core product, measure the concentration and purity, adjust and store at -20℃ for later use.

[0146] Example 7: SNP site verification

[0147] 1. Primer design and PCR amplification

[0148] (1) Primer sequence: Primers were designed based on the upstream and downstream sequences of the SNP site. Forward primer F: ACAGATTTCGACGCAAGGTCT (SEQ ID NO: 1), reverse primer R: TGGCCCATGGTT CTTTCTCA (SEQ ID NO: 2), amplified fragment length 487bp.

[0149] PCR reaction system (25 μL):

[0150] 2×Es Taq MasterMix——12.5μL;

[0151] Forward / reverse primers – 1 μL each;

[0152] DNA template – 1 μL;

[0153] ddH2O——9.5μL.

[0154] (2) Amplification conditions:

[0155] Pre-denaturation at 94℃ for 2 minutes;

[0156] 35 cycles: (94℃ for 30s, 57℃ for 30s, 72℃ for 30s);

[0157] Extend at 72℃ for 2 minutes.

[0158] 2. Electrophoresis and sequencing genotyping

[0159] Electrophoresis detection: Take 2 μL of PCR product and verify the singleness of the bands by electrophoresis on a 1% agarose gel (120V, 30min). Figure 1 ).

[0160] First-generation sequencing: Samples with clear bands were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to obtain the SNP locus genotypes (AA / AG / GG, see example). Figure 5 Sequencing peak diagram), and statistical analysis of genotype data for SNP loci (see Table 3 below for specific data).

[0161] 3. Statistical Analysis

[0162] (1) Chi-square test: SPSS 26.0 software was used to analyze the difference in the distribution of SNP genotypes between the low body weight group and the high body weight group. The test result was P = 0.013587602973423 < 0.05, indicating that the SNP locus was significantly associated with the body weight trait.

[0163] Table 3. Statistical results of SNP loci genotypes in the retesting phase for low-somatic and high-somatic recombination sites (with chi-square test results).

[0164]

[0165] Example 8: Cross-group validation

[0166] 1. Secondary sampling and verification

[0167] Sample collection: 200 new thick-shelled mussels were collected (100 low-body weight mussels and 100 high-body weight mussels). The weight data were measured using vernier calipers according to the method in Example 1 and sorted and grouped.

[0168] 2. Replication verification: DNA extraction was performed according to the procedure in Example 6, and PCR amplification and sequencing were performed according to the procedure in Example 7. The genotype data of the SNP locus were counted (see Table 4 below for specific data). The second test showed that P = 0.0221923546679867 < 0.05, indicating that the SNP locus was significantly associated with body weight characteristics.

[0169] Table 4. Statistical results of SNP loci genotypes for low-somatic and high-somatic recombination during the retesting phase (with chi-square test results).

[0170]

[0171] sequence list

[0172]

Claims

1. A molecular marker for SNPs related to the weight trait of thick-shelled mussels, characterized in that, The nucleotide sequence of this molecular marker is shown in SEQ ID NO: 1, and the mutation type is A / G mutation.

2. The application of the SNP molecular markers related to the weight trait of thick-shelled mussels as described in claim 1 in the breeding of thick-shelled mussels.

3. The application of the SNP molecular markers related to the weight trait of thick-shelled mussels as described in claim 1 in screening individuals with the weight trait phenotype.

4. The method for developing SNP molecular markers related to the weight trait of thick-shelled mussels as described in claim 1, characterized in that, Includes the following steps: S.

1. Collect thick-shelled mussel samples; S.

2. Measure the sample weight phenotypic data; S.3 Combined with genome-wide association analysis (GWAS), candidate SNPs significantly associated with body weight traits were screened out; S.

4. Design specific primers and utilize PCR amplification and first-generation sequencing technology; S.

5. The associated SNP markers were finally determined through a two-stage analysis of initial screening and cross-population validation.

5. The method as described in claim 4, characterized in that, The nucleotide sequences of the specific primers in S.

4. are shown in SEQ ID NO: 2-3.

6. The primers for identifying SNP molecular markers related to the weight trait of thick-shelled mussels as described in claim 1, characterized in that, The nucleotide sequence of the identification primer is shown in SEQ ID NO: 2-3.

7. The application of the identification primer as described in claim 6 in the identification of SNP molecular markers related to the weight trait of thick-shelled mussels, wherein the nucleotide sequence of the SNP molecular markers related to the weight trait of thick-shelled mussels is shown in SEQ ID NO: 1.

Images