Novel bifidobacterium bacteria

Abstract

Provided is a bacterium belonging to Bifidobacterium pseudocatenuicola, which is capable of using xylan and has excellent survivability in a culture medium containing a milk component. The bacterium belonging to the Bifidobacterium pseudocatenum has a xylanase gene on a genome, and the survivability of the bacterium in a culture medium containing milk components is higher than that of the Bifidobacterium pseudocatenum YIT 11057 (NITE BP-02930).

Description

Technical Field

[0001] This invention relates to a Bifidobacterium bacterium classified as Bifidobacterium pseudosmata. Background Technology

[0002] One reason why probiotics are thought to affect the host's physiological functions is that they metabolize sugars remaining in the digestive tract, producing short-chain fatty acids such as lactic acid and acetic acid. According to current research, the genomes of Bifidobacteria species, which are dominant in the adult gut, have more genes related to the metabolism of indigestible polysaccharides from plants, especially xylan, which is abundant in the adult diet, compared to Bifidobacteria species from infants.

[0003] The applicant has discovered to date a Bifidobacterium species possessing a xylanase gene in its genome, capable of efficiently assimilating xylans (Patent Document 1). This Bifidobacterium species shows promise for proliferation in the adult gut and exhibits a high capacity for producing organic acids, thus making it a strong candidate for probiotics targeting adults.

[0004] Existing technical documents

[0005] Patent documents

[0006] Patent Document 1: International Publication No. 2020 / 203782 Summary of the Invention

[0007] Patent Document 1 describes *Bifidobacterium pseudomicrobium* YIT 11057, which possesses a xylanase gene and is expected to actively metabolize sugars and produce organic acids in the intestine. However, it has been determined that the viability of YIT 11057 in culture media containing milk components may not be sufficient when considering its use in the production of fermented milk. Therefore, this invention relates to providing a novel bacterium belonging to *Bifidobacterium pseudomicrobium* that can utilize xylans and exhibits excellent viability in culture media containing milk components.

[0008] The inventors conducted in-depth research and obtained a novel bacterium belonging to Bifidobacterium pseudomicrobium that can efficiently assimilate xylans and exhibits excellent viability in culture media containing milk components.

[0009] That is, the present invention provides the following [1] to [6].

[0010] [1] A bacterium belonging to Bifidobacterium pseudomicrobium has a xylanase gene in its genome and has a higher survival rate in a culture medium containing milk components than Bifidobacterium pseudomicrobium YIT 11057 (NITE BP-02930).

[0011] [2] The bacteria described in [1] wherein the xylanase gene is a polynucleotide consisting of the base sequence shown in sequence number 1, or a polynucleotide having more than 70% homology with the base sequence and encoding a protein having xylanase activity.

[0012] [3] The bacteria described in [1] have a survival rate of more than 20% after being cultured in a culture medium containing milk components for 24 hours and stored at low temperature for 2 weeks.

[0013] [4] A strain of Bifidobacterium pseudomicrobium Y 51493 (NITE BP-03852), Bifidobacterium pseudomicrobium YIT 13179 (NITE BP-03853), or a closely related strain.

[0014] [5] A food or beverage containing any of the bacteria described in any of [1] to [4].

[0015] [6] As described in [5], the food and beverage is a fermented dairy food and beverage.

[0016] The novel bacteria of this invention, belonging to the Bifidobacterium pseudobulb, possess the ability to break down and assimilate xylans, particularly arabinoxylans, which are abundant in the adult diet, and exhibit excellent viability in culture media containing milk components. Therefore, the bacteria of this invention are expected to proliferate in the adult gut and have a high capacity for producing organic acids, making them suitable for use as probiotics in pharmaceuticals, food products, and the like. Attached Figure Description

[0017] Figure 1 This indicates the change in viable cell counts of Y51493 and YIT 11057 cultured on a medium containing milk components during storage.

[0018] Figure 2 This indicates the change in the survival rate of Y51493 and YIT 11057 cultured in a medium containing milk components during storage.

[0019] Figure 3 This is an example of the genome structure of a strain (transformant) from which the xylanase gene of *Bifidobacterium pseudomicrobe* was obtained. The corresponding single nucleotide polymorphisms (SNPs) in each strain are indicated by gray lines.

[0020] Figure 4 The figures show the proliferation curves of the donor (Bifidobacterium pseudomicrobium YIT 11027), the recipient (Bifidobacterium pseudomicrobium YIT 11956), and the gene-acquiring strain (transformant) in mPY-AX medium.

[0021] Figure 5The figures show the proliferation curves of the donor (Bifidobacterium pseudomicrobium YIT 11027), the recipient (Bifidobacterium pseudomicrobium YIT 11956), and the gene-acquiring strain (transformant) in mPY-Starch medium.

[0022] Figure 6 The donor (Bifidobacterium pseudosporidis YIT 4072) T Colony formation of the receptor (Bifidobacterium pseudosporidis YIT 12824) and the gene-acquiring strain (transformant) in Tc-mGAML medium.

[0023] Figure 7 The transformation frequency is the frequency when (A) live or dead bacterial cells, (B) live bacterial cells, genomic DNA or PCR products, or (C) DNase-treated live bacterial cells are used as donors.

[0024] Figure 8 This indicates the change in viable cell count and survival rate on day 28 of storage of YIT 13179 and Y 51493 cultured in a medium containing milk components. Detailed Implementation

[0025] The bacteria of this invention are *Bifidobacterium pseudomicrobium* bacteria that possess a xylanase gene in their genome and exhibit excellent survival in culture media containing milk components. In one embodiment, the bacteria of this invention are *Bifidobacterium pseudomicrobium* bacteria that possess a xylanase gene in their genome and exhibit higher survival in culture media containing milk components than *Bifidobacterium pseudomicrobium* YIT 11057 (NITEBP-02930). YIT 11057 possesses a xylanase gene in its genome. YIT 11057 was deposited on March 25, 2019, at the Patent and Microbial Collection Center of the Technical Base for Product Evaluation (Room 122, 2-5-8 Kamisama, Kisarazu City, Chiba Prefecture).

[0026] "Xylanase gene" refers to the gene encoding xylanase classified as GH10 (endonuclease-1,4-β-xylanase A, xynA), which is the "xylanase gene" retained in the genome of the bacteria belonging to Bifidobacterium pseudomicrobium of the present invention. Specifically, it comprises: a polynucleotide consisting of the base sequence shown in Serial No. 1; or a polynucleotide having 70% or more, preferably 90% or more, more preferably 95% or more, more preferably 98% or more, more preferably 99% or more homology with the base sequence and encoding a protein having xylanase activity.

[0027] Here, the polynucleotide consisting of the base sequence shown in sequence number 1 refers to the xylanase gene retained by YIT 11057.

[0028] Furthermore, for homology of base sequences, the two nucleic acid sequences to be compared are arranged in such a way that as many bases as possible are identical. The number of identical bases is divided by the total number of bases, and the resulting value is expressed as a percentage. Anyone skilled in the art can appropriately set the parameters of software such as BLAST, ClustalX, or Genetyx to determine the homology of base sequences.

[0029] In addition, xylanase activity refers to the activity of hydrolyzing the xylose backbone of xylan to produce xylooligosaccharides and xylose using xylan as a substrate (xylan hydrolysis activity).

[0030] Here, examples of xylans include xylan, arabinoxylan, glucuronic acid xylan, glucuronic acid arabinoxylan, acetylxylan, etc., with xylan and arabinoxylan being preferred.

[0031] Therefore, in other words, bacteria belonging to Bifidobacterium pseudomicrobium that possess the xylanase gene in their genome are bacteria belonging to Bifidobacterium pseudomicrobium that have the ability to break down the xylose backbone of xylan.

[0032] In this invention, "having the ability to assimilate xylan" refers to the ability to propagate using xylan as a carbon source. Specifically, this means, for example, the ability to propagate in a culture medium using xylan as the sole carbon source. For example, it refers to the turbidity, such as OD, after culturing for 72 hours in a culture medium using only xylan as the sugar source. 600 The increase should be 0.1 or more. Turbidity is preferred at OD. 600 The increase is 0.3 or more, more preferably 0.4 or more. Furthermore, in cases where changes in turbidity cannot be measured, such as in culture media containing xylan with a high proportion of insoluble components, the increase refers to the total amount of short-chain fatty acids produced in the culture supernatant after 72 hours of culture, such as lactic acid, acetic acid, and formic acid, being 10 mM or more. The total amount of short-chain fatty acids produced is preferably 20 mM or more, more preferably 40 mM or more.

[0033] The culture medium used in the test of xylan assimilation capacity can be any medium containing xylan added to a sugar-removed medium. The sugar-removed medium can be composed of M-ILS medium, peptone-yeast (PY) medium, etc.

[0034] The amount of xylan added to the culture medium is preferably 0.01 to 10% by mass, more preferably 0.05 to 5% by mass, and even more preferably 0.1 to 1% by mass. It should be noted that, preferably as a control, the bacteria belonging to Bifidobacterium pseudosporidis, which are the target bacteria, are cultured in a culture medium in which the sugar source has been removed, and the OD is confirmed in advance.

[0035] "Milk components" refers to substances containing milk-derived components, such as raw milk, heated milk, skim milk powder, whole milk powder, cream, and whey, from animal milk such as cow's milk, goat's milk, and sheep's milk. Skim milk powder is a preferred example. It should be noted that "whey" refers to the substance obtained by removing fat and casein from milk.

[0036] As a "culture medium containing milk components," any culture medium containing milk components is acceptable, but it may further include other components such as sugars, vitamins, protein breakdown products, amino acids, minerals, salts, surfactants, fatty acids, and metals. Furthermore, there are no particular limitations on these other components, but sugars such as glucose, galactose, lactose, and fructose are preferred.

[0037] The content of milk components in the culture medium is not particularly limited, but when converted to solid components, it is preferably 1 to 50% by mass (hereinafter, when referred to only as “%”, it means mass%), and more preferably 2 to 10%.

[0038] The term "viability in a culture medium containing milk" refers to the extent to which *Bifidobacterium pseudosporidis*, the target bacteria, remain viable after culturing for 24 hours in a milk-containing medium and then storing at low temperature for 2 weeks. The viable count can be determined using conventional methods. For example, the viable count in a milk-containing medium can be determined by colony counting. Alternatively, the survival rate can be expressed as the ratio of the viable count after 2 weeks of low-temperature storage to the viable count immediately after 24 hours of culture. Here, "low temperature" refers to the temperature range commonly used for preserving microorganisms, preferably below 10°C.

[0039] The statement that "its survival rate in a culture medium containing milk components is higher than that of Bifidobacterium pseudosporidis YIT 11057" more specifically means that after being cultured in a culture medium containing milk components for 24 hours and then stored at low temperature for 2 weeks, the survival rate is preferably 20% or more, more preferably 40% or more, and even more preferably 50% or more.

[0040] The bacteria belonging to *Bifidobacterium pseudomicrobium* of this invention possess a xylanase gene in their genome, enabling them to decompose and assimilate xylans. Therefore, they can contribute to the supply of short-chain fatty acids such as acetic acid, lactic acid, and formic acid produced from the decomposition of xylans. Furthermore, the bacteria belonging to *Bifidobacterium pseudomicrobium* of this invention exhibit high survival rates in culture media containing milk components, thus effectively exerting their physiological effects and making them useful in the manufacture of pharmaceuticals, food products, and the like.

[0041] The bacteria belonging to *Bifidobacterium pseudomicrobium* of the present invention can be obtained by screening, for example, from bacteria belonging to *Bifidobacterium pseudomicrobium* present in the intestines of humans (e.g., adults, infants), using the presence of a xylanase gene or the ability to assimilate xylans as described above, and their survival in a culture medium containing milk components as indicators. Alternatively, the bacteria belonging to *Bifidobacterium pseudomicrobium* of the present invention can be obtained by screening, for example, from bacteria belonging to *Bifidobacterium pseudomicrobium*, such as bacteria belonging to *Bifidobacterium pseudomicrobium* present in the intestines of humans (e.g., adults, infants), as a mother strain and prepared using known breeding methods; from bacteria prepared by treating the mother strain with ultraviolet light or with mutagenic agents such as nitrosoguanidine (NTG) or ethyl methanesulfonic acid (EMS); or from bacteria prepared by modifying the genome of the mother strain using known site-specific mutation introduction methods. Alternatively, the bacteria belonging to *Bifidobacterium pseudomicrobium* of the present invention can be obtained by screening, for example, from bacteria produced using any *Bifidobacterium pseudomicrobium* bacteria, such as those present in the intestines of humans (e.g., adults, infants), as recipients (mother strains), through the transformation method of *Bifidobacterium* bacteria detailed in Reference Examples 1 or 2 below, using the presence of a xylanase gene, the ability to assimilate xylanase as described above, and using any *Bifidobacterium pseudomicrobium* bacteria as recipients (mother strains). Here, as the mother strain, bacteria belonging to *Bifidobacterium pseudomicrobium* that possess a xylanase gene in their genome are preferred, and YIT 11057 is more preferred.

[0042] As shown in Example 1 below, the inventors used YIT 11057 as the mother plant and bred it through UV irradiation and long-term subculturing to obtain Y 51493, which showed higher survival rates in a culture medium containing milk components than YIT 11057. Furthermore, as shown in Example 2 below, YIT 13179, which showed equivalent survival rates in a culture medium containing milk components to Y51493, was obtained through transformation of Y 51493. The bacteria belonging to *Bifidobacterium pseudomicrobium* of the present invention are not limited to those possessing a xylanase gene in their genome and exhibiting higher survival rates in a culture medium containing milk components than YIT 11057; they include strains that are biologically and genetically closely related to them. Furthermore, the bacteria belonging to *Bifidobacterium pseudomicrobium* of the present invention, as long as they possess a xylanase gene in their genome and exhibit higher survival rates in a culture medium containing milk components than YIT 11057, can be naturally occurring strains, variants of natural strains, or transgenic strains.

[0043] Y 51493 and YIT 13179, as shown below, were deposited on March 13, 2023, at the Patent and Microbial Collection Center of the Technical Base for Product Evaluation (Room 122, 2-5-8 Kazusa-Kamazu, Kisarazu City, Chiba Prefecture).

[0044] Bifidobacterium pseudobulb Y 51493 (NITE BP-03852)

[0045] Bifidobacterium pseudobulb YIT 13179 (NITE BP-03853).

[0046] Among these, YIT 13179 or its closely related strains are preferred, considering their ability to assimilate xylan, their survival in culture media containing milk components, and, more importantly, their glucose assimilation ability. By possessing glucose assimilation ability, it is expected that organic acids can be produced from polysaccharides or oligosaccharides whose constituent sugars are glucose.

[0047] Here, glucose assimilation capacity refers to the ability to multiply using glucose as a carbon source.

[0048] In addition, closely related strains refer to strains whose sequences are identical through multilocus sequence analysis (MLSA) that evaluates multiple housekeeping gene sequences.

[0049] Specifically, the genes obtained as suitable for MLSA analysis of Bifidobacterium and reported in the International Journal of Systematic and Evolutionary Microbiology (2006), 56, 2783-2792, are DNA gyrase subunit B (gyrB), 50S ribosomal protein L2 (rplB), amidophosphoribosyltransferase (purF), DNA-directed RNA polymerase subunit beta (rpoB), ATP-dependent Clp protease ATP-binding subunit ClpC1 (clpC), elongation factor G (fusA), and isoleucine-tRNA ligase (fusA) are described in the report (International Journal of Systematic and Evolutionary Microbiology (2006), 56, 2783-2792). The full-length sequence of ligase)(ileS) was obtained, and after linking all genes of each strain, the sequence consistency between the comparison strains was verified using programs such as VSEARCH or BLAST. If the sequence homology was 90% or more, preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more, they could be identified as closely related species.

[0050] The base sequences of the gyrB, rplB, purF, rpoB, clpC, fusA, and ileS genes in YIT 11057 are shown in the sequence listing (gyrB: sequence number 2, rplB: sequence number 3, purF: sequence number 4, rpoB: sequence number 5, clpC: sequence number 6, fusA: sequence number 7, ileS: sequence number 8).

[0051] The utilization form of the bacteria belonging to Bifidobacterium pseudosporidis of the present invention is not particularly limited. It can be freeze-dried bacteria or in the form of a culture containing these bacteria. However, in either form, the bacteria are preferably in a live state.

[0052] The bacteria belonging to *Bifidobacterium pseudosporidis* of this invention can also be mixed with solid or liquid pharmaceutical non-toxic carriers and utilized in conventional pharmaceutical formulations. Examples of such formulations include solid dosage forms such as tablets, granules, powders, and capsules; liquid dosage forms such as solutions, suspensions, and emulsions; and freeze-dried formulations. These formulations can be prepared using conventional pharmaceutical methods. Examples of the aforementioned pharmaceutical non-toxic carriers include glucose, lactose, sucrose, starch, mannitol, dextrin, fatty acid glycerides, polyethylene glycol, hydroxyethyl starch, ethylene glycol, polyoxyethylene sorbitan fatty acid esters, amino acids, gelatin, albumin, water, and physiological saline. Furthermore, conventional additives such as stabilizers, wetting agents, emulsifiers, binders, isotonic agents, and excipients can be added as needed.

[0053] The bacteria belonging to *Bifidobacterium pseudosporidis* of this invention can not only be formulated into the preparations described above, but can also be used in food and beverage products. When used in food and beverage products, they can be contained directly or together with various nutrients. Specifically, when incorporating the bacteria belonging to *Bifidobacterium pseudosporidis* of this invention into food and beverage products, food additives suitable for use in food and beverage products can be appropriately used, and conventional methods can be used to shape them into edible forms, such as granules, pellets, tablets, capsules, pastes, etc. Furthermore, they can be added to various foods, such as processed meat products like ham and sausages; processed seafood products like Japanese fish cakes and chikuwa; bread, sweets, butter, and milk powder; or added to beverages such as water, fruit juice, milk, soft drinks, and tea drinks. It should be noted that animal feed is also included in the food and beverage products.

[0054] Furthermore, as a food and beverage product, fermented dairy products, fermented soy milk, fermented fruit juice, fermented vegetable juice, and other fermented foods containing the *Bifidobacterium pseudomicrobium* bacteria of the present invention in a live state can be appropriately used, with fermented dairy products being particularly preferred. The manufacture of fermented dairy products can be carried out using conventional methods. For example, in the case of manufacturing fermented milk, the *Bifidobacterium pseudomicrobium* bacteria of the present invention are inoculated and cultured alone or simultaneously with other microorganisms in a sterilized milk culture medium, and then homogenized to obtain a fermented milk base. Next, a separately prepared syrup solution is added and homogenized using a homogenizer, flavoring is further added, and finally, the product is processed into a final product. Fermented dairy products prepared in this manner can also be made into any form of product, such as plain, soft, fruit-flavored, solid, or liquid, without syrup (sweetener).

[0055] This fermented dairy product can be combined with any ingredients such as sweeteners like syrup, emulsifiers, thickeners (stabilizers), and various vitamins. As a syrup, it can be combined with sugars such as glucose, sucrose, fructose, fructose-glucose syrup, glucose-fructose syrup, balakinose, trehalose, lactose, xylose, galacto-oligosaccharide (GOS), xylooligosaccharide (XOS), arabinoxylose (AXOS), xylan, arabinoxyl, arabinolose (AOS), polyarabinose, maltose, honey, and molasses; sugar alcohols such as sorbitol, xylitol, erythritol, lactitol, palatinol, reducing maltose, and reducing maltose; high-sweetness sweeteners such as aspartame, sematrandez, sucralose, acesulfame K, and stevia; emulsifiers such as glyceryl fatty acid esters, polyglyceryl fatty acid esters, sorbitan fatty acid esters, and lecithin; and thickeners (stabilizers) such as agar, gelatin, carrageenan, guar gum, xanthan gum, pectin, locust bean gum, gellan gum, carboxymethyl cellulose, soybean polysaccharides, and propylene glycol alginate. In addition, it can be combined with vitamins such as vitamin A, B vitamins, vitamin C, and vitamin E; minerals such as calcium, magnesium, zinc, iron, and manganese; acidic ingredients such as citric acid, lactic acid, acetic acid, malic acid, tartaric acid, and gluconic acid; dairy fats such as cream, butter, and sour cream; flavorings such as yogurt, berry, orange, pear, perilla, citrus, apple, mint, grape, apricot, pear, custard, peach, melon, banana, tropical fruit, herbal, black tea, and coffee; and herbal extracts and brown sugar extracts.

[0056] Microorganisms other than Bifidobacterium pseudosporidis can also be used in the manufacture of fermented dairy products. Examples of such microorganisms include *Lactobacillus* species such as *Lactaseibacillus paracasei*, *Lactobacillus casei*, *Lactobacillus acidophilus*, *Lactobacillus plantarum*, *Lactobacillus buchneri*, *Lactobacillus gallinarum*, *Lactobacillus amylovorus*, *Lactobacillus brevis*, *Lactobacillus rhamnosus*, *Lactobacillus kefir*, *Lactobacillus paracasei*, *Lactobacillus cristata*, *Lactobacillus zeae*, *Lactobacillus helveticus*, *Lactobacillus salivalius*, *Lactobacillus gasseri*, *Lactobacillus fermentum*, *Lactobacillus reuteri*, and *Lactobacillus delbrueckii* subsp. bulgaricus. Lactobacillus subsp. bulgaricus, Lactobacillus delbrueckii subsp. delbrueckii, Lactobacillus johnsonii, and other Lactobacillus species; Streptococcus thermophilus and other Streptococcus species; Lactococcus lactis subsp. lactis and other Lactococcus species; Enterococcus faecalis and E. faecium and other Enterococcus species; Bacillus subtilis and other Bacillus species; and yeasts belonging to the genera Saccharomyces sescerevisiae, Torulaspora delbrueckii, and Candidakefyr, etc. If fermented dairy products are made together with one or more bacteria selected from the genera *Lactobacillus*, *Streptococcus*, and *Lactococcus*, in conjunction with the bacteria belonging to *Bifidobacterium pseudosporidis* of the present invention, higher palatability can be obtained, making consumption easier, and therefore this is preferred.

[0057] When using the bacteria belonging to *Bifidobacterium pseudosporidis* of the present invention, there is no strict limitation on the dosage; the preferred dosage, based on viable count, is 10 per day. 5 CFU~10 13 CFU, preferably 10 8 CFU~10 12 CFU.

[0058] Example

[0059] Next, embodiments will be given to further illustrate the invention in detail, but the invention is not limited thereto.

[0060] Example 1: Preparation of a bacterium belonging to *Bifidobacterium pseudomicrobium* possessing a xylanase gene and exhibiting excellent survival in a culture medium containing milk components.

[0061] Using Bifidobacterium pseudosporidis YIT 11057 as the mother strain, the following breeding was carried out to confirm the number of viable bacteria (proliferation) and viability in the culture medium containing milk components.

[0062] (1) Breeding

[0063] YIT 11057 frozen bacterial culture (1%) was inoculated into modified GAM (mGAM) liquid medium (Niksui Pharmaceutical Co., Ltd.) and statically cultured at 37°C for 4 hours under anaerobic conditions. The bacterial culture was then diluted 10-fold with PBS. The diluted bacterial culture was dropped into the center of a petri dish and subjected to ultraviolet irradiation (wavelength 254 nm, illuminance approximately 0.2 mW / cm²) under conditions where the survival rate after ultraviolet irradiation in the preliminary study was approximately 1%. 2 The UV-irradiated bacterial culture was passaged in a mother culture medium (12% skim milk powder, 0.1% yeast extract, 0.03% L-cysteine ​​hydrochloride monohydrate, 0.2% calcium carbonate, sterilization conditions: 115℃, 20 minutes). The process of static incubation at 37℃ for 24 hours followed by refrigeration at 4℃ or 10℃ for 2 weeks was repeated 18 times (36 weeks). It should be noted that refrigeration was carried out under anaerobic conditions based on AnaeroPack (Mitsubishi Gas Chemical) in the aforementioned mother culture medium.

[0064] The cold-stored bacterial culture was plated at an appropriate concentration onto mGAM agar plates containing 1% lactose and adjusted to pH 4.4 or 4.6 with 4M hydrochloric acid. After 14 days of anaerobic incubation at 37°C, colonies were collected and transferred to mGAM liquid medium containing 1% lactose. After 20 hours of anaerobic incubation at 37°C, the culture was plated onto TOS propionic acid agar plates and incubated again at 37°C for approximately 48 hours. Colonies were then collected and transferred to mGAM liquid medium containing 1% lactose. This process was repeated twice to obtain *Bifidobacterium pseudosporidis* Y 51493.

[0065] (2) Confirmation of viable bacterial count and survival rate

[0066] In the viability study, frozen bacterial suspensions of strains YIT 11057 and Y 51493 were inoculated into mother culture medium and pre-cultured at 37°C for 24 hours. Then, 5% of the suspensions were inoculated into the mother culture medium and formally cultured at 37°C for 24 hours. The bacterial suspensions were then refrigerated at 4°C for 0, 7, and 14 days. Serially diluted YIT 11057 and Y 51493 bacterial suspensions were spread onto TOS propionic agar plates and incubated anaerobically at 37°C for 48 hours. Viable cell counts were then determined. The survival rate was calculated based on the measured viable cell counts. The survival rate was expressed as a percentage obtained by dividing the measured viable cell count by the number of viable cells stored for 0 days. The results are shown below. Figure 1 , 2 The results confirmed that Y51493, obtained through breeding, had superior viable bacterial count (proliferation) and survival rate in culture media containing milk components compared to YIT 11057.

[0067] Reference Example 1: Discovery of genome mosaicism in Bifidobacteria.

[0068] By analyzing the assimilation of indigestible polysaccharides from strains of *Bifidobacterium pseudomicrobium* and their genomes, it was found that some strains exhibit assimilation of long-chain xylans, defined by the xylanase (BpXyn10A) gene located in the chromosome. When a phylogenetic tree of strains possessing the xylanase gene is constructed based on the genomic information of *Bifidobacterium pseudomicrobium* strains, the strains are dispersed throughout the phylogenetic tree rather than concentrated in specific clusters (Non-Patent Literature 1). This suggests that horizontal transfer of the xylanase gene occurs between strains. Therefore, the horizontal transfer of the xylanase gene was verified in vitro.

[0069] Generally, horizontal gene transfer in bacteria is known to occur in three forms: natural transformation via extracellular DNA uptake; transduction via phage infection; and conjugation mediated by plasmids or other transfer agents. Therefore, to detect any phenomenon, two strains of *Bifidobacterium pseudosporidis* with different phenotypes were cultured separately and then co-cultured on agar medium for a certain period to verify horizontal gene transfer.

[0070] (1) Use of strains

[0071] Strains of *Bifidobacterium pseudomicrobium* (YIT11025, YIT 11027, YIT 12242, YIT 12820, YIT 12824, YIT 12986) with xylanase gene and tetracycline (Tc) sensitivity were used as donors, and strains of *Bifidobacterium pseudomicrobium* (YIT 4072) without xylanase gene and Tc resistance were used as donors. T YIT 11955, YIT 11956, YIT 12228, YIT 12818, YIT 12822, and YIT 12987 serve as receptors.

[0072] (2) Verification method for horizontal transfer of xylanase gene

[0073] Each strain of donor and recipient bacteria was inoculated into modified GAM (mGAM) liquid medium (Niksui Pharmaceutical Co., Ltd.) supplemented with 0.5% glucose-lactose and cultured until the logarithmic growth phase. 200 μL each of the donor and recipient bacterial cultures were mixed (approximately 10⁻⁶ cells / mL based on bacterial count). 8-9After centrifugation, the supernatant was removed using a 200 μL pipette. The particles were resuspended using a small amount of culture medium remaining in the pipette, and the entire volume was then placed on mGAM agar (Niksui Pharmaceutical Co., Ltd.). After anaerobic culture at 37°C for 16–24 hours, bacterial cells were scraped using a 1 μL inoculation loop and inoculated into mPY-AX-Tc liquid medium (mPY medium: refer to Non-Patent Literature 1, arabinoxylan (AX): final concentration 0.5% by mass, Tc: final concentration 10 μg / mL), which cannot proliferate when the donor or recipient is alone. Turbidity was monitored using an Eon microplate spectrophotometer (Biotech). For a subset of combinations where turbidity increases were confirmed in the selected medium, subculture was performed in fresh, identical medium to confirm the reproducibility of the turbidity increase. The bacterial culture was spread onto mGAM agar medium containing Tc (final concentration 10 μg / mL) and anaerobically cultured overnight at 37°C. The resulting single colonies were then passaged in the same agar medium. The next day, a portion of the bacterial cells was transferred to mPY-AX-Tc liquid medium, and another portion was suspended in TE buffer and heated at 95°C for 5 minutes to prepare a simple PCR template. To confirm proliferation in mPY-AX-Tc medium, and with YIT 11956 as the receptor, PCR was performed using receptor (YIT 11956) specific primers (BP28-f: GGGCAAGATCGGCATCATCTA (SEQ ID NO. 10), BP28-r: CACATTGGTGGTGTTCACGTC (SEQ ID NO. 11)) and xylanase gene specific primers (pBpXyn10A-F: CGAGAATGCGAACACGTACTTC (SEQ ID NO. 12), pBpXyn10A-R: CTGCTCGGTGTTGTAATCGTTG (SEQ ID NO. 13)) to identify the strain and confirm the presence of the same gene. Colonies confirmed to contain the xylanase gene were cryopreserved.

[0074] (3) Genome analysis methods

[0075] DNA was extracted from the bacterial cells obtained in (2), and short and long read sequences were obtained using the second-generation sequencer Miseq (Illumina Corporation) and the third-generation sequencer MinION (Oxford Nanopore Technologies). These sequences were then mixed and assembled to obtain the full-length genome sequence. The genome sequences of the donor strain, recipient strain, and gene-acquiring strain were sequenced using snippy (https: / / github.com / tseemann / snippy), and the sequenced results were input into fastGEAR (Mostowy et al., Molecular Biology and Evolution 34(5), 1167-1182) to identify homologous recombination regions. Additionally, single nucleotide polymorphism (SNP) information was extracted from the genome sequence using the nucmer, delta-filter, and show-snps functions of the MUMMER (Kurtz et al., Genome Biology 5, R12, 2004) software package. After adjusting the output file format using a custom script, homologous recombination regions were visualized using Artemis ACT (Sanger Institute).

[0076] (4) Validation results of horizontal transfer of xylanase gene

[0077] After mixing the donor and recipient, the mixture was anaerobically cultured overnight on mGAM agar. The bacteria were then introduced into mPY-AX-Tc liquid selective medium, and proliferation was monitored. The results showed an increase in turbidity in multiple donor-recipient combinations. Specifically, YIT 11956 or YIT 4072 were used. T Genome analysis was performed on 13 gene-acquiring strains obtained as recipients and YIT 11025, YIT 11027, YIT 12820, or YIT12824 as donors. The results confirmed that each gene-acquiring strain possessed a xylanase gene, closely related to the recipient strain rather than the donor strain. Furthermore, it was determined that the xylanase gene on the chromosome was transferred from the donor strain possessing the xylanase gene to the recipient strain not possessing the xylanase gene. Figure 3 Table 1). It was confirmed that strains with the transferred xylanase gene could proliferate in mPY-AX medium (…). Figure 4 ).

[0078] A detailed comparison of the genome sequences at the SNP level revealed that in the gene-acquired strains, SNPs in regions ranging from 16.5 to 247 kb upstream and downstream of the newly acquired xylanase gene were identical to those in the donor. This indicates that in the gene-acquired strains, horizontal transfer of the xylanase gene occurred through homologous recombination with widespread double crossovers, resulting in the replacement of the donor genome regions containing the xylanase gene and its upstream and downstream components. Furthermore, the replacement of genome regions occurred mosaicically within the overall genome, and the replacement regions varied depending on the strain. Specifically, each strain had up to seven locations across a region spanning 0.5–247 kb from the donor genome (…). Figure 3 On the other hand, no traces of phages or plasmids were detected in the replacement region.

[0079] To verify the generality of this phenomenon, we also attempted to verify the horizontal transfer of other genes in *Bifidobacterium pseudospinipes*. First, we focused on the amylase gene, which specifies starch assimilation. Using a strain of *Bifidobacterium pseudospinipes* (YIT 11027) with the amylase gene and Tc sensitivity as the donor, and a strain of *Bifidobacterium pseudospinipes* (YIT 11956) without the amylase gene and Tc resistance as the recipient, we used the same method as in (2). When the mixed cells of each strain were planted on mPY-St-Tc (starch (St): final concentration 0.5% by mass%, Tc: final concentration 10 μg / mL) liquid medium, we confirmed that strains exhibited genomic mosaicism and horizontal transfer of the amylase gene (Table 1). We confirmed that the strains with transferred amylase genes could proliferate in mPY-Starch medium ( Figure 5 Furthermore, the focus was also on the Tc resistance gene. A strain of *Bifidobacterium pseudosporidis* (YIT 4072) possessing the Tc resistance gene and sensitive to erythromycin (Em) was used. T YIT 11955 and YIT 12987 were used as donors, and a strain of *Bifidobacterium pseudosporidis* (YIT 12824) without the Tc resistance gene and resistant to Em was used as the recipient. Using the same method as in (2), the mixed bacterial cells were spread onto 0.5% lactose-added modified GAM (mGAML) (EmTc-mGAML) agar medium supplemented with Em (final concentration 1 μg / mL) and Tc (final concentration 10 μg / mL). Strains exhibiting genomic mosaicism and horizontal transfer of the Tc resistance gene were identified (Table 1). The strains with transferred Tc resistance genes were confirmed to be able to proliferate in Tc-mGAML medium. Figure 6 ).

[0080] [Table 1]

[0081]

[0082] Reference Example 2: Verification of natural transformation in Bifidobacteria

[0083] In the mosaicking of the genomes of Bifidobacteria, the absence of traces of horizontal transfer of bacteriophages or plasmids verified whether it was based on natural transformation.

[0084] (1) Use of strains

[0085] The baseline strain of *Bifidobacterium pseudosporidis*, YIT 4072, was used, which is Tc-resistant and Em-sensitive. T Tc-sensitive and Em-resistant Bifidobacterium pseudosporidis YIT 12824 was used as the donor and the recipient.

[0086] (2) Methods for extracting genomic DNA used as a donor and preparing PCR products

[0087] YIT 4072 T The DNA was cultured overnight in mGAML liquid medium, and high-molecular-weight genomic DNA was purified using a NucleoBond Buffer Kit III and a NucleoBond AXG20 column (Takara Bio Inc.). The amount of double-stranded DNA was quantified using a Picogreen kit and diluted to 30 ng / μL with TE buffer. Using this genomic DNA as a template, a region containing the Tc resistance gene (tetW) of approximately 20 kb was amplified by PCR. The high-fidelity enzyme PrimeSTARGXL DNA polymerase (Takara Bio Inc.) was used for PCR. 0.2 μL of enzyme, 0.04 μL each of 50 μM primers (serial numbers 14 and 15), 1 μL of template DNA (0.02 ng / μL), 1.6 μL of dNTP solution, and 4 μL of 5× buffer were mixed to make a reaction volume of 20 μL per PCR tube. The obtained PCR product was precipitated with ethanol and then dissolved in TE buffer. After quantifying the double-stranded DNA using Picogreen, it was diluted with TE buffer to 1 ng / μL and then divided into small portions for cryopreservation.

[0088] The primers and PCR conditions used in this embodiment are shown in Table 2.

[0089] [Table 2]

[0090]

[0091] (3) Methods for preparing dead bacterial bodies

[0092] YIT 4072 TThe cells were cultured in 2 mL of mGAML liquid medium until the late logarithmic growth phase. After washing with mPY liquid medium, the particles were suspended in 180 μL of the same medium. 20 μL was aliquoted into 1.5 mL screw-cap tubes and heated at 80°C for 10 minutes using a heating block to prepare dead cells. This treatment confirmed complete cell death.

[0093] (4) Verification of horizontal transfer of antibiotic resistance genes using live bacteria, heat-killed bacteria, and purified DNA as donors.

[0094] YIT 4072 T Frozen bacterial cells of various strains, including YIT 12824, were inoculated into mGAML agar medium and cultured anaerobically at 37°C. The resulting bacterial cells were then subcultured in 400 μL of the same liquid medium. After 3–4 hours of culture, an additional 1600 μL of the same liquid medium was added, and the cells were cultured from the late logarithmic growth phase for 4–5 hours until the stationary phase was reached. The bacterial suspensions were collected, washed with mPY liquid medium, and then resuspended in 180 μL of the same medium. 5 μL of the recipient (YIT 12824) bacterial suspension and 5 μL of the donor (YIT 4072) bacterial suspension were then added to the medium. T 5 μL of live bacterial solution prepared in (3) or purified DNA prepared in (2) were mixed (approximately 10 μL each based on bacterial count). 7-8 All cells were placed on mGAM agar medium and anaerobically cultured at 37°C for 16–24 hours. Then, all cells were scraped using a 1 μL inoculation loop, suspended in 60 μL of mPY liquid medium, serially diluted, and spread onto EmTc-mGAML agar medium. After anaerobic culture at 37°C for 2–3 days, the colony count was performed. For a subset of colonies, genome analysis was performed in the same manner as in Example 1(3), confirming homologous recombination.

[0095] (5) Verification of the effects of adding DNA-degrading enzyme (DNase I)

[0096] YIT 4072 was prepared in the same manner as (4). TThe cleaned live bacterial suspension of YIT 12824 was used. 20 μL of each strain of the cleaned bacterial suspension was aliquoted into 1.5 mL tubes and mixed. After centrifugation, the particles were resuspended in 40 μL of 1×DNase I buffer (Takara Bio Inc.). 8 μL of recombinant DNase I (Takara Bio Inc.) was added, either as a stock solution (5 U / μL) or diluted to 1 / 10 (0.5 U / μL) or 3 / 10 (1.5 U / μL) using 1×DNase I buffer. 12 μL of each suspension was incubated on mGAM agar, with three incubation sites for each condition. After anaerobic culture of the agar medium containing the bacterial cells at 37°C for 16 hours, all bacterial cells were scraped using a 1 μL inoculation loop, resuspended in 60 μL of mPY liquid medium, and then appropriately diluted using the same medium. To determine the number of bacteria with horizontally transferred Tc resistance genes, bacterial suspensions were spread onto EmTc-mGAML agar medium. Additionally, to determine the total viable count of Em-resistant strains, bacterial suspensions were also spread onto Em-mGAML agar medium. Each agar medium was incubated anaerobically at 37°C for 2–3 days, and the ratio of mosaicized bacteria to the total viable count of Em-resistant strains was taken as the mosaic frequency.

[0097] (6) Results

[0098] YIT 4072 from the donor T Live cells of the Tc-resistant strain and the recipient YIT 12824 (Em-resistant strain) were mixed and anaerobically cultured overnight on mGAM agar. The presence of two resistant strains in the selective medium, where either the donor or recipient alone failed to proliferate, was investigated. The results showed colonies exhibiting resistance to both antibiotics. Genome analysis of the six strains identified mosaic homologous recombination in multiple regions containing the Tc resistance gene and its vicinity. The number of recombination regions ranged from 1 to 4, with the largest recombination region ranging in length from 22 to 112 kb.

[0099] When using dead bacterial cells as donors, although the frequency decreased compared to using live bacterial cells as donors, horizontal transfer of the Tc resistance gene was confirmed. Figure 7 A). Similarly, even when the donor is replaced with genomic DNA or PCR products, horizontal transfer still occurs. Figure 7 B). When using dead bacterial cells as donors, in the two strains with analyzed genomes, the number of recombination regions was 1–2, and the largest recombination region was 16–45 kb. When using genomic DNA as donors, in the two strains with analyzed genomes, the number of recombination regions was 1, and the largest recombination region was 12–16 kb in length. Using YIT 4072... TWhen PCR products prepared using genomic DNA as a template are used as donors, the number of recombination regions in one strain after genome analysis is 1, and the maximum recombination region length is 12kb. Furthermore, in experimental systems using live bacteria as donors, the addition of DNA hydrolase resulted in hindered horizontal gene transfer. Figure 7 C). Therefore, the pathway of genome mosaicism with horizontal gene transfer in Bifidobacteria has been clarified as being based on natural transformation through extracellular DNA uptake and homologous recombination. Thus, the aforementioned mosaicism frequency refers to the transformation frequency.

[0100] The results confirming the universality of natural transformation in *Bifidobacterium pseudosporidis* will be presented as YIT 4072. T Using PCR products prepared with genomic DNA as templates as donors, horizontal transfer of the Tc resistance gene was confirmed in 11 new strains (Table 3).

[0101] [Table 3]

[0102]

[0103] Example 2: Preparation of a bacterium belonging to *Bifidobacterium pseudomicrobium* possessing a xylanase gene and exhibiting excellent survival in a culture medium containing milk components.

[0104] The Y51493 obtained in Example 1 lost its glucose assimilation ability during breeding (see Table 4 below). Genome analysis revealed a one-base deletion at position 369 of the gene (sequence number 9) encoding the glucose transporter (beta-glucoside PTS system EIICBA component) in Y51493. This resulted in a frameshift and a significant change in the amino acid sequence, leading to the inability to transport glucose into the cell. Maintaining glucose assimilation ability is preferable from the perspective of intestinal glucose metabolism. However, restoring the deleted base using conventional UV irradiation or long-term passaging is impractical. Therefore, to restore the one-base deletion in the glucose transporter gene, Y51493 was used as the mother plant (recipient), and the genomic DNA of YIT 11057 was used as the donor DNA, in accordance with the transformation method of Reference Example 2.

[0105] (1) Use of strains

[0106] Y 51493, prepared in Example 1, was used as the receptor.

[0107] (2) Donor DNA

[0108] Genomic DNA was extracted using the glycosylation method from 1 mL of bacterial culture obtained by culturing YIT 11057 in mGAML liquid medium overnight.

[0109] (3) Screening of bacteria that restore conversion and glucose assimilation capacity

[0110] All operations were performed in an anaerobic glove box. Frozen cells of Y 51493 were inoculated into mGAM agar and cultured anaerobically overnight. The next morning, multiple colonies were scraped off and subcultured in 400 μL of the same liquid medium. After culturing for 3–4 hours, an additional 1600 μL of the same liquid medium was added and cultured for 4–5 hours. After centrifugation, the bacterial particles were washed once with 500 μL of mPY liquid medium, and then suspended in 180 μL of the same liquid medium. The bacterial suspension was mixed with an equal volume of DNA solution (genomic DNA of YIT 11057 dissolved in TE buffer after ethanol precipitation), and 10 μL was spotted onto mGAM agar medium supplemented with 50 mM magnesium chloride. After standing for a few minutes until the liquid dried, the mixture was anaerobically cultured at 37°C. The same agar medium used on the day of use was autoclaved. Sixteen hours later, all bacterial cells were scraped using a 1 μL inoculation loop and suspended in 500 μL of mPY liquid medium. 50 μL of this was then resuspended in 640 μL of mPY liquid medium supplemented with 0.5% glucose. 200 μL of this was transferred to a 96-well plate, and 50 μL of mineral oil was added to overlap the plate. A proliferation curve was obtained using a PowerWave 340 microplate reader (Biotech). The remaining bacterial culture was anaerobically cultured in 1.5 mL tubes at 37°C. When an increase in turbidity was observed on the PC screen, 10 μL of the bacterial culture from the 1.5 mL tube was subcultured in 500 μL of fresh, identical liquid medium, and the culture was transferred to 96-well plates and 1.5 mL tubes for further proliferation monitoring. After confirming continued proliferation, the bacterial culture from the 1.5 mL tube was streaked onto mGAML agar, and single colonies were isolated, suspended in glycerol, and stored at -80°C. The cells of the isolated strain were suspended in mPY liquid medium supplemented with 0.5% glucose to confirm proliferation. The full-length genome of the isolated strain was determined by referring to the steps described in Example 1(3).

[0111] (4) Sugar assimilation test

[0112] Frozen bacterial cells of the isolated strains obtained in (3), Y 51493, and YIT 11057 were inoculated into modified GAM agar medium supplemented with 1% lactose and cultured in an anaerobic glove box for 2–3 days. Multiple colonies were scraped and subcultured in the same liquid medium. After incubation at 37°C for one night, the culture was subcultured at 5% in fresh, identical medium for 6–9 hours until the late logarithmic growth phase was reached. The OD... 600 Two μL of PIPES-ILS medium was added to 198 μL of PIPES-ILS medium supplemented with 0.5% sugar in each well of a 96-well plate. 50 μL of mineral oil was added on top, and the plates were incubated anaerobically at 37°C. OD was measured after 72 hours. 600 An increase of 0.1 or more is considered assimilation.

[0113] (5) Confirmation of viable bacterial count and viability

[0114] The strains were refrigerated for 0, 14, 21, and 28 days. In addition, the viable count and survival rate of the isolated strains and Y 51493 obtained in (3) were calculated using the same method as in Example 1 (2).

[0115] (6) Analysis of the variant sites

[0116] Using the full-length genome of YIT 11057 as a reference, the variations produced by the strain obtained in (3) were explored. First, a snippy test was used to identify single base substitutions (SNPs). In addition, a mauve test (Darling et al., GenomeResearch 14, 1394-1403) was used to visually confirm large-scale genomic changes and SNPs that were not detected in the snippy test.

[0117] (7) Results

[0118] DNA extracted from YIT 11057 was used as the donor, and live cells of Y 51493 were used as the recipient for transformation. The result was the transformation of *Bifidobacterium pseudosporidis* YIT13179, which proliferated in liquid medium with glucose as the sole sugar source. The glucose assimilation ability of YIT 13179 was confirmed, and the results showed that it assimilates glucose (Table 4). Furthermore, both YIT 13179 and Y51493 maintained a survival rate of over 40% after two weeks of storage, confirming that YIT 13179 had a higher survival rate compared to Y51493. Figure 8 ).

[0119] The full-length genome of YIT 13179 was determined, and the base sequence of the glucose transporter gene was identified. The results showed that the deletion of one base generated in Y 51493 in YIT13179 was restored, and the full-length gene is the same sequence as YIT 11057.

[0120] [Table 4]

[0121]

[0122] The assimilation of arabinoxylan, starch and lactose in Y 51493, YIT 11057 and YIT 13179 is roughly equivalent (Table 4).

[0123] During the breeding process from YIT 11057 to Y 51493, variations occurred at 15 locations in the genome, which were expected to improve survival in milk culture medium. Of these, only one location in YIT 13179 reverted to the sequence of YIT 11057. The reverted variation was a deletion of the glucose transporter gene.

[0124] Compared to YIT 11057, no mutations were generated in Y 51493, while new mutations were generated at four positions in YIT 13179, but none of them contained genes expected to be related to safety. Furthermore, adverse genes were explored using MiFuP Safety, but no genes with safety concerns were detected in YIT 13179.

Claims

1. A bacterium belonging to Bifidobacterium pseudomicrobium, possessing a xylanase gene in its genome, exhibits higher survival rate in culture media containing milk components than Bifidobacterium pseudomicrobium YIT 11057, whose preservation number is NITE BP-02930.

2. The bacteria according to claim 1, wherein, The xylanase gene is a polynucleotide consisting of the base sequence shown in Serial No. 1, or a polynucleotide that has more than 70% homology with the base sequence and encodes a protein with xylanase activity.

3. The bacteria according to claim 1, after being cultured in a culture medium containing milk components for 24 hours and then stored at low temperature for 2 weeks, have a survival rate of more than 20%.

4. A strain of *Bifidobacterium pseudomicrobium* Y 51493, *Bifidobacterium pseudomicrobium* YIT 13179, or a closely related strain thereof, wherein the accession number of *Bifidobacterium pseudomicrobium* Y 51493 is NITE BP-03852, and the accession number of *Bifidobacterium pseudomicrobium* YIT 13179 is NITE BP-03853.

5. A food product containing any one of claims 1 to 4.

6. The food or beverage according to claim 5, wherein it is a fermented dairy food or beverage.

Images