Application of ADA2 as sarcopenia treatment target

Abstract

The invention discloses application of ADA2 as a sarcopenia treatment target, and belongs to the field of sarcopenia treatment. Real-time fluorescent quantitative PCR detection shows that the expression of ADA2 in the old zebra fish is increased. Further researches find that the expression of amyotrophy factors Atrogin-1 and MuRF-1 in ADA2 knockout juvenile zebrafish is reduced, the expression of ADA2 in human aging macrophages is increased, the expression of the amyotrophy factors Atrogin-1 and MuRF-1 can be increased when rhADA2 acts on C2C12 myotubes, siADA2 acts on the aging macrophages, and the expression of the amyotrophy factors Atrogin-1 and MuRF-1 can be reduced when cell supernatant and C2C12 differentiated mature myotubes are co-cultured. Therefore, it is analyzed that ADA2 can be used as a new target for treating sarcopenia, a powerful basis is provided for clinical prediction and diagnosis of patients with sarcopenia, and a treatment reference value is provided.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of sarcopenia treatment, and particularly relates to application of ADA2 as a target point for treating sarcopenia. BACKGROUND

[0002] Sarcopenia is an age-related syndrome mainly manifested as progressive loss of skeletal muscle mass and function, which seriously affects the quality of life and independence of the elderly. Skeletal muscle atrophy is mainly caused by excessive decomposition of muscle protein, and protein decomposition is usually accompanied by decreased protein synthesis, which is manifested as decreased skeletal muscle mass and dysfunction, thereby leading to decreased quality of life of patients and increased morbidity and mortality. Therefore, it is of great significance to find new effective muscle factors as intervention target points for treating muscle atrophy.

[0003] Adenosine deaminase 2 (ADA2) is a secreted protein (amino acid sequence as shown in SEQ ID NO 10), and the coding gene is CECR1 (located on human chromosome 22), and the mRNA sequence thereof is as shown in SEQ ID NO 11. It is a dimeric enzyme produced by mononuclear cells, bone marrow cells and oligodendrocytes, has four different domains, and the main function is to catalyze the conversion of adenosine and 2'-deoxyadenosine into inosine and deoxyinosine. It has growth factor activity, regulates angiogenesis and immune response, and plays a role in regulating the immune system, inflammation and vascular function. However, there is no related record of ADA2 as a target point for treating sarcopenia in the prior art. SUMMARY

[0004] In view of the deficiencies in the prior art, the purpose of the present application is to provide application of ADA2 as a target point for treating sarcopenia, which solves the problems in the prior art.

[0005] The purpose of the present application can be achieved by the following technical solutions.

[0006] Application of the ADA2 inhibitor in preparation of a medicament for treating sarcopenia.

[0007] Further, the ADA2 inhibitor comprises an ADA2 specific antibody.

[0008] Further, the ADA2 specific antibody is RB7913.

[0009] Further, the amino acid sequence of RB7913 is as shown in SEQ ID NO. 9.

[0010] Further, the ADA2 specific antibody is abx129047.

[0011] A drug for treating sarcopenia, comprising an ADA2 inhibitor, the ADA2 inhibitor comprising an ADA2 specific antibody RB7913 or abx129047.

[0012] Use of an ADA2 gene expression detection reagent in preparation of a sarcopenia diagnosis kit.

[0013] Further, the ADA2 gene expression detection reagent comprises an ADA2 gene specific primer.

[0014] Further, the ADA2 gene specific primer comprises an ADA2 gene specific forward primer and an ADA2 gene specific reverse primer, the nucleotide sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively.

[0015] A sarcopenia diagnosis kit, comprising an ADA2 gene expression detection reagent.

[0016] Advantages of the present application:

[0017] The present application finds that the ADA2 level of the elderly is higher than that of the young, and is generally positively correlated with age; the expression of ADA2 in the peripheral serum of sarcopenia patients is increased; after knocking down the zebrafish ADA2 gene, the expression of muscle atrophy factor is down-regulated; further research finds that the expression of ADA2 in aged macrophages is up-regulated, and the supernatant of the cells acts on C2C12 myotubes, which can up-regulate the expression of muscle atrophy factor, thereby indicating that ADA2 can be used as a new target for the treatment of sarcopenia, and provides a strong basis for the prediction and diagnosis of clinical sarcopenia patients, and provides a treatment reference value. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description, and obviously, other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0019] Figure 1 is a schematic diagram of the mRNA expression of ADA2 in the muscle tissue of the old zebrafish of the present application;

[0020] Figure 2 is a schematic diagram of the protein expression of ADA2 in the muscle tissue of the ADA2 knockout zebrafish of the present application;

[0021] Figure 3 is a schematic diagram of the protein expression of ADA2 in the human aging macrophage of the present application;

[0022] Figure 4is a schematic diagram of mRNA expression of Atrogin-1 and MuRF-1 in C2C12 myotubes treated with rhADA2 according to the present application;

[0023] Figure 5 is a schematic diagram of mRNA expression of Atrogin-1 and MuRF-1 in C2C12 myotubes treated with rhADA2 according to the present application; DETAILED DESCRIPTION

[0024] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0025] Embodiment 1

[0026] In this embodiment, it is found by real-time fluorescent quantitative PCR detection method that the expression of ADA2 in the muscle tissue of old zebrafish is increased;

[0027] Materials and methods: Wild adult zebrafish and old zebrafish tissues were extracted respectively, 10 in each group, n = 6, total RNA of zebrafish tissues was extracted, 1 μg of RNA was reversely transcribed into cDNA, and then real-time fluorescent quantitative PCR detection was performed. Among them:

[0028] The forward primer sequence of ADA2 gene (as shown in SEQ ID NO. 1) is ACCACTGAACTGGACAACAGT;

[0029] The reverse primer sequence of ADA2 gene (as shown in SEQ ID NO. 2) is AAACTGTCGGAGACCTTCATAG.

[0030] The forward primer sequence of internal reference Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (as shown in SEQ ID NO. 3) is AGGTCGGTGTGAACGGATTTG;

[0031] The reverse primer sequence of GAPDH (as shown in SEQ ID NO. 4) is TGTAGACCATGTAGTTGAGGTCA.

[0032] The specific steps are as follows:

[0033] S1, the real-time fluorescent quantitative PCR reaction system is (the PCR detection method is two independent reactions for detecting the expression of ADA2 and internal reference GAPDH mRNA respectively, so the forward primers and reverse primers in Table 1 below are specific primers used in the respective reactions):

[0034] Table 1 Real-time fluorescent quantitative PCR reaction system

[0035]

[0036] S2, the real-time fluorescent quantitative PCR reaction program is shown in Table 2:

[0037] Table 2 Real-time fluorescent quantitative PCR reaction program

[0038]

[0039]

[0040] S3, after the reaction is completed, the amplification curve and the melting curve of the real-time fluorescent quantitative PCR are confirmed, and the relative quantitative value of ADA2 is calculated according to the Ct value by using the internal reference gene GAPDH for standardization, and the expression difference of ADA2 in the muscle tissue of the old zebrafish and the muscle tissue of the adult zebrafish is calculated.

[0041] The results are shown in Figure 1 , wherein black represents adult zebrafish and red represents old zebrafish, and it can be seen that the expression of ADA2 in the muscle tissue of the old zebrafish is higher than that in the muscle tissue of the adult zebrafish.

[0042] Example 2

[0043] In this embodiment, it is found by Western blotting experiment that the expression of atrophy factors Atrogin-1 and MuRF-1 in the ADA2 gene knockout zebrafish larvae is decreased;

[0044] Materials and methods: 20 ADA2 gene knockout zebrafish larvae and 20 wild type zebrafish larvae were extracted respectively, n = 6, total protein of the larvae was extracted, and Western blotting experiment was performed;

[0045] The specific process is as follows:

[0046] S1: the protein electrophoresis condition is 120V constant voltage for 100 minutes;

[0047] S2: the protein transfer membrane condition is 300mA constant current for 90 minutes;

[0048] S3: 5% skimmed milk blocking for 2 hours;

[0049] S4: specific antibody incubation overnight; wherein the specific antibody includes:

[0050] (1) Zebrafish ADA2 specific antibody (RB7913), sequence (as shown in SEQ ID NO. 9) is: DPDRAYPNQDTVWEC.

[0051] (2) Atrogin-1 specific antibody (Proteintech, 67172-1-Ig) was purchased from Wuhan Three Eagle Company (Proteintech).

[0052] (3) MuRF-1 specific antibody (Proteintech, 55456-1-AP) was purchased from Wuhan Three Eagle Company (Proteintech).

[0053] (4) Internal reference GAPDH specific antibody (Proteintech, 60004-1-Ig) was purchased from Wuhan Three Eagle Company (Proteintech).

[0054] S5: After washing three times with membrane washing solution, incubate the anti-mouse secondary antibody for 70 minutes;

[0055] S6: After washing three times with membrane washing solution, develop;

[0056] S7: According to the gray value standardization, calculate the relative quantitative value of ADA2, Atrogin-1 and MuRF-1, and calculate the expression difference of Atrogin-1 and MuRF-1 in zebrafish ADA2 knockout and control group zebrafish larvae;

[0057] The results are shown in Figure 2 , wherein gray represents wild zebrafish larvae, red represents D-gal intervened zebrafish larvae, black represents ADA2 gene knocked down zebrafish larvae, and green represents D-gal intervened ADA2 gene knocked down zebrafish larvae; It can be seen that the expression of Atrogin-1 and MuRF-1 in ADA2 knockout zebrafish larvae is significantly lower than that in wild zebrafish larvae.

[0058] Example 3

[0059] In this embodiment, it is found by Western blotting experiment that ADA2 is expressed in human senescent macrophages.

[0060] Materials and methods: Human macrophages and senescent macrophages were extracted respectively, n = 6, total protein of each group of cells was extracted, and Western blotting experiment was performed.

[0061] The specific process is as follows:

[0062] S1: The protein electrophoresis condition is 120V constant voltage, 100 minutes;

[0063] S2: The protein transfer film condition is 300 mA constant current for 90 minutes;

[0064] S3: 5% skim milk blocking for 2 hours;

[0065] S4: Specific antibody incubation overnight; the specific antibody includes:

[0066] (1) Human macrophage ADA2 specific antibody (abx129047) is purchased from Abbexa Company.

[0067] (2) Internal reference GAPDH specific antibody (Proteintech, 60004-1-Ig) is purchased from Wuhan Sanying Company (Proteintech).

[0068] S5: After washing three times with washing solution, incubate the anti-mouse secondary antibody for 70 minutes;

[0069] S6: After washing three times with washing solution, develop;

[0070] S7: According to the gray value standardization, calculate the relative quantitative value of ADA2, and calculate the expression difference of ADA2 in human senescent macrophages and ADA2 in the control group;

[0071] The results are shown in Figure 3 , wherein black represents macrophages and red represents senescent macrophages. It can be seen that the expression of ADA2 in human senescent macrophages is significantly increased.

[0072] Example 4

[0073] In this embodiment, it is found by real-time fluorescent quantitative PCR detection method that rhADA2 acts on C2C12 myotube muscle atrophy factor expression to increase;

[0074] Materials and methods: rhADA2 acts on C2C12 differentiated mature myotubes, n = 6, total RNA is extracted, 1 μg of RNA is reversely transcribed into cDNA, and then real-time fluorescent quantitative PCR detection is performed. Among them:

[0075] The Atrogin-1 forward primer sequence (as shown in SEQ ID NO. 5) is: CAGCTTCGTGAGCGACCTC;

[0076] The Atrogin-1 reverse primer sequence (as shown in SEQ ID NO. 6) is: GGCAGTCGAGAAGTCCAGTC;

[0077] The MuRF-1 forward primer sequence (as shown in SEQ ID NO. 7) is: GTGTGAGGTGCCTACTTGCTC;

[0078] The sequence of the reverse primer of MuRF-1 (as shown in SEQ ID NO. 8) is GCTCAGTCTTCTGTCCTTGGA.

[0079] The sequence of the forward primer of the internal reference GAPDH (as shown in SEQ ID NO. 3) is AGGTCGGTGTGAACGGATTTG.

[0080] The sequence of the reverse primer of GAPDH (as shown in SEQ ID NO. 4) is TGTAGACCATGTAGTTGAGGTCA.

[0081] The specific steps are as follows:

[0082] S1: The reaction system of real-time fluorescent quantitative PCR (the PCR detection method is two independent reactions for detecting the expression of Atrogin-1, MuRF-1 and internal reference GAPDH mRNA, and thus the forward primer and reverse primer in Table 3 are the specific primers used in each reaction) is as follows:

[0083] Table 3 Real-time fluorescent quantitative PCR reaction system

[0084] SYBR Green PCR Master Mix (2x) 5ul Specific forward primer (10 uM) 0.5ul Specific reverse primer (10 uM) 0.5ul Nuclease-free water 2ul cDNA product 2ul Total 10ul

[0085] S2: The reaction program of real-time fluorescent quantitative PCR is shown in Table 4:

[0086] Table 4 Real-time fluorescent quantitative PCR reaction program

[0087]

[0088]

[0089] S3: After the reaction, the amplification curve and the melting curve of real-time fluorescent quantitative PCR are confirmed, and the relative quantitative value of Atrogin-1 and MuRF-1 is calculated by using the internal reference gene GAPDH as a standard, and the expression difference of muscle atrophy factors Atrogin-1 and MuRF-1 after rhADA2 acting on C2C12 myotubes is calculated.

[0090] The results are shown in Figure 4 , wherein gray represents the C2C12 myotube control group, red represents the rhADA2 solvent group, black represents the rhADA2 group, green represents the rhADA2+adenosine (Ado) solvent group, and yellow represents the rhADA2+adenosine (Ado) group. It can be seen that the expression of muscle atrophy factors Atrogin-1 and MuRF-1 increases after rhADA2 acting on C2C12 myotubes.

[0091] Example 5

[0092] In this embodiment, the supernatant of the senescent macrophages after the siADA2 treatment was found to decrease the expression of muscle atrophy factors in C2C12 myotubes by real-time fluorescent quantitative PCR detection method;

[0093] Materials and methods: siADA2 was used to treat senescent macrophages, and the supernatant of senescent macrophages and macrophage supernatant were used as conditioned medium to co-culture with C2C12 myotubes, n = 6, total RNA of each group of cells was extracted, 1 μg of RNA was reversely transcribed into cDNA, and then real-time fluorescent quantitative PCR detection was performed. Among them:

[0094] The Atrogin-1 forward primer sequence (as shown in SEQ ID NO. 5) is: CAGCTTCGTGAGCGACCTC;

[0095] The Atrogin-1 reverse primer sequence (as shown in SEQ ID NO. 6) is: GGCAGTCGAGAAGTCCAGTC;

[0096] The MuRF-1 forward primer sequence (as shown in SEQ ID NO. 7) is: GTGTGAGGTGCCTACTTGCTC;

[0097] The MuRF-1 reverse primer sequence (as shown in SEQ ID NO. 8) is: GCTCAGTCTTCTGTCCTTGGA;

[0098] The GAPDH forward primer sequence (as shown in SEQ ID NO. 3) is: AGGTCGGTGTGAACGGATTTG;

[0099] The GAPDH reverse primer sequence (as shown in SEQ ID NO. 4) is: TGTAGACCATGTAGTTGAGGTCA.

[0100] The specific process is as follows:

[0101] S1: The real-time fluorescent quantitative PCR reaction system is (the PCR detection method is two independent reactions to detect the expression of Atrogin-1, MuRF-1 and internal reference GAPDH mRNA respectively, so the forward primer and reverse primer in Table 5 below are the specific primers used in each reaction):

[0102] Table 5 Real-time fluorescent quantitative PCR reaction system

[0103] SYBR Green PCR Master Mix (2x) 5ul Specific forward primer (10 uM) 0.5ul Specific reverse primer (10 uM) 0.5ul Nuclease-free water 2ul cDNA product 2ul Total 10ul

[0104] S2: The real-time fluorescent quantitative PCR reaction program is shown in Table 6:

[0105] Table 6 Real-time quantitative PCR reaction procedure

[0106] 50℃ 2 min 95℃ 10 min 95℃ 15s 60℃ 30s 72℃ 30s 95℃ 15s 60℃ 1 min 95℃ 15s

[0107] S3: After the reaction is completed, after confirming the amplification curve and melting curve of real-time quantitative PCR, the relative quantitative values ​​of Atrogin-1 and MuRF-1 are calculated based on the Ct value using the internal reference gene GAPDH normalization, and the expression difference of muscle atrophy factor Atrogin-1 and MuRF-1 after rhADA2 is applied to C2C12 myotubes is calculated.

[0108] The results are as follows Figure 5 As shown, gray represents co-culture of macrophage supernatant with C2C12, red represents co-culture of senescent macrophage supernatant with C2C12, black represents co-culture of senescent macrophage supernatant with C2C12 after the addition of a negative control group (NC), and green represents co-culture of senescent macrophage supernatant with C2C12 after the addition of siADA2. It can be seen that the expression of muscle atrophy factors Atrogin-1 and MuRF-1 decreased after co-culturing senescent macrophage supernatant with C2C12 myotubes with the addition of siADA2.

[0109] Based on the above embodiments, this invention, through real-time quantitative PCR detection, revealed elevated ADA2 expression in aged zebrafish. Further studies showed that ADA2 knockout zebrafish juveniles exhibited decreased expression of atrophic dystrophin-1 (Atrogin-1) and MuRF-1, while ADA2 expression was elevated in senescent human macrophages. rhADA2, acting on C2C12 myotubes, increased Atrogin-1 and MuRF-1 expression. siADA2, acting on senescent macrophages, and co-culturing its cell supernatant with mature C2C12 myotubes, decreased Atrogin-1 and MuRF-1 expression. This invention is simple, rapid, and stable. This invention proposes that ADA2 could serve as a novel target for sarcopenia treatment, providing strong evidence for the prediction and diagnosis of clinical sarcopenia patients, and offering valuable treatment reference.

[0110] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0111] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above-mentioned embodiments, and the above-mentioned embodiments and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.

Claims

1. Application of ADA2 inhibitors in the preparation of drugs for the treatment of sarcopenia.

2. The application according to claim 1, characterized in that, The ADA2 inhibitors include ADA2-specific antibodies.

3. The application according to claim 2, characterized in that, The ADA2-specific antibody is RB7913.

4. The application according to claim 3, characterized in that, The amino acid sequence of RB7913 is shown in SEQ ID NO.

9.

5. The application according to claim 2, characterized in that, The ADA2-specific antibody is abx129047.

6. A drug for treating sarcopenia, characterized in that, This includes ADA2 inhibitors, which include ADA2-specific antibodies RB7913 or abx129047.

7. Application of ADA2 gene expression detection reagent in the preparation of sarcopenia diagnostic kit.

8. The application according to claim 7, characterized in that, The ADA2 gene expression detection reagent includes ADA2 gene-specific primers.

9. The application according to claim 8, characterized in that, The ADA2 gene-specific primers include an ADA2 gene-specific forward primer and an ADA2 gene-specific reverse primer, with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

10. A diagnostic kit for sarcopenia, characterized in that, Including ADA2 gene expression detection reagents.

Images