Bacillus cereus with wide pH adaptability and application of bacillus cereus in heavy metal remediation of soil or underground water

Abstract

The invention discloses bacillus cereus with wide pH adaptability and application of the bacillus cereus in soil or underground water heavy metal remediation, the strain is named as bacillus cereus GS and preserved in the China Center for Type Culture Collection (the preservation number is CCTCC NO: M 20241939), and the bacillus cereus is named as bacillus cereus GS and preserved in the China Center for Type Culture Collection (CCTCC). The strain is high in environmental adaptability and high in remediation efficiency, can show good reduction and endurance capacity to various heavy metal pollutants under the wide environmental conditions that the pH ranges from 4 to 10 and the temperature ranges from 16 DEG C to 37 DEG C, and is particularly suitable for in-situ remediation of high-concentration contaminated soil; experimental results represented by hexavalent chromium show that the removal rate of the strain in 1000 mg / kg hexavalent chromium contaminated soil within 7 days can reach 70-100%, the dependence of an existing microbial remediation technology on a low-concentration and alkaline environment or a long remediation period is broken through, and an efficient solution is provided for green bioremediation of multiple types of heavy metal contaminated sites.

Description

TECHNICAL FIELD

[0001] The present application relates to a Bacillus cereus, in particular to a Bacillus cereus with wide pH adaptability, and also relates to the application of the Bacillus cereus in the remediation of heavy metals in soil or groundwater, and belongs to the technical field of environmental microbial remediation. BACKGROUND

[0002] Typical heavy metal pollutants include hexavalent chromium (Cr(VI)), lead (Pb), cadmium (Cd), arsenic (As), etc., which are highly toxic, persistent and mobile, and can accumulate through the food chain, posing a long-term threat to the ecosystem and human health. Traditional soil heavy metal remediation methods, such as chemical precipitation, stabilization and solidification, and soil replacement, can reduce pollutant concentrations to some extent, but often have high costs, high energy consumption, long processing periods, and serious damage to soil ecological structure, and can easily cause secondary pollution. Therefore, green, efficient and environmentally friendly microbial remediation technology has gradually attracted widespread attention.

[0003] Previous studies have shown that a variety of microorganisms have the ability to remove heavy metal pollutants through mechanisms such as biosorption, bioreduction, and intracellular precipitation. However, the microbial strains currently available on the market or reported in the literature often have limited remediation efficiency, poor environmental adaptability, sensitivity to high concentrations of heavy metals, and long processing periods. For example, the alkaline-tolerant strain reported in patent CN114164139A only exhibits Cr(VI) removal activity at pH 10, limiting its application in neutral or acidic soil environments; another strain reported in CN114573115A is only suitable for low-concentration Cr(VI) wastewater remediation, and its remediation capacity significantly decreases under high-concentration pollution conditions.

[0004] Therefore, developing a functional microorganism with broad environmental adaptability, good tolerance to high concentrations of heavy metal pollution, and strong reduction capacity is crucial for the practical application of efficient biological remediation technology for heavy metal-contaminated soil or groundwater. SUMMARY

[0005] The purpose of the present application is to provide a Bacillus cereus with wide pH adaptability and its application in the remediation of heavy metals in soil or groundwater, and to solve the technical bottlenecks of low remediation efficiency, strong alkaline environment dependence, difficulty in treating high-concentration heavy metals, and long processing period in existing microbial remediation technology.

[0006] Technical solution: The wide pH adaptable Bacillus cereus provided by the present application is named Bacillus cereus GS, which is preserved in China Center for Type Culture Collection (CCTCC) on September 9, 2024, and the preservation number is CCTCC NO: M 20241939, and the preservation address is Wuhan, China. The 16S rDNA sequence of the strain has a homology of 99% with the 16S rDNA sequence of Bacillus cereus.

[0007] The strain is inoculated into LB liquid medium (10 g / L of proteose peptone, 5 g / L of yeast powder and 10 g / L of sodium chloride), and can stably grow under extensive environmental conditions of pH 4-10 and temperature 16-37 DEG C, and shows good tolerance and removal capacity to one or more of various typical heavy metal pollutants, including hexavalent chromium (Cr(VI)), lead (Pb(II)), cadmium (Cd(II)) and arsenic (As(V)). Especially in Cr(VI) pollution remediation, the removal rate of 20 mg / L Cr(VI) is more than 95% within 20 hours.

[0008] The above-mentioned Bacillus cereus can be applied in Cr(VI) contaminated liquid medium, and the removal rate of 20 mg / L Cr(VI) is more than 95% within 20 hours under the conditions of pH 4-10 and temperature 16-37 DEG C. The medium is LB medium, and the aerobic environmental conditions are that the shaking rate is 180-200 rpm.

[0009] The above-mentioned wide pH adaptable Bacillus cereus can be applied in soil or groundwater heavy metal remediation.

[0010] The concentration of the heavy metal in the soil or groundwater is 100-1000 mg / kg.

[0011] The Bacillus cereus GS is inoculated into the medium, and the bacterial liquid is obtained after culture under aerobic conditions, and the bacterial liquid is applied to the heavy metal contaminated soil or groundwater for in-situ treatment.

[0012] The medium is LB medium, and the formula is 10 g / L of proteose peptone, 5 g / L of yeast powder and 10 g / L of sodium chloride; the aerobic environmental conditions are 30-32 DEG C, pH 7.2-7.4, constant temperature oscillation for 20 hours, and the shaking rate is 180-200 rpm; preferably pH 7.4.

[0013] The concentration of the Bacillus cereus GS in the bacterial liquid is 10 8 -10 9 cfu / ml, and the addition amount is 10 8-10 9 cfu / g, the preferred amount of addition is 10 8 cfu / g; the amount of addition of the bacterial solution is 5%-10% of the mass of the soil or groundwater.

[0014] The treatment lasts for 5-7 days, and after 5-7 days of treatment, the removal rate of heavy metals in the soil or groundwater reaches 70%-100%.

[0015] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages:

[0016] (1) High repair efficiency and rapid reaction: Cr(VI) is efficiently removed in a short time, which is much better than the treatment period of the disclosed strains;

[0017] (2) Wide adaptability and strong stability: The dependence of microorganisms on alkaline conditions in the current technology is broken, and it is suitable for various soil types and environmental scenarios;

[0018] (3) Strong tolerance to high concentration pollution: It can maintain activity in contaminated soil with Cr(VI) concentration up to 1000mg / kg, effectively solving the problem of strain inactivation under high pollution intensity;

[0019] (4) Simple operation and suitable for in-situ application: The bacterial solution is simple to prepare and can be directly applied to soil without the need for additional pH adjustment or nutrient supplement, which is low in cost and high in engineering feasibility;

[0020] (5) Effective for multiple heavy metals: It has broad-spectrum removal potential and is suitable for the repair needs of complex pollution sites;

[0021] In summary, the Bacillus cereus GS provided by the present application and its application method in Cr(VI) contaminated soil have good industrial application value and promotion potential, and provide a feasible new technical path for the current green and efficient biological repair of heavy metal contaminated soil or groundwater. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The colony morphology of the strain GS in the LB medium in Example 1;

[0023] Figure 2 The influence of different initial Cr(VI) concentrations on the growth of the GS strain and the reduction rate of Cr(VI) content in Example 3;

[0024] Figure 3 The bacterial concentration and Cr(VI) concentration after 20h of detection under different temperatures (16℃, 20℃, 25℃, 30℃, 37℃) and 160rpm shaking in Example 3;

[0025] Figure 4To implement the influence of different pH (4, 7, 10) on the content reduction rate of Cr(VI) in Example 3;

[0026] Figure 5 To implement the influence of different pH (4, 7, 10) on the content reduction rate of Cr(VI) in Example 3; DETAILED DESCRIPTION

[0027] The technical solutions of the present application are further illustrated below in combination with the drawings and specific examples. The test materials used in the examples can be purchased through conventional channels.

[0028] Example 1

[0029] Isolation and purification of Bacillus cereus GS strain:

[0030] Cr(VI) contaminated soil was collected from the west plot of Hucheng electroplating factory in Suzhou city. After the collected soil was thoroughly mixed, bacteria were isolated by using the method of "selective medium + dilution coating culture", and the culture medium was mainly LB culture medium containing 20 mg / L Cr(VI). 10 g of soil was weighed into a sterile flask, 100 mL of sterile water was added, and the mixture was shaken for 30 minutes to obtain 10 -1 soil suspension. 1 mL of 10 -1 soil suspension was taken into 9 mL of sterile water to obtain 10 -2 soil suspension. In this way, 10 -8 soil suspensions were prepared until 10 -6 , 10 -7 , 10 -8 dilution gradient soil suspensions were obtained. 200 μL of each soil suspension was coated on LB medium plates containing 10 mg / L K2Cr2O7, and cultured at 30°C for 20 hours. A strain with good growth was selected, and streaked and purified until pure culture was obtained, and stored at 4°C for standby use. The formula of LB culture medium is: 10 g / L proteose peptone, 5 g / L yeast powder, 10 g / L sodium chloride, pH 7.4.

[0031] As Figure 1 shown, the colony of Bacillus cereus GS is round, yellow-white, about 5-7 mm in diameter, the surface is rough, like frosted glass or wax melting.

[0032] Example 2

[0033] Identification of Bacillus cereus GS strain:

[0034] Take 200 μL of the bacteria solution cultured overnight, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 200 μL of sterile ultrapure water to the precipitate, mix thoroughly, then place in a 100℃ water bath for 5 min to lyse, and use the lysate as a template for PCR. The PCR primers are universal primers 27F and 1492R. The primer sequences are 27F: AGAGTTTGATCCTGGCTCAG and 1492R: TACGGCTACCTTGTTACGACTT. The PCR reaction system is: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min 30 s, 25 cycles; 72℃ for 10 min. The PCR reaction conditions are: 10×Ex Taq Buffer 2 μL, 5 U / μL Ex Taq 0.2 μL, 2.5 mM dNTP Mix 1.6 μL, 27F and 1492R each 1 μL, template 0.5 μL, ddH2O 13.7 μL, a total of 20 μL system. The PCR product is detected by 1.2% agarose gel electrophoresis and sent to Shanghai Meiji Biomedicine Technology Co., Ltd. for sequencing. The two ends of the raw sequence obtained by Sanger sequencing are subjected to quality control to remove low-quality bases, and the clean sequence is obtained after splicing to obtain the assembled sequence. The top 10 species information of the species similarity obtained by blast with the NT database is obtained, and the highest similarity alignment species is selected as the identification result.

[0035] It is found by comparison that the similarity is more than 99%, which is Bacillus sp. Among them, strain GS has a similarity of 99.5% with KC510288.1 Bacillus cereus strain Fd 16S ribosomal RNA gene. The Bacillus cereus GS was preserved in the China Center for Type Culture Collection (CCTCC) on September 9, 2024, with a preservation number of CCTCC NO: M20241939 and a preservation address of Wuhan, China.

[0036] The 16S rDNA sequence of the strain is as follows (SEQ ID NO. 1):

[0037]

[0038] Example 3

[0039] Study on the characteristics of Cr(VI) reduction of the strain:

[0040] The GS bacterial solution was cultured to the logarithmic phase seed solution, OD 600 1.0, inoculated into LB medium containing different initial concentrations of Cr(VI) (0 mg / L, 10 mg / L, 20 mg / L, 50 mg / L, 70 mg / L, 100 mg / L, 150 mg / L) at pH 7.4 at 5% inoculation, 180 rpm, constant temperature shaking at 30°C, and the bacterial concentration and Cr(VI) removal rate were detected after 20 hours, with 3 parallel groups in each group.

[0041] The results are shown in Figure 2 When the concentration of Cr(VI) was 10 mg / L and 20 mg / L, the growth of the strain was not inhibited, and the removal rate of Cr(VI) was about 100%, which may be because the low concentration of Cr(VI) did not affect the growth and metabolism of the strain itself, so the removal rate could be nearly 100%; when the concentration was 50 mg / L, the growth of the strain was largely inhibited, and the removal rate was about 50%, the toxicity of Cr(VI) began to have a significant impact on the growth of the strain, which may interfere with the normal physiological functions of the cell, such as affecting the permeability of the cell membrane, the activity of the enzyme, etc., so that the growth of the strain was largely inhibited. But at this time the strain still had certain tolerance and reduction capacity, so it could still achieve a removal rate of about 50%; when the concentration was 70-100 mg / L, the growth of the strain was completely inhibited, and the removal rate was about 10%, at this time the concentration of Cr(VI) was too strong for the GS strain, which may have severely damaged the structure and function of the cell, leading to the inability of the cell to grow and reproduce normally, and the metabolic activity was also basically stagnant.

[0042] The GS bacterial solution was cultured to the logarithmic phase seed solution, OD 600 1.0, inoculated into LB medium containing 20 mg / L initial concentration of Cr(VI) at pH 7.4 at different temperatures (16°C, 20°C, 25°C, 30°C, 37°C), 180-200 rpm shaking, and the bacterial concentration and Cr(VI) concentration were detected after 20 hours, with 3 parallel groups in each group.

[0043] The results are shown in Figure 3As shown, the removal rate of Cr(VI) by GS strain is about 95% at 16-37°C, and the growth of the strain is not inhibited. It shows that GS strain has a wide range of temperature adaptation, and the enzyme system, metabolic pathway, etc. in the cells of the strain can remain relatively stable and active between 16-37°C. It is possible that the composition of the cell membrane and the structure of the protein of GS strain have certain flexibility and stability, which can maintain normal physiological functions at different temperatures, thereby ensuring the efficient removal of Cr(VI), all of which can achieve a removal rate of about 95%, indicating that the Cr(VI) reduction metabolism mechanism of the strain is relatively stable in this temperature range.

[0044] The GS bacterial liquid was cultured to the logarithmic phase, and the OD 600 was 1.0, and was inoculated into different pH (4, 7, 10) LB medium containing 10 mg / L initial concentration of Cr(VI) at a 5% inoculation amount, and was incubated at a constant temperature (30°C, 180 rpm). The bacterial concentration and Cr(VI) concentration were detected after 20 hours, and three parallel groups were set for each group.

[0045] The results are shown in Figure 4 As shown, the removal rate of Cr(VI) by GS strain is about 75% at pH 4-10. GS strain can maintain a certain Cr(VI) removal capacity in the pH range of 4-10, indicating that the strain has certain acid-base adaptability. It is possible that the strain cells have an acid-base regulation mechanism, which can maintain the relative stability of the intracellular environment under different pH environments, ensuring the activity of related enzymes and metabolic pathways. However, the removal rate is about 75%, which does not reach a higher removal rate under certain conditions. It is possible that the change of pH will still have a certain impact on some physiological processes of the strain, although it does not completely inhibit the growth, but will affect the activity or efficiency of Cr(VI) reduction related enzymes, so that the removal rate is stabilized at about 75%.

[0046] Example 4

[0047] Bioremediation of Cr(VI) contaminated soil experiment:

[0048] This experiment includes 8 treatments, each with three replicates, to monitor the removal of Cr(VI) in soil (as shown in Table 1). The treatments include the addition of GS bacterial liquid and the control treatment without GS, and the Cr(VI) concentration of 100, 200, 500, 1000 mg / kg is set. The soil is artificially contaminated with Cr(VI), and Cr(VI) solution is added to the aliquot of soil, and different concentrations of Cr(VI) are set. After 7 days of contamination, the Cr(VI) concentration of the soil is measured.

[0049] Each treatment set 100 g of contaminated soil, added to a 250 mL beaker, added 30 mL of deionized water in the control treatment, added 10 mL of GS bacterial solution with a concentration of 10 8 -10 9 cfu / mL in the GS treatment, and kept the moisture at 30% water holding capacity (WHC). After 7 days, destructive sampling was performed, and the Cr(VI) concentration in the aged soil was determined using the method described in HJ 687-2014 (Determination of Cr(VI) in solid waste - Alkaline digestion flame atomic absorption spectrophotometry).

[0050] Under different concentrations of soil Cr(VI) pollution, after 7 days of cultivation, GS significantly increased the reduction of Cr(VI) compared to the control (p < 0.05, analysis of variance, as Figure 5 ) In the GS treatment, the Cr(VI) reduction rate was about 100% when the initial concentration of Cr(VI) was 100 mg / kg, about 77% when the initial concentration of Cr(VI) was 200 mg / kg, about 66% when the initial concentration of Cr(VI) was 500 mg / kg, and about 70% when the initial concentration of Cr(VI) was 1000 mg / kg. In contrast, in the control group, the Cr(VI) reduction rate was only 11.3% to 23.6%.

[0051] Table 1 Soil remediation experiment

[0052]

[0053] In summary, the Bacillus cereus GS of the present application exhibits excellent performance in Cr(VI) pollution remediation:

[0054] (1) In liquid medium, the removal rate of 20 mg / L Cr(VI) is >95% within 20 hours, far exceeding existing strains (such as FNXJ1-2-3 disclosed in CN114573115A, which requires 28-32 hours).

[0055] (2) Stable operation within the pH 4-10, temperature 16-37℃ range, breaking through the acid-base dependence and temperature limitations of existing strains (such as FZUY-01 disclosed in CN114164139A, which requires use at pH 10).

[0056] (3) In the remediation of chromium-contaminated soil, the removal rate of Cr(VI) in 100-1000mg / kg contaminated soil within 7 days reached 70%-100%; it can treat contaminated soil with Cr(VI) concentration as high as 1000mg / kg, and can maintain activity at a Cr(VI) concentration of 50mg / L, while existing strains (such as FNXJ1-2-3) are only applicable to ≤30mg / L, and their activity is completely inhibited at this concentration.

[0057] (4) It can be directly added with bacterial liquid, without the need to adjust the pH of the soil or add nutrients, reducing the cost of remediation; using conventional LB medium for culture, the preparation process is simple and suitable for large-scale application.

Claims

1. A wide pH-adaptable Bacillus cereus, characterized in that, The strain was named Bacillus cereus GS and was deposited at the China Center for Type Culture Collection (CCTCC) on September 9, 2024, with accession number CCTCC NO:M 20241939 and deposit address in Wuhan, China.

2. The application of the wide pH-adaptable Bacillus cereus of claim 1 in the remediation of heavy metals in soil or groundwater.

3. The application according to claim 2, characterized in that, The heavy metal is one or more of hexavalent chromium, lead, cadmium, and arsenic.

4. The application according to claim 3, characterized in that, The concentration of the heavy metal in the soil or groundwater is 100-1000 mg / kg.

5. The application according to claim 3, characterized in that, Bacillus cereus GS was inoculated into a culture medium and cultured under aerobic conditions to obtain a bacterial solution. The bacterial solution was then applied to heavy metal contaminated soil or groundwater for in-situ treatment.

6. The application according to claim 5, characterized in that, The concentration of Bacillus cereus GS in the bacterial solution was 10. 8 -10 9 cfu / ml, addition amount 10 8 -10 9 cfu / g.

7. The application according to claim 5, characterized in that, The amount of bacterial solution added is 5%-10% of the mass of the soil or groundwater.

8. The application according to claim 5, characterized in that, The processing time is 5-7 days.

Images