Aspergillus scheffleri and application thereof

By optimizing the fermentation process of Aspergillus chevallis LH-3, the polysaccharide yield was increased and the extracellular polysaccharide was purified, solving the problem of low production efficiency of microbial extracellular polysaccharides. This enabled efficient and low-cost polysaccharide preparation, expanding its application in functional foods, pharmaceuticals, health products, and green biomaterials.

CN120905039APending Publication Date: 2025-11-07NANNING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511120702.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-11
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the efficient and low-cost production of microbial extracellular polysaccharides, limiting their widespread application in functional foods, pharmaceuticals, health products, and green biomaterials.

Method used

The fermentation process of Aspergillus chevalieri LH-3 was isolated and optimized. By optimizing the culture medium composition and fermentation conditions, the polysaccharide yield was increased to 24.24 mg/ml, and high-purity extracellular polysaccharides were obtained through ethanol precipitation and purification steps.

Benefits of technology

This has enabled the efficient and low-cost production of microbial extracellular polysaccharides, meeting the needs of functional foods, pharmaceuticals, health products, and green biomaterials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905039A_ABST
    Figure CN120905039A_ABST
Patent Text Reader

Abstract

The invention discloses an Aspergillus scheffleri strain and application thereof, the strain is named as Aspergillus scheffleri LH-03, the preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.41987, the preservation date is May 7, 2025, and the preservation unit is China General Microbiological Culture Collection Center. The strain shows efficient exopolysaccharide synthesis capability, and the yield of the synthesized exopolysaccharide is obviously higher than that of a conventional production strain.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial fermentation, and particularly relates to a strain of Aspergillus shivaramii and application thereof. BACKGROUND

[0002] Microbial exopolysaccharide has broad prospects in the field of bioactive substance research due to its unique structural characteristics and source advantages. Compared with plant-derived polysaccharides, the production of microbial exopolysaccharide is less limited by natural conditions, has lower cost, and is stable. Current research shows that microbial exopolysaccharide has the following biological activities: 1. Anti-tumor activity: exopolysaccharide can play an anti-tumor role by interfering with tumor blood supply, inhibiting tumor cell proliferation, etc.; 2. Antioxidant activity: it can effectively scavenge free radicals to protect biological macromolecules from oxidative damage and prolong the cell aging process; 3. Anti-cancer effect: lactic acid bacterial exopolysaccharide has been proven to have potential for anti-colon cancer, providing a new idea for prevention and treatment; 4. Prebiotic characteristics: promoting the colonization of beneficial bacteria and regulating the intestinal microecology, which has important intestinal health promoting effect; 5. Antibacterial function: it can effectively inhibit the growth of common pathogenic bacteria (such as Escherichia coli and Staphylococcus aureus) in food and clinical pathogenic bacteria, and has important application potential in food preservation technology and prevention of infectious diseases; 6. Heavy metal adsorption: some microbial exopolysaccharides contain rich functional groups (such as carboxyl and hydroxyl groups), which can be used as natural heavy metal chelators for heavy metal ion adsorption in environmental pollution control and detoxification in vivo; 7. Blood glucose and lipid-lowering effect: by inhibiting the activity of related enzymes, it can regulate blood glucose and lipid levels, providing a new strategy for the prevention and treatment of chronic diseases.

[0003] In recent years, microbial exopolysaccharide has shown broad application prospects in the fields of functional food, medical and health products, and green biological materials due to its rich biological functions and controllable production advantages. Compared with plant polysaccharides, microbial polysaccharides can be produced on a large scale and standardized through industrial fermentation, and the product quality is stable. The screened functional strains and their exopolysaccharides, especially, have the following application potential: functional food development, prebiotic characteristics and multiple physiological activities make them applicable to the fields of health drinks, fermented products, etc.; in medical and health applications, they can be developed as natural immune enhancers, auxiliary treatment preparations, etc.; natural food additives, with excellent emulsifying property, film-forming property and moisturizing property, are applied to products such as beverages, sauces, ice cream, etc. SUMMARY

[0004] The application isolates a strain of Aspergillus shivaramii with high polysaccharide yield, and further optimizes the fermentation process to realize efficient and low-cost production of polysaccharide.

[0005] The Aspergillus shivaramii of the application is named Aspergillus shivaramii (A.shivaramii) strain YN-1. Aspergillus chevalieri) LH-3, the preservation number is CGMCC NO. 41987, the preservation date is May 7, 2025, and the preservation unit is China General Microbiological Culture Collection Center.

[0006] In another aspect, the application also discloses application of the Aspergillus sydowi in preparation of polysaccharides.

[0007] After fermentation optimization of the Aspergillus sydowi separated and purified in the application, the polysaccharide content value can reach 24.24 mg / ml.

[0008] In a third aspect, the application also discloses a method for preparing polysaccharides, comprising the following steps: Step 1: seed culture: inoculating the Aspergillus sydowi in claim 1 into a seed culture medium to obtain a seed culture solution; Step 2: fermentation culture: inoculating the seed culture solution into a fermentation culture medium and fermenting for a period of time; Step 3: collecting polysaccharides: after removing the mycelium in the fermentation solution, collecting the fermentation supernatant rich in extracellular polysaccharides; Step 4: polysaccharide extraction: adding ethanol to the fermentation supernatant to precipitate polysaccharides, centrifuging, and collecting the precipitate to obtain crude extracellular polysaccharides.

[0009] In some embodiments, the method for preparing polysaccharides further comprises step 5: Step 5: polysaccharide purification: after washing the crude extracellular polysaccharides with anhydrous ethanol for 3-5 times, redissolving the polysaccharides with pure water to obtain a purified extracellular polysaccharide extract.

[0010] In some embodiments, in the method for preparing polysaccharides, the fermentation culture medium contains glucose with a weight concentration of 12-18 %, beef extract with a weight concentration of 9-18 g / L, KH2PO4 with a weight / volume ratio of 1.0-1.5 %, MgSO4·7H2O with a weight / volume ratio of 0.5-0.8 %, and the pH is 5.5-6.0.

[0011] In some embodiments, in the method for preparing polysaccharides, the fermentation time in step 2 is 72-96 hours, and the fermentation temperature is 27°C.

[0012] In some embodiments, in the method for preparing polysaccharides, the inoculation amount of the seed culture solution in step 2 is 5-10 % (V / V), and a shaking table is used for fermentation in step 2, and the shaking table rotation speed is 180 r / min.

[0013] In some embodiments, in the method for preparing polysaccharides, the nitrogen source content in the fermentation culture medium in step 2 is 11.96 g / L, the carbon source weight content is 14.90 %, and the inoculation amount of the seed culture solution is 9.87 % (V / V). In a fourth aspect, the present application also discloses a food product comprising the Aspergillus sydowii.

[0014] In a fifth aspect, the present application also discloses a tea comprising the Aspergillus sydowii. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A glucose standard curve for the determination of the exopolysaccharide content.

[0016] Figure 2 A DNA electropherogram of 15 polysaccharide-producing fungal strains for strain isolation.

[0017] Figure 3 A phylogenetic tree of the strain LH-03 of the present application.

[0018] Figure 4 A result graph of the exopolysaccharide production by the strain LH-03 of the present application in liquid fermentation media of different carbon source types.

[0019] Figure 5 A result graph of the exopolysaccharide production by the strain LH-03 of the present application in liquid fermentation media of different glucose concentrations.

[0020] Figure 6 A result graph of the exopolysaccharide production by the strain LH-03 of the present application in liquid fermentation media of different nitrogen source types.

[0021] Figure 7 A result graph of the exopolysaccharide production by the strain LH-03 of the present application in liquid fermentation media of different beef extract concentrations.

[0022] Figure 8 A result graph of the exopolysaccharide production by the strain LH-03 of the present application under different culture time conditions.

[0023] Figure 9 A result graph of the exopolysaccharide production by the strain LH-03 of the present application under different culture temperature conditions.

[0024] Figure 10 A result graph of the exopolysaccharide production by the strain LH-03 of the present application under different inoculum conditions.

[0025] Figure 11 A result graph of the exopolysaccharide production by the strain LH-03 of the present application under different culture rotation speed conditions.

[0026] Figure 12 A response surface graph and an isohypsic graph of the effect of the nitrogen source and carbon source dosages on the polysaccharide production.

[0027] Figure 13The response surface plot and contour plot show the effects of nitrogen source content and inoculum amount on polysaccharide yield.

[0028] Figure 14 The response surface plot and contour plot show the effects of carbon source content and inoculum amount on polysaccharide yield.

[0029] Figure 15 This is a morphological diagram of strain LH-03 of this application. Detailed Implementation

[0030] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0031] Example 1 Isolation and purification of bacterial strains Preparation of Culture Medium: PDA (Potassium Dioxide Agar) medium preparation: Distilled water was boiled in an induction cooker. 200 g of peeled potatoes were weighed, cut into small pieces, and placed in the boiling water. The mixture was stirred constantly and boiled for another 20 minutes. The potato residue was then filtered through eight layers of gauze to obtain the extract. 20 g of glucose and 20 g of agar were added to the extract, and the volume was adjusted to 1000 mL with double-distilled water. The mixture was then autoclaved at 121°C for 20 minutes before use.

[0032] Preparation of seed liquid culture medium: 1L of seed liquid culture medium contains 35.0 g glucose, 10.0 g beef extract, 1.0 g potassium dihydrogen phosphate and 0.5 g magnesium sulfate heptahydrate. The solution is adjusted to pH 5.5-6.0 using a pH meter and then autoclaved at 121℃ for 20 min before use.

[0033] Preparation of liquid fermentation medium: 1L of liquid fermentation medium contains 35.0 g glucose, 10.0 g beef extract, 0.1 g KH2PO4, and 0.05 g MgSO4·7H2O. Adjust the pH to 5.5-6.0, sterilize at 121 ℃ for 20 min, and then use.

[0034] 2. Separation and purification Accurately weigh 10 g of tea leaves (select 4 samples of Liupao tea provided by Wuzhou Zhongtian Yuli Liupao Tea Co., Ltd., with aging periods of 2 years, 4 years, 6 years and 8 years respectively) into a 250 mL conical flask, inject 90 mL of sterilized distilled water, and treat for 15 min at 150 r / min to prepare 10 -1 times diluted initial bacterial suspension. Then, in a sterile operation table, mix 1 mL of the initial bacterial suspension with 9 mL of sterilized distilled water to obtain 10 -2 times diluted solution. Repeat the gradient dilution operation to prepare 10 -3 to 10 -6 times diluted series in turn. Take 600 μL of bacterial solution from each dilution gradient, use a sterile glass spreader to evenly spread on potato dextrose agar (PDA) plates, set up three parallel samples for each gradient, and place in a 28°C constant temperature incubator for inverted culture for 3-5 days.

[0035] Select the target fungal colonies on the plate and separate and purify them on PDA medium using the plate streaking method. Repeat the above streaking and separating steps until pure single colonies are obtained. Inoculate the purified strains into PDA slant medium and store at 4°C for future use.

[0036] 3. Liquid fermentation to screen polysaccharide-producing strains First, pick the colonies of the strains inoculated into PDA slant medium, wash the fungal spores on the medium with 10 mL of sterile normal saline to obtain a spore suspension. Adjust the spore concentration to 1×10 6 6 / mL, and then inoculate 5 mL into a culture bottle containing 40 mL of seed medium. Place the inoculated culture bottle in a 28°C constant temperature shaker at a rotation speed of 180 rpm for 24 hours to obtain a seed solution.

[0037] Use 250 mL conical flasks for the fermentation culture stage, each containing 50 mL of liquid fermentation medium, and inoculate the above seed solution at a 10% v / v inoculation amount. Maintain the culture conditions at a constant temperature of 28°C and a shaking rotation speed of 180 rpm, and continue the culture for 4 days to complete the fermentation process.

[0038] After the culture is completed, separate the fermentation broth from the bacterial cells by vacuum filtration: the filtrate is used to determine the content of extracellular polysaccharide, and the bacterial cell precipitate is used to extract intracellular polysaccharide.

[0039] 4. Construct a glucose standard curve using the phenol-sulfuric acid colorimetric method for quantitative analysis of soluble sugars in samples. The specific steps are as follows: Accurately weigh 0.0100 g of anhydrous glucose, dissolve in a suitable amount of deionized water, transfer to a 100 mL volumetric flask, and dilute to the mark with deionized water to prepare a glucose standard stock solution with a concentration of 100 μg / mL.

[0040] Take 0 mL, 0.2 mL, 0.4 mL, 0.5 mL, 0.6 mL, 0.8 mL, 1.0 mL, and 1.2 mL of standard glucose stock solution into test tubes, and dilute to 2.0 mL with deionized water to prepare standard working solutions with concentrations of 0, 0.010, 0.020, 0.025, 0.030, 0.040, 0.050, and 0.060 mg / mL, respectively. Then, take 0.5 mL of each of the above series of standard working solutions and place them into clean test tubes. Add 0.75 mL of 5% phenol solution to each tube, followed by 3.75 mL of concentrated sulfuric acid. Mix thoroughly and allow to stand at room temperature in the dark for 30 minutes.

[0041] After the reaction was completed, using ultrapure water as a blank control, the absorbance (OD value) of each reaction solution was measured at a wavelength of 490 nm using a UV spectrophotometer. A standard working curve was plotted with the glucose standard solution concentration (mg / mL) on the x-axis and the absorbance value on the y-axis. Figure 1 The standard curve's sub-regression equation is y = 2.4828x - 0.0164, with R² = 0.9991. Here, y represents the absorbance value, and x represents the glucose concentration (mg / mL).

[0042] 5. Determination of Extracellular Polysaccharides: After removing mycelia from the fermentation broth using vacuum filtration, polysaccharides were precipitated using 95% ethanol at a ratio of 1:4 (v / v). The mixture was incubated at 4 ℃ for 12 hours to ensure complete precipitation. The precipitate was then centrifuged at 4000 rpm for 10 minutes, and the precipitate was collected as crude extracellular polysaccharides. This precipitate was washed repeatedly with anhydrous ethanol and then redissolved in 5 mL of ultrapure water to obtain the extracellular polysaccharide extract. The polysaccharide content in the sample was finally determined using the phenol-sulfuric acid colorimetric method.

[0043] Fifteen strains with high extracellular polysaccharide production were finally screened, and one strain with high genetic stability, LH-3, was selected and deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.41987.

[0044] Example 2 Identification of Aspergillus that produces extracellular polysaccharides 1. Morphological observation The bacterial strain was removed from the 4°C freezer and activated at a constant temperature of 28°C for 24 hours. The activated strain was then transferred to the surface of the culture medium using a three-point inoculation method and incubated upside down in a 28°C incubator. Colony growth was observed and recorded daily, with a focus on analyzing its edge morphology, color, texture, and overall structural characteristics.

[0045] The morphological characteristics of strain LH-3 are as follows: After culturing on PDA plates for 5 days, the colonies are pale yellow to golden yellow, with neat edges, a loose texture, a dry surface, and obvious aerial hyphae. Microscopic examination shows that the hyphae are clearly branched, with curved growth and branching. The hyphal tips appear to have some swelling or special structures, and the overall appearance is relatively sparse (e.g., Figure 15 (As shown).

[0046] 2. Molecular identification 2.1 DNA Extraction Typical single colonies were selected using a sterile inoculation loop and inoculated onto freshly prepared PDA agar plates. The plates were then transferred to a 28°C incubator and cultured until the colony diameter reached 1 cm. The culture surface was rinsed with sterile physiological saline to obtain a spore suspension. Hyphae were then collected using a sterile scraper into sterile EP tubes. Two mL of the spore suspension was inoculated onto liquid seed culture medium and cultured at 28°C with shaking at 180 r / min for 72 hours. The hyphae were collected by centrifugation for total DNA extraction. Take a 1.5 mL centrifuge tube, add 50 μL of 50 mmol / L NaOH solution, transfer the mycelium into the tube, and thoroughly grind it with a sterile pipette tip to completely lyse the mycelium. Then, seal the tube with sealing film and place it in a 700 W microwave oven for 30 s. Immediately afterwards, cool the sample rapidly by incubating it on ice for 5 min. Place the pretreated sample in a centrifuge at 4℃ and centrifuge at a relative centrifugal force of 12000×g for 2 minutes. After centrifugation, aspirate 10 μL of the supernatant as a PCR amplification template. The obtained DNA template is aliquoted and stored at -20℃ for later use.

[0047] 2.2 DNA Sample PCR Amplification Primers (purchased from Sangon Biotech (Shanghai) Co., Ltd.): ITS1F: 5'-CTTGGTCATTTAGAGGAAGTAA-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0048] The PCR amplification reaction system is shown in Table 1. Table 1 PCR amplification reaction system

[0049] PCR amplification conditions are shown in Table 2. Table 2 PCR amplification conditions

[0050] 2.3 DNA electrophoresis detection Preparation of agarose gel Gel preparation: 1 g of agarose was mixed with 100 mL of 1x TAE buffer, dissolved by microwave heating, then 1.5 μL of GoldView™ nucleic acid dye was added and mixed well.

[0051] Gel molding: pour the above solution into the gel molding mold, insert the comb, and place it at room temperature for 20 min to fully solidify, then remove the comb.

[0052] Electrophoresis analysis Electrophoresis preparation: transfer the solidified gel to the electrophoresis tank, and inject 1x TAE buffer to make the liquid level higher than the gel surface by 2 mm.

[0053] Sample loading: mix 2 μL of PCR amplification product with loading buffer, and accurately load into the sample well.

[0054] Electrophoresis running: after closing the electrophoresis tank, connect the power supply, set the electrophoresis parameters to 110 V voltage and 100 mA current, and continue electrophoresis for 40 min, then terminate the experiment.

[0055] 3 DNA electrophoresis results The DNA sequence of polysaccharide LH-3 produced by strain 1 was amplified by PCR amplification technology, and 700-1000 bp of amplification product was obtained. The electrophoresis detection results are shown in Figure 2 (MARK between 1000 bp and 750 bp).

[0056] 4 PCR product testing and sequencing Using 1.0% agarose gel electrophoresis combined with gel imaging analysis, a single DNA band below 1000 bp was observed, which was preliminarily judged to be the ITS region amplification product of the strain. ITS sequence is a commonly used molecular marker in fungal classification and identification, which can effectively distinguish the species relationship of different strains due to its high inter-specific variability and conservation. After electrophoretic detection of the PCR amplification product, it was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing analysis. The ITS rDNA sequence of LH-3 was submitted to NCBI database, BLAST analysis and retrieval were performed, and Mega11.0 software was used for multiple sequence alignment, and the neighbor-joining method was used to construct the phylogenetic tree Figure 3 ), which showed that the strain had a sequence homology of up to 100% with Aspergillus chevalieri , and the strain was identified as Aspergillus chevalieri Aspergillus chevalieri.

[0057] The ITS rDNA sequence of Aspergillus chevalieri isolated in Example 1 is as follows (SEQ ID NO: 1): TGCCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAA Example 3 Fermentation process optimization Strain LH-03 was used as the strain for optimizing the fermentation conditions for polysaccharide production.

[0058] Single-factor experiment 1 Carbon source screening Experimental method: Single-factor carbon source optimization experiment design was used, with the carbon source in the liquid fermentation medium formula as the variable. The carbon sources in each liquid fermentation medium were glucose, sucrose, lactose, maltose and fructose, and they were the only carbon source. The concentration of the carbon source in the liquid fermentation medium was maintained at 35 g / L, and the medium without the addition of carbon source was used as a blank control. After inoculating 10% v / v concentration of 1 x 10 6 ML of Aspergillus chevalieri seed liquid, it was cultured at 28 °C, 180 rpm for 96 h, and the exopolysaccharide yield was determined to determine the preferred carbon source. Each group of experiments was repeated 3 times, and the average polysaccharide yield was taken as the final result.

[0059] Results and analysis: Carbon source, as the basic nutrient component necessary for microbial growth, not only provides energy source for metabolic activities of the bacteria, but also ensures the maintenance of normal physiological functions. Fungi can utilize a variety of carbon sources for growth and metabolism, such as monosaccharides, disaccharides and polysaccharides, etc. The results of the production of exopolysaccharide by strain LH-03 in liquid fermentation medium with different carbon sources are shown in Table 1. Figure 4 As can be seen from Table 1, Figure 4 different carbon sources have a significant impact on the synthesis of exopolysaccharide by strain LH-03. Among the five carbon sources tested, the polysaccharide yields in glucose, sucrose, lactose, maltose and fructose culture groups were 11.23 mg / mL, 8.46 mg / mL, 9.59 mg / mL, 7.72 mg / mL, respectively. The polysaccharide yields in glucose and lactose culture groups were relatively high. It is particularly noteworthy that when glucose is used as the carbon source, the strain exhibits the best metabolic activity, with the highest exopolysaccharide yield of 11.23 mg / mL. This data fully proves that glucose is the best carbon source choice for promoting polysaccharide biosynthesis by strain LH-03.

[0060] 2Carbon source concentration optimization Experimental method: The optimal carbon source is selected, and a concentration gradient of 5-25% is set. The other conditions during the preparation of the liquid fermentation medium and the fermentation conditions are kept consistent with the above-mentioned carbon source screening. The optimal carbon source concentration is determined by measuring the polysaccharide yield. Each test is repeated three times, and the average polysaccharide yield is taken as the final result.

[0061] Results and analysis: The results of the production of exopolysaccharide by strain LH-03 in liquid fermentation medium with different glucose concentrations are shown in Table 2. Figure 5 As can be seen from Table 2, Figure 5 the measured exopolysaccharide yields corresponding to glucose concentrations of 5%, 10%, 15%, 20%, and 25% were 5.9 mg / mL, 6.35 mg / mL, 7.49 mg / mL, 6.89 mg / mL, and 5.96 mg / mL, respectively. The exopolysaccharide synthesis efficiency of strain LH-03 showed a non-linear relationship with the glucose concentration. The experimental data showed that before the glucose mass fraction reached 15% (m / m), the polysaccharide yield increased significantly with increasing substrate concentration; however, beyond this critical value, the product accumulation showed a downward trend. This phenomenon indicates that a lower carbon source supply limits the nutritional needs of the bacteria, affecting their growth and metabolism and polysaccharide biosynthesis; while a higher glucose concentration causes substrate inhibition, which adversely affects the physiological activity of the strain and product formation. Based on the above experimental results, 15% is determined as the optimal glucose addition concentration for subsequent fermentation process optimization.

[0062] 3Nitrogen source screening Experimental method: Fix the optimized carbon source condition (glucose, concentration of 15%), take the nitrogen source in the liquid fermentation medium formula as the variable, the nitrogen source of each liquid fermentation medium is yeast powder, peptone, beef extract, and , and as a single nitrogen source, keep the concentration of nitrogen source in the liquid fermentation medium at 10 g / L, and take the culture medium without adding nitrogen source as a blank control, keep other conditions and fermentation conditions in the preparation process of the liquid fermentation medium consistent with the above carbon source screening. Compare the effects of different nitrogen sources on polysaccharide synthesis. Each test is repeated 3 times, and the average value of polysaccharide yield is taken as the final result.

[0063] Results and analysis: Nitrogen source is an indispensable key nutrient component in the growth and metabolism of microorganisms, which plays a core role in physiological processes such as protein synthesis, nucleic acid construction and amino acid metabolism in the cell by participating in various biosynthesis pathways. The results of strain LH-03 producing extracellular polysaccharide in liquid fermentation medium with different nitrogen sources are shown in Figure 6 , it can be seen from Figure 6 that the polysaccharide yields of yeast powder, peptone, beef extract, and culture groups are 6.92 mg / mL, 7.44 mg / mL, 9.52 mg / mL, 0.19 mg / mL, 0.91 mg / mL respectively. Different nitrogen sources have a significant impact on polysaccharide synthesis of the strain. Among the five nitrogen sources tested, organic nitrogen sources (beef extract and peptone) are significantly better than inorganic nitrogen sources (NH4Cl and yeast extract), and ), among which the extracellular polysaccharide yield of the beef extract culture group is the highest. Based on the above analysis, beef extract is selected as the best nitrogen source for culturing strain LH-03.

[0064] 4 Nitrogen source concentration optimization Experimental method: Fix the optimized carbon source condition (glucose, concentration of 15%), and select the best nitrogen source (beef extract), set the concentration gradient of 6-30 g / L, keep other conditions and fermentation conditions in the preparation process of the liquid fermentation medium consistent with the above carbon source screening, and determine the optimal nitrogen source concentration by polysaccharide yield determination. Each test is repeated 3 times, and the average value of polysaccharide yield is taken as the final result.

[0065] Results and analysis: The results of strain LH-03 producing extracellular polysaccharide in liquid fermentation medium with different beef extract concentrations are shown in Figure 7 , it can be seen from Figure 7It can be seen that the beef extract concentration is 6 g / L, 12 g / L, 18 g / L, 24 g / L, 30 g / L, and the corresponding measured exopolysaccharide yield is 7.78 mg / mL, 16.54 mg / mL, 13.22 mg / mL, 11.36 mg / mL, 10.32 mg / mL, respectively. The synthesis efficiency of exopolysaccharide of strain LH-03 and the addition amount of beef extract present a nonlinear relationship, and the yield increases first and then decreases with the increase of nutrient concentration. It shows that the content of nitrogen source has an effect on the synthesis of polysaccharide by strain LH-03, and appropriate increase of nitrogen source content within a certain range is beneficial to the synthesis of polysaccharide by strain LH-03, and once it exceeds the range, it will hinder the polysaccharide production of strain LH-03. Therefore, the nitrogen source concentration of 12 g / L is selected for the next experiment.

[0066] 5Optimization of culture time Experimental method: Under the premise of fixed optimal carbon source condition (glucose 15%) and optimal nitrogen source condition (beef extract 12 g / L), set the culture time gradient of 24 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h (1-7 d), keep other conditions in the preparation process of liquid fermentation medium and other conditions of fermentation consistent with the above carbon source screening, sample every 24 h to determine the polysaccharide content. Each group of test is repeated 3 times, and the average value of polysaccharide yield is taken as the final result.

[0067] Results and analysis: Culture time has a significant regulatory effect on the physiological state of the strain, and insufficient culture time will lead to immature development of the strain, while too long culture time will cause the strain to be senescent, both of which are not conducive to maintaining the optimal metabolic activity. In order to explore the effect of culture time on the polysaccharide synthesis of LH-03 strain, the exopolysaccharide yield of different culture time (24 h-168 h) was determined Figure 8 ), the exopolysaccharide yield corresponding to the culture time of 24 h, 48 h, 72 h, 96 h, 120 h, 144 h, 168 h is 5.83 mg / mL, 7.36 mg / mL, 14.33 mg / mL, 12.35 mg / mL, 8.19 mg / mL, 5.52 mg / mL, 4.27 mg / mL, respectively, and it is found that the polysaccharide synthesis capacity of the strain reaches the peak value when the culture time is 72 h.

[0068] 6Optimization of culture temperature Experimental method: Under the premise of fixing the optimized optimal carbon source conditions (glucose 15%), the optimal nitrogen source conditions (beef extract 12 g / L), and the optimal culture time (72 h), the strain LH-03 was cultured at 24 ℃, 27 ℃, 30 ℃, 33 ℃, and 36 ℃, respectively, keeping the other conditions in the preparation process of the liquid fermentation medium and the other conditions of the fermentation consistent with those of the carbon source screening, to determine the optimal culture temperature by taking the polysaccharide yield of the strain LH-03 as the index. Each group of tests was repeated for 3 times, and the average value of the polysaccharide yield was taken as the final result.

[0069] Results and analysis: The proliferation of microorganisms and the biosynthesis process of their secondary metabolites have high complexity, and a series of physiological activities need to rely on a catalytic system composed of multiple enzymes and must be effectively carried out under specific temperature conditions. Therefore, for the growth and metabolism process of the strain LH-03, it is crucial to maintain a suitable temperature. The temperature regulation mechanism plays a key role in the fermentation process of the strain, which regulates the physiological metabolism of microorganisms by changing the enzyme reaction rate, and finally determines the biosynthesis efficiency and extracellular secretion level of the target product. The results of the extracellular polysaccharide production of the strain LH-03 under different culture temperature conditions are shown in Table 1. Figure 9 Figure 9 As can be seen from Table 1, when the culture temperature was 24 ℃, 27 ℃, 30 ℃, 33 ℃, and 36 ℃, the corresponding measured extracellular polysaccharide yield was 7.72 mg / mL, 8.17 mg / mL, 7.12 mg / mL, 5.80 mg / mL, and 4.63 mg / mL, respectively. When the temperature was in the range of 24 to 27 ℃, the extracellular polysaccharide synthesis efficiency of the strain LH-03 showed obvious temperature dependence. Before the culture temperature rose to 27 ℃, the polysaccharide yield showed an increasing trend, and after exceeding this critical temperature, it turned to be decreasing. Based on this temperature response characteristic, 27 ℃ was determined as the optimal culture temperature of the strain in the subsequent experiment.

[0070] 7 Optimization of inoculum size Experimental method: Under the premise of fixing the optimized optimal carbon source conditions (glucose 15%), the optimal nitrogen source conditions (beef extract 12 g / L), the optimal culture time (72 h), and the optimal culture temperature (27 ℃), 1 × 10 6 6 The other conditions in the preparation process of the liquid fermentation medium and the other conditions of the fermentation were kept consistent with those of the carbon source screening, and the optimal inoculum size was screened by measuring the polysaccharide yield of the strain LH-03. Each group of tests was repeated for 3 times, and the average value of the polysaccharide yield was taken as the final result.

[0071] Results and Analysis: The results of extracellular polysaccharide production by strain LH-03 under different inoculum amounts are as follows: Figure 10 As shown, by Figure 10 It was found that when the inoculum concentrations were 1% v / v, 4% v / v, 7% v / v, 10% v / v, 13% v / v, and 16% v / v, the corresponding extracellular polysaccharide yields were 9.85 mg / mL, 10.77 mg / mL, 12.65 mg / mL, 22.94 mg / mL, 15.69 mg / mL, and 15.28 mg / mL, respectively. The biosynthetic efficiency of extracellular polysaccharides from strain LH-03 exhibited a typical bell-shaped curve relationship with the inoculum concentration. Experimental data showed that the inoculum concentration significantly affected the polysaccharide production capacity of this strain. Within a specific range, increasing the inoculum concentration promoted polysaccharide accumulation, but exceeding the optimal threshold inhibited product formation. Therefore, the optimal inoculum concentration was 10% v / v.

[0072] 8. Optimization of culture rotation speed Experimental Methods: Under the optimized conditions of optimal carbon source (15% glucose), optimal nitrogen source (12 g / L beef extract), optimal culture time (72 h), optimal culture temperature (27 ℃), and optimal inoculum size (10% v / v), strain LH-03 was cultured at 90 r / min, 120 r / min, 150 r / min, 180 r / min, and 210 r / min, respectively, with the culture speed as the variable. The culture speed was determined by the polysaccharide yield of strain LH-03. Each experiment was repeated three times, and the average polysaccharide yield was taken as the final result.

[0073] Results and Analysis: The results of extracellular polysaccharide production by strain LH-03 under different culture speeds are as follows: Figure 11 As shown, by Figure 11 It was found that the extracellular polysaccharide yields at cultivation speeds of 90 r / min, 120 r / min, 150 r / min, 180 r / min, and 210 r / min were 1.26 mg / mL, 1.45 mg / mL, 1.69 mg / mL, 2.17 mg / mL, and 1.86 mg / mL, respectively. When the shaker speed was set to 180 r / min, strain LH-03 exhibited the best extracellular polysaccharide production capacity, reaching a yield of 2.16 mg / mL. It is noteworthy that when the speed exceeded this critical value, the increased shear force due to the increased impeller velocity negatively impacted the mycelial structure, thus reducing polysaccharide synthesis efficiency.

[0074] Example 4 Response surface methodology Experimental method: Based on the results of single factor experiment, this study adopts Box-Behnken response surface method to design the optimization experiment scheme. Select three key parameters which have significant influence on the yield of polysaccharide of strain LH-03 as independent variables: A (nitrogen source concentration), B (carbon source content) and C (inoculum size). Set three experimental levels for each factor, respectively coded as -1 (low level), 0 (central point) and +1 (high level), in which the central point level corresponds to the optimal value of the parameter in the single factor experiment (the highest yield of polysaccharide when other conditions are fixed). Take the content of extracellular polysaccharide as the response value (R), establish the experimental matrix of three factors and three levels (Table 6). The experimental design and data analysis are completed by Design-Expert 13 statistical software, including experimental scheme generation and response surface model construction.

[0075] Table 6 Box-Behnken experimental design factor level

[0076] Results and analysis: Based on the results of single factor experiment of strain LH-03 producing extracellular polysaccharide, since the nitrogen content, carbon content and inoculum size are significant influencing factors, therefore, the nitrogen content, carbon content and inoculum size are selected as independent variables for response surface optimization, respectively represented by letters A, B and C. Based on Box-Behnken response surface design method, this study optimizes the key reaction parameters systematically, and the specific experimental scheme and corresponding results are shown in Table 7. Subsequently, with the help of Design-Expert 13 statistical software platform, multiple regression analysis is carried out on experimental data, including analysis of variance (ANOVA) and model fitting degree evaluation, etc. statistical processing, and the multiple quadratic regression model equation of polysaccharide content on each factor is obtained: Y=23.21-0.0275A-0.1150B-0.5600C+1.64AB+0.1425AC-0.7325BC-5.15A 2 +2.48B 2 -6.54C 2 .

[0077] The variance analysis and significance analysis of the model are shown in Table 8.

[0078] Table 7 Box-Behnken experimental design and results

[0079] Table 8 Regression model variance and significance of polysaccharide content

[0080] The variance analysis results of polysaccharide content regression model show that the model has excellent fitting degree, and the correlation coefficient (R2 =0.9743) and the corrected coefficient of determination (Adj.R.) 2 The values ​​(F=0.9412) are close to 1, indicating a high degree of agreement between the model's predicted and observed values. The model significance test shows an F-statistic of 29.46 and P<0.0001, confirming the model's high statistical significance. The lack-of-fit analysis (F=5.98, P=0.0584>0.05) indicates no significant bias in the model, demonstrating its ability to effectively predict the polysaccharide extraction efficiency of strain LH-03. Model accuracy assessment shows a coefficient of variation of only 7.09%, reflecting good consistency and reproducibility of the experimental data. Factor effect analysis shows that the quadratic term A... 2 and C 2 The effect on polysaccharide content reached a highly significant level (P<0.01), while the interaction term AB and the quadratic term B... 2 The effect was also statistically significant (P<0.05).

[0081] The interaction effects of nitrogen source concentration, carbon source content, and inoculum size were systematically analyzed using Design-Expert 13 software. The results are as follows: Figures 12-14 As shown, by constructing a three-dimensional response surface model and corresponding contour plots, the influence of various factor combinations on polysaccharide synthesis in strain LH-03 is visually demonstrated. When any factor is at its optimal level, the relationship between the other two variables and the response value exhibits typical convex surface characteristics, with the vertices corresponding to the theoretical maximum polysaccharide yield. Surface curvature analysis shows that the edge curvature is positively correlated with the significance of the factors; the contour lines exhibit a distinct elliptical distribution, and the greater the eccentricity, the more significant the synergistic effect among the factors. These characteristics collectively confirm the existence of a clear optimal combination of process parameters in the experimental system.

[0082] from Figure 12 It can be seen that under the condition of 10% v / v inoculum, the fungal polysaccharide yield reaches its highest value when the nitrogen source content is 9-15 g / L and the carbon source content is 12-16%. Beyond this range, the polysaccharide content gradually decreases with the increase or decrease of the extraction nitrogen and carbon source amounts. The contour lines are elliptical, indicating that the polysaccharide yield of strain LH-03 is significantly affected by the interaction of nitrogen and carbon source amounts.

[0083] Depend on Figure 13 It was found that with a carbon source content of 15% as the central point, and nitrogen source concentrations between 9 and 15 g / L, and inoculum concentrations maintained between 9% and 11% v / v, the extracellular polysaccharide synthesis efficiency of strain LH-03 reached its peak. Beyond this optimal range, polysaccharide production decreased with increasing nitrogen source concentration and inoculum size. Response surface methodology showed that the interaction between nitrogen source concentration and inoculum size significantly affected polysaccharide accumulation, a conclusion supported by the elliptical contour distribution pattern.

[0084] From Figure 14 It can be analyzed that, with the nitrogen source content of 12 g / L as the center point, the carbon source content is 12-18%, and the inoculation amount is 9-12%, the polysaccharide yield reaches the highest value, when the carbon source content and the inoculation amount exceed this range, with the increase or decrease of them, the polysaccharide yield decreases. The contour is oval, which shows that the production of strain LH-03 polysaccharide is significantly affected by the interaction of carbon source content and inoculation amount.

[0085] Through the above regression model, the fermentation conditions are optimized by using Design-Expert 13 software, and the optimal polysaccharide fermentation conditions are obtained: the nitrogen source content is 11.96 g / L, the carbon source content is 14.90%, and the inoculation amount is 9.87%. At this time, the polysaccharide yield of strain LH-03 is the highest, and the predicted value is 23.22 mg / mL. The fermentation parameters obtained by response surface method are verified by experiment (except that the nitrogen source content is 11.96 g / L, the carbon source content is 14.90%, and the inoculation amount is 9.87%, the experimental method is the same as the liquid fermentation screening polysaccharide-producing strain experiment in embodiment 1). The result shows that the polysaccharide content value is 24.24 mg / mL, and the relative error between the experimental value and the predicted value is only 0.9% deviation. This result fully confirms the accuracy and reliability of the response surface optimization scheme. It is worth noting that the polysaccharide content of strain LH-3 without process optimization is 5.8231 mg / mL, and the polysaccharide content of strain LH-3 after optimization reaches 24.24 mg / mL, which is 4 times higher than before optimization.

[0086] In summary, 15 strains of polysaccharide-producing Aspergillus were isolated from Liupao tea of four different years. Among them, strain LH-03 showed the best polysaccharide production capacity. Through the combination of morphological characteristics observation and ITS sequence analysis, the high-yield strain was finally identified as Aspergillus chevalieri. Aspergillus chevalieri). The fermentation process of strain LH-03 was comprehensively screened and optimized by single factor variable analysis method. The key factors were mainly explored as follows: (1) selection of different nitrogen sources and setting of concentration gradient; (2) applicability of various carbon sources and their optimal addition amount; (3) optimization of culture time; (4) regulation of temperature conditions; (5) determination of inoculum concentration; (6) key parameters such as shaking frequency. Through the control of single variable method, the influence of each factor on the polysaccharide yield of strain LH-03 was evaluated. Finally, the nitrogen content, carbon content and inoculum amount were selected for response surface test by Design-Expert.13 software. The results showed that the optimal polysaccharide production conditions were as follows: nitrogen content 11.96 g / L, carbon content 14.9%, inoculum amount 9.87%, culture time 3 d, culture temperature 28℃, and shaking speed 180 rmp. Before the fermentation process optimization, the polysaccharide content of strain LH-3 was 5.82 mg / mL, and after optimization, the polysaccharide content of strain LH-03 reached 24.24 mg / mL. The polysaccharide yield of strain LH-03 was increased by 4 times after the fermentation process optimization.

Claims

1. An Aspergillus sydowi characterized in that, Aspergillus shirouziensis LH-3, and the preservation number is CGMCC NO. 41987.

2. Use of the Aspergillus shirouziensis in claim 1 in the preparation of polysaccharides.

3. A method for preparing polysaccharides, comprising the following steps: Step 1: seed culture: inoculating the Aspergillus shirouziensis in claim 1 into a seed culture medium to obtain a seed culture solution; Step 2: fermentation culture: inoculating the seed culture solution into a fermentation culture medium and fermenting for a period of time; Step 3: collecting polysaccharides: after removing the mycelium in the fermentation solution, collecting the fermentation supernatant rich in extracellular polysaccharides; Step 4: polysaccharide extraction: adding ethanol to the fermentation supernatant to precipitate polysaccharides, centrifuging, and collecting the precipitate to obtain crude extracellular polysaccharides.

4. The method for preparing polysaccharides according to claim 3, further comprising step 5: Step 5: polysaccharide purification: washing the crude extracellular polysaccharides with anhydrous ethanol 3-5 times, and then redissolving with pure water to obtain a purified extracellular polysaccharide extract.

5. The method of producing a polysaccharide according to claim 3, wherein, The fermentation culture medium contains glucose at a weight concentration of 12-18 %, beef extract at 9-18 g / L, KH2PO4 at a weight / volume ratio of 1.0-1.5 %, MgSO4·7H2O at a weight / volume ratio of 0.5-0.8 %, and pH is 5.5-6.

0.

6. The method of producing a polysaccharide according to claim 3, wherein, The fermentation time in step 2 is 72-96 hours, and the fermentation temperature is 27°C.

7. The method of producing a polysaccharide according to claim 3, wherein, The inoculation amount of the seed culture solution in step 2 is 5-10% (V / V), and a shaking table is used for fermentation in step 2, and the shaking table rotation speed is 180 r / min.

8. The method for preparing polysaccharides according to claim 3, wherein the nitrogen source content in the fermentation culture medium in step 2 is 11.96 g / L, the carbon source weight content is 14.90%, and the inoculation amount of the seed culture solution is 9.87% (V / V).

9. A food product containing the Aspergillus shirouziensis in claim 1.

10. A tea containing the Aspergillus shirouziensis in claim 1.