Aspergillus cristatum and application thereof

Abstract

The invention relates to the field of microorganisms, and discloses an aspergillus cristatus strain and application thereof. The preservation number of the aspergillus cristatus provided by the invention is CGMCC (China General Microbiological Culture Collection Center) No.41727. The aspergillus cristatus provided by the invention can produce chymosin at high yield, has excellent curding activity and relatively low proteolytic activity, and can reduce the bitter taste of dairy products and improve the yield; the aspergillus cristatus provided by the invention not only can shorten the fermentation time of the dairy product, improve the cream flavor of the dairy product, reduce the peculiar smell of the dairy product, balance the sourness and sweetness of the dairy product and improve the cinnamon flavor, but also has intestinal colonization ability, and has the potential of improving the flavor level of the dairy product and becoming intestinal probiotics.

Description

Technical Field

[0001] This invention relates to the field of microbiology, specifically to a strain of Aspergillus cristatus and its applications. Background Technology

[0002] Rennet plays a crucial role in health products and the food industry, particularly in dairy processing. During cheese production, rennet facilitates the transformation of casein in the milk from a dissolved state to a gel state, forming the core of the product's texture. Simultaneously, it serves as a nutritional supplement and digestive enzyme, optimizing the body's digestion and absorption of nutrients. Traditionally, rennet has primarily been derived from newborn mammals (such as the abomasum of calves). However, the production of these animal-derived rennets is limited and cannot meet the increasing demand, and some consumers have reservations about animal-derived rennets.

[0003] Microbial rennet is a core direction for replacing animal-derived rennet, offering advantages such as low cost, ease of extraction, high economic benefits, and production not being limited by season or region. However, existing microbial rennets suffer from problems such as low rennet activity.

[0004] Currently, Streptococcus thermophilus ( Streptococcus thermophilus Lactobacillus bulgaricus ( Lactobacillus bulgaricus ), Max Kluyveromycin ( Kluyveromyces marxianus While some fungi, such as Aspergillus cristatus, are commonly used in fermented dairy products (e.g., butter and cheese), no single strain of Aspergillus cristatus is suitable for use in fermented dairy products. Aspergillus cristatus is a filamentous fungus that combines food safety with bioactivity. Traditionally, it is widely recognized for its role in the fermentation of Fu brick tea. Its metabolites (such as polysaccharides, polyphenols, and enzymes) have been shown to possess antioxidant, anti-inflammatory, and metabolic-regulating functions, but these effects are mostly based on in vitro experiments or short-term interventions. Even after surviving stomach acid and bile, most probiotic strains may not be able to adapt to the intestinal microenvironment (e.g., competition with existing flora or competition for nutrients) and thus struggle to colonize, resulting in their probiotic effects being only temporary and failing to provide sustained health benefits.

[0005] Therefore, there is an urgent need to develop Aspergillus cristatus for fermented dairy products, which combines high rennet production, high rennet activity, and intestinal colonization ability. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned problems existing in the prior art and to provide a strain of Aspergillus cristatus and its applications.

[0007] To achieve the above objectives, the first aspect of the present invention provides a strain of Aspergillus cristatus (… Aspergillus cristatus The preservation number of Aspergillus cristatus is CGMCC No. 41727.

[0008] The second aspect of the present application provides a mycelium freeze-dried powder, wherein the mycelium freeze-dried powder contains the mycelium of Aspergillus corntus with the preservation number of CGMCC No.41727 and skimmed milk powder.

[0009] The third aspect of the present application provides a spore powder, wherein the spore powder contains the spore of Aspergillus corntus with the preservation number of CGMCC No.41727.

[0010] The fourth aspect of the present application provides a method for promoting milk clotting, which comprises inoculating a fermentation starter into a dairy raw material for fermentation, wherein the fermentation starter comprises Aspergillus corntus with the preservation number of CGMCC No.41727.

[0011] The fifth aspect of the present application provides a method for fermenting a dairy product, which comprises inoculating a fermentation starter into a dairy raw material for fermentation, wherein the fermentation starter comprises Aspergillus corntus with the preservation number of CGMCC No.41727.

[0012] The sixth aspect of the present application provides the use of the Aspergillus corntus of the first aspect in promoting milk clotting.

[0013] The seventh aspect of the present application provides the use of the Aspergillus corntus of the first aspect in improving the flavor of a fermented dairy product.

[0014] Through the above technical solutions, the present application has at least the following beneficial effects: (1) The Aspergillus corntus provided by the present application can produce chymosin at a high yield, has excellent milk clotting activity and relatively low proteolytic activity, and can reduce the bitterness of dairy products and improve the yield; (2) The Aspergillus corntus provided by the present application not only can shorten the fermentation time of dairy products, improve the creamy flavor of dairy products, reduce the off-flavor of dairy products, and balance the sour and sweet flavors of dairy products, but also can specifically improve the cinnamon flavor and other flavor levels, and has the ability to colonize the intestinal tract and the potential to become an intestinal probiotic.

[0015] Biological preservation The strain provided by the present application is named Aspergillus corntus Aspergillus cristatus , which was preserved in the China General Microbiological Culture Collection Center (abbreviated as CGMCC) on December 23, 2024, with the preservation number of CGMCC No.41727 and the preservation address of No.3, Beichen West Road, Haidian District, Beijing. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a microscopic photograph of the sporangium of Aspergillus corntus CCHN008; Figure 2 is a microscopic photograph of the spore of Aspergillus corntus CCHN008; Figure 3 are the results of curd and hydrolysis circles of CCHN008 and CICC2650. DETAILED DESCRIPTION

[0017] The endpoints of the ranges and any values disclosed herein are not limited to the precise values recited as exactly that endpoint. Any values that fall within common

[0018] The inventors of the present application accidentally isolated a strain of Aspergillus corntus (A. corntus) with the property of intestinal colonization during research Aspergillus cristatus ) CCNH008, and further research showed that CCNH008 has a curdling effect and can be used for fermented dairy products, improving the taste and flavor of fermented dairy products, and especially giving fermented dairy products a special cinnamon flavor.

[0019] Based on the above findings, the present application provides, in a first aspect, a strain of Aspergillus corntus (A. corntus) Aspergillus cristatus The preservation number of the Aspergillus corntus is CGMCC No. 41727.

[0020] In the present application, the "Aspergillus corntus provided by the present application", "Aspergillus corntus CCNH008", "strain CCNH008" and "CCNH008" all refer to the Aspergillus corntus with the preservation number CGMCC No. 41727.

[0021] The present application provides, in a second aspect, a mycelium lyophilized powder containing the mycelium of the Aspergillus corntus with the preservation number CGMCC No. 41727 and skimmed milk powder.

[0022] The present application provides, in a third aspect, a spore powder containing the spores of the Aspergillus corntus with the preservation number CGMCC No. 41727.

[0023] In the present application, the spore powder can be prepared using methods commonly used in the art, for example, inoculating the spores of the Aspergillus corntus with the preservation number CGMCC No. 41727 on a base material for fermentation.

[0024] In the present application, the base material used for preparing the spore powder can be the commonly used material in the art, however, the inventors of the present application found in the research that, compared with other commonly used base materials, the spore powder prepared by taking bran, Pu'er tea, green tea, black tea, white tea, Liupao tea, black tea or rice as the base material, exhibits more excellent results in the storage time and performance stability, and the spore powder prepared from the above-mentioned base materials also has more beneficial acid resistance / cholic acid resistance, stronger colonization ability, and can impart more excellent flavor to the fermented milk product. Based on the above-mentioned finding, the present application provides a spore powder, and the base material used in the present application is at least one of bran, Pu'er tea, green tea, black tea, white tea, Liupao tea, black tea or rice. In some specific embodiments of the present application, the base material is preferably black tea.

[0025] The fourth aspect of the present application provides a method for promoting curd, which comprises inoculating a fermentation agent into a milk product raw material for fermentation, wherein the fermentation agent comprises G. fimbriatum with the preservation number of CGMCC No.41727.

[0026] The fifth aspect of the present application provides a method for fermenting a milk product, which comprises inoculating a fermentation agent into a milk product raw material for fermentation, wherein the fermentation agent comprises G. fimbriatum with the preservation number of CGMCC No.41727.

[0027] Preferably, the milk product raw material comprises at least one of liquid milk, solid milk and powdered milk.

[0028] Preferably, the fermentation condition comprises a temperature of 10-45℃.

[0029] Preferably, the fermentation condition further comprises a pH of 5-9.

[0030] Preferably, the fermentation condition further comprises a time of 1h-10d.

[0031] Moreover, the inventors of the present application also found that the G. fimbriatum with the preservation number of CGMCC No.41727 provided by the present application not only can be used alone for milk product fermentation, but also has good compatibility with commercial agents with fermentation effect, and can be compounded with commercial strains (such as lactic acid bacteria) for fermentation, thereby further improving the fermentation effect of the milk product.

[0032] Based on the above-mentioned finding, the fermentation agent can further comprise at least one of Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus salivarius subsp. thermophilus, Lactococcus lactis subsp. diacetylactis, Lactococcus lactis subsp. cremoris and Lactococcus lactis subsp. lactis.

[0033] The sixth aspect of the present application provides the use of the G. fimbriatum of the first aspect in promoting curd.

[0034] The seventh aspect of the present application provides the application of the Aspergillus corallinus in the first aspect in improving the flavor of fermented dairy products.

[0035] Preferably, the flavor is cinnamon flavor.

[0036] The present application will be described in detail below by examples. In the following examples, the reagents and materials used are commercially available products purchased from regular chemical or biological reagent / material suppliers, and the reagents are all of analytical purity, unless otherwise specified.

[0037] CICC2650: Aspergillus corallinus (Aspergillus corallinus) Aspergillus cristatus , purchased from China Industrial Microbial Culture Collection Center; Malt spawn culture medium: malt extract powder 130 g / L, chloramphenicol 0.1 g / L, agar 15 g / L, pH value 5.6±0.2; Potato liquid culture medium (PDB culture medium): potato extract powder 6.0 g / L, glucose 20 g / L, natural pH; add agar to obtain potato agar culture medium (PDA culture medium); Casein culture medium: by weight, proteose peptone 0.25%, glucose 1%, yeast extract 0.1%, casein 1%, agar 2%, skimmed milk 5%, the rest is water, pH=7.0, sterilized at 95℃ for 15 min; The absorbance was detected by a visible spectrophotometer.

[0038] Example 1 The present inventors accidentally isolated a strain of Aspergillus from fermented food, as shown in Figure 1 and Figure 2 , it was observed that most of the colonies were round or oval, and individual colonies were irregular in shape; the thickness of the colony edge was slightly lower than that of the central area; when cultured for 2-3 days, the whole colony presented white or light yellow, among which the edge part presented white velvet radiation, and the central area presented yellow; when cultured for 4-5 days, the color of the colony edge changed to yellow or dark yellow, and the central area changed to dark yellow or black brown, at this time the color of the colony presented a concentric circle effect from the edge to the center, and the color gradually deepened; when cultured for 6-7 days, the whole colony changed to black brown or olive color, and the culture medium also changed to olive color or brown color. The structure of the colony was relatively dense, and the main feature was closed ascus; the colony texture was felted, the surface had radial grooves, and the reverse was black brown. The strain was named CCNH008.

[0039] The ITS sequence of CCNH008 is shown as SEQ ID NO. 1, and compared with the data in NCBI, it has Aspergillus cristatus 99.43% homology.

[0040] SEQ ID NO.1: TAGGGGGTGCGGGGTCTCTGGGTCACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAA ACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCC TGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGC GTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAA Example 2 The pure strain CCNH008 was inoculated onto casein agar plates and incubated at 30°C for 3-5 days. The size of the white curd ring and hydrolysis ring were observed. A control group, CICC2650, was also included. Each group had five replicates. Figure 3 As shown, the average diameter of the curd ring for CCNH008 is 22.5 mm, and the average diameter of the hydrolysis ring is 3 mm, while the average diameter of the curd ring for CICC2650 is 12 mm, and the average diameter of the hydrolysis ring is 8.5 mm. A larger curd ring indicates stronger rennet activity in the strain. A larger hydrolysis ring means higher protein hydrolysis activity. Excessive protein hydrolysis activity can lead to over-hydrolysis of proteins in cheese, generating bitter peptides and affecting the palatability of the cheese.

[0041] Example 3 CCNH008 powder was inoculated into PDB medium (inoculation amount was 0.02 g powder / mL medium), and was cultured at 30℃ with 120 r / min shaking for 24 h as activated seed liquid, then was inoculated into sterilized medium with 3 vol% inoculation amount, and was cultured at 30℃ with 120 r / min shaking for 1, 3, 5 and 7 days to obtain enzyme liquid with different culture time.

[0042] Skim milk powder was dissolved in 0.01 mol / L CaCl2 solution to prepare 100 g / L skim milk solution, and was placed at room temperature for 30 min. 0.2 mL of enzyme liquid was added into 2 mL of skim milk solution under 35℃, and was mixed quickly. The time t (unit: s) required for flocculation and aggregation of particles was recorded, and the coagulation activity was calculated according to the formula. The amount of rennet required for coagulating 1 mL of 100 g / L skim milk within 40 min was defined as a Soxhlet unit (SU), and the coagulation activity was the number of Soxhlet units per mL of enzyme liquid (unit: SU / mL). In the formula, n was the dilution multiple of enzyme liquid (n=1 in the example). The coagulation activity of CICC2650 was measured by the same method. The coagulation activity was calculated according to the formula, and the results were shown in Table 1.

[0043] Coagulation activity (SU / mL) = (2400×5n) / 0.5t.

[0044] Table 1

[0045] Example 4 CCNH008 and CICC2650 were activated to the second generation in PDA medium, and were transferred to malt juice for spore culture for 10-15 d. The mycelium was washed with physiological saline and was filtered to prepare 10 8 CFU / mL spore suspension. The spore suspension was inoculated into PDB medium for 4 days, and the supernatant was collected to prepare crude enzyme liquid A (unit: mL). The dried weight of the precipitated mycelium was B (unit: g), and 1 g of mycelium corresponded to A / B mL of crude enzyme liquid.

[0046] Xylanase activity: 1 nmol of reducing sugar produced per minute per gram of bacteria under alkaline (pH=9.0), acidic (pH=4.8) or neutral (pH=6.0) conditions was the activity unit of alkaline, acidic or neutral xylanase. The standard curve of standard concentration-540 nm absorbance of reducing sugar (xylanase degradation product) was established, the xylanase activity of the tested strain was calculated by measuring the increasing rate of absorbance at 540 nm, and the unit was nmol / (min×g dry weight of mycelium). The results were shown in Table 2.

[0047] Table 2

[0048] Example 5 CCNH008 was inoculated on PDA plates, and when the plates were covered with yellow spores, the plates were washed with sterile saline to obtain a seed solution. The mycelium of CICC2650 was collected by centrifugation, and the wet weight of the mycelium was measured. The mycelium was mixed with skim milk solution (12wt% skim milk powder) at a weight ratio of 1:1, and the mixture was frozen in a -80°C refrigerator and then freeze-dried in a freeze dryer. The freeze-dried powder of the mycelium was obtained by crushing. 8 The seed solution was inoculated into sterilized PDB medium at a volume fraction of 5%, and the mixture was cultured at 30°C and 250 rpm for 120 h. The mycelium was collected by centrifugation, and the wet weight of the mycelium was measured. The mycelium was mixed with skim milk solution (12wt% skim milk powder) at a weight ratio of 1:1, and the mixture was frozen in a -80°C refrigerator and then freeze-dried in a freeze dryer. The freeze-dried powder of the mycelium was obtained by crushing.

[0049] CCNH008 was activated to the second generation on PDA medium and then transferred to malt juice for spore production for 10-15 days. The mycelium was removed by washing the plates with saline and filtering, and the spores were retained to prepare a 10 8 CFU / mL spore suspension. The black tea base was sterilized at 121°C for 15 min, and the spore suspension was inoculated into the sterilized base. The mixture was fermented at 30°C for 12 days, and then the spores were sieved using an automatic sifter after drying to obtain spore powder. The concentration of the spore powder reached 10 10 CFU / g.

[0050] Example 6 The freeze-dried powder of the mycelium and the spore powder of CICC2650 were prepared according to the method of Example 5. The gastric acid resistance and bile salt resistance of the freeze-dried powder of the mycelium and the spore powder of CCNH008 and CICC2650 were evaluated according to T / CNHFA435-2024 "Detection method for gastric juice resistance of probiotic agents". In the gastric acid resistance experiment, the pH was 3, and the incubation time was 2 h. In the bile salt resistance experiment, the bile salt content was 0.2wt%, and the incubation time was 4 h. The OD 600 .

[0051] The survival rate = OD 600 after the experiment / OD 600 before the experiment × 100%.

[0052] The survival rates of the freeze-dried powder of the mycelium of CCNH008 and CICC2650 in the gastric acid resistance experiment were 95.58% and 90.33%, respectively, and the survival rates in the bile salt resistance experiment were 85.55% and 69.36%, respectively. The survival rates of the spore powder of CCNH008 and CICC2650 in the gastric acid resistance experiment were 100% and 93.1%, respectively, and the survival rates in the bile salt resistance experiment were 100% and 95.35%, respectively. It can be found that the gastric acid resistance and bile salt resistance of the freeze-dried powder of the mycelium and the spore powder of CCNH008 are better than those of CICC2650 (p<0.05).

[0053] Example 7 Based on the gastric acid resistance and bile salt resistance of the spore powder of Example 6, both of which are significantly better than the mycelium freeze-dried powder, the spore powder is further used for mouse gavage experiment to verify the intestinal colonization ability. The experimental groups are set in 3 groups, each group of 50 mice, strain C57BL / 6, 7-9 weeks old male mice.

[0054] 1) Normal group: once a day for 2 weeks, gavage with PBS buffer.

[0055] 2) Low dose group: once a day for 2 weeks, gavage with low dose CCNH008 spores dissolved in PBS buffer, final concentration of 10 7 CFU / kgBW (BW: mouse weight).

[0056] 3) High dose group: once a day for 2 weeks, gavage with high dose CCNH008 spores dissolved in PBS buffer, final concentration of 10 8 CFU / kgBW.

[0057] After 2 weeks of continuous gavage, feces are collected every 2-4 days, and the whole experiment lasts for 30 days (i.e. gavage for 1-14 days, no feces collection; no gavage for 15-30 days, feces collection).

[0058] During this period, the content of Aspergillus corallinus in the fecal samples is detected regularly by plate coating method to determine the colonization of CCNH008 in the mouse intestine; during this period, some mice are sacrificed, small intestine, ileum and colon tissues, and contents of different intestinal segments are taken to detect the content of CCNH008 (number of CCNH008 viable bacteria per g sample, Lg CFU / g sample) to evaluate the colonization effect of CCNH008 in the intestine, and the results of CCNH008 content are shown in Table 3. Among them, the intestinal samples of the normal group of mice do not contain CCNH008.

[0059] Table 3

[0060] The results are shown in Table 3. CCNH008 is continuously discharged in feces within 16 days after gavage operation (i.e. 15-30 days of the experiment), indicating that CCNH008 exists and colonizes in vivo within these 16 days, and CCNH008 is present in the mucosa and its contents, i.e. CCNH008 has the ability to colonize in the intestine.

[0061] Example 8 Fermenting agent: CICC2650 mycelium freeze-dried powder (A1), CICC2650 mycelium spore powder (A2), CCNH008 mycelium freeze-dried powder (A3) and CCNH008 spore powder (A4).

[0062] Fresh whipping cream was pasteurized (95°C, 30s) and inoculated with starter culture (the amount of starter culture was such that the number of viable bacteria in the whipping cream was 1.3 x 10 7 CFU / mL). The fermentation was carried out at 13°C until the pH of the fermentation system reached 4.5-5.0, and the fermentation time was 24h, to obtain the whipping cream (fermentation broth), and the number of viable bacteria and pH in the fermentation broth were determined.

[0063] Cold storage post-fermentation: the fermentation broth was placed in a refrigerator at 4°C for 24h.

[0064] Stirring to remove cheese: after the end of cold storage post-fermentation, the fermentation product was stirred at 10°C, 750rpm for 30min to make the fat particles in it gather into clusters, and then filtered, washed twice with cold water (4°C) to remove buttermilk; the washed product was extruded using a press to remove water and shape it to obtain fermented butter, and the water and fat contents were determined, and the fermented butter was stored in a refrigerator at 4°C.

[0065] As shown in Table 4, the number of viable bacteria of CCNH008 mycelium freeze-dried powder (A3) and spore powder (A4) after 24h of fermentation was more than twice that of CICC2650, and the water and fat contents were also significantly higher than those of CICC2650 (p<0.05).

[0066] Table 4

[0067] Twenty people with experience in sensory evaluation in the field were selected as evaluators, and the samples were randomly numbered. The sensory evaluation method of fermented butter applied to flaky biscuits and raw food bread slices was used to score the aroma and taste of butter, respectively. The average score after removing the highest and lowest scores was taken as the result. The scoring details are shown in Table 5, and the scoring results are shown in Table 6.

[0068] Table 5

[0069] Table 6

[0070] Compared with CICC2650, the fermented butter prepared from CCNH008 had a certain amount of cinnamon flavor, which was a special flavor that consumers could easily accept. In addition, CCNH008 also significantly improved the buttery aroma and balanced the sour and sweet flavors.

[0071] Further, the volatile flavor components of the fermented butter prepared by A1, A2, A3 and A4 were detected by using solid phase microextraction (SPME) for pretreatment and gas chromatography-mass spectrometry (GC-MS). The SPME conditions were as follows: about 5 g of the sample to be detected was accurately weighed and added into a 20 mL headspace bottle, an appropriate amount of internal standard solvent 4-octanol was added, a 50 / 30 μm DVB / CAR / PDMS extraction head was used, the extraction temperature was 65°C, and the extraction time was 60 min.

[0072] The GC conditions were as follows: an HP-INNOWax (60 m x 0.25 mm x 0.25 μm) chromatographic column; the carrier gas was He, the flow rate was 2 mL / min; the injection port temperature was 250°C, without split; the detector temperature was 280°C; the temperature rising program was as follows: starting at 40°C, maintaining for 2 min; increasing to 180°C at a rate of 3°C / min, maintaining for 3 min; increasing to 230°C at a rate of 5°C / min, maintaining for 5 min.

[0073] The MS conditions were as follows: an EI ionization source, an electron energy of 70 eV, an ion source temperature of 250°C, a mass scan range of 29-350 amu, and an interface temperature of 250°C.

[0074] The mass spectrum collected was searched by using NIST11.L spectrum library, artificial spectrum analysis was performed by combining the retention time, CAS number and English name, and the volatile flavor components of the fermented butter were determined. The characteristic aroma component evaluation was performed by using the odor activity value (OAV) to evaluate the contribution of each volatile component to the overall aroma of the sample, that is, the odor activity value (OAV) was the ratio of the concentration (C) of each aroma component to the sensory threshold (T): OVA = C / T, wherein the threshold value was mainly derived from the reported data. If OAV≥0.1, the overall flavor was modified; if OAV≥1, the overall flavor was greatly contributed; within a certain range, the greater the OAV value, the greater the contribution of the substance to the overall flavor. The threshold values of the aroma components and the corresponding aroma descriptions are shown in Table 7, and the aroma measurement results of different groups are shown in Table 8.

[0075] The results showed that the fermented butter product prepared by CCNH008 had a cinnamic acid flavor substance that CICC2650 did not have, and the contribution of the flavor substances involved in the sweet and grassy aroma was higher than that of CICC2650.

[0076] Table 7

[0077] Table 8

[0078] Example 9 (1) Standardize raw cow milk to make the weight ratio of fat to protein 1.6:1, to obtain raw milk; homogenize the raw milk at 20 MPa, pasteurize (heat at 62℃ for 35 min), and cool to 32℃, to obtain fermentation raw material; Fermentation starter: CICC2650 mycelium freeze-dried powder (B1), CICC2650 mycelium spore powder (B2), CCNH008 mycelium freeze-dried powder (B3), and CCNH008 spore powder (B4).

[0079] (2) Inoculate the fermentation starter into the fermentation raw material at 3 vol%, stir for 2 min, and ferment at 30℃ until complete curd, during which record the time required for the raw material to coagulate (ferment until complete curd); (3) Add rennet 0.04 g / kg of fermented milk, stir for 2 min, and stand for 0.5 h, to obtain curd block; (4) Heat the curd block to 40℃, immediately cut into 1 cm×1 cm×1 cm cubes with cheese knife, continuously stir for 5 min, drain whey, vacuum package after shaping, and store at 4℃.

[0080] Score each group of cheese according to the standards in Table 9, and the score results of the cheese prepared with different fermentation starters are shown in Table 10.

[0081] Table 9

[0082] Table 10

[0083] As shown in Table 10, all scores of CCNH008 are better than those of CICC2650.

[0084] The above describes the preferred embodiments of the present application in detail, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including combining each technical feature in any other suitable manner, and these simple modifications and combinations should also be considered as disclosed by the present application, and all fall within the protection scope of the present application.

Claims

1. A strain of Aspergillus corallinus (ATCC® 48234®), Aspergillus cristatus , characterized in that, The preservation number of the Aspergillus cristatus is CGMCC No. 41727.

2. A mycelial lyophilized powder, characterized in that, The mycelium freeze-dried powder contains the mycelium of the Aspergillus cristatus according to claim 1 and skimmed milk powder.

3. A spore powder, characterized in that, The spore powder contains the spores of the Aspergillus cristatus according to claim 1.

4. A method of promoting curd formation, characterized by, The method comprises inoculating a fermentation starter into a dairy raw material for fermentation, wherein the fermentation starter comprises the Aspergillus cristatus according to claim 1.

5. A method of fermenting a dairy product, characterized in that, The method comprises inoculating a fermentation starter into a dairy raw material for fermentation, wherein the fermentation starter comprises the Aspergillus cristatus according to claim 1.

6. The method of claim 4 or 5, wherein, The dairy raw material comprises at least one of liquid milk, solid milk and powdered milk.

7. The method of claim 4 or 5, wherein, The fermentation condition comprises a temperature of 10-45℃. And / or, the fermentation condition further comprises a pH of 5-9. And / or, the fermentation condition further comprises a time of 1h-10d.

8. The Aspergillus cristatus according to claim 1 is applied to promoting curdling.

9. The Aspergillus cristatus according to claim 1 is applied to improving the flavor of fermented dairy products.

10. Use according to claim 9, wherein, The flavor is cinnamon flavor.

Images