Recombinant baculovirus vector and insect cell

Abstract

The invention belongs to the field of gene engineering, and particularly discloses a recombinant baculovirus vector and an insect cell. The recombinant baculovirus vector comprises a nucleic acid molecule with an exogenous gene expression cassette, the exogenous gene expression cassette is located between a CNE sequence and an NAE sequence of the nucleic acid molecule, and the distance between the exogenous gene expression cassette and the CNE sequence and the distance between the exogenous gene expression cassette and the NAE sequence are both smaller than 5 kb; and the distance between the CNE sequence and the NAE sequence is greater than 1.5 kb. According to the application, the technical scheme that the exogenous gene expression cassette is arranged between the CNE sequence and the NAE sequence of the nucleic acid molecule is adopted, so that the production stability of the exogenous protein or the rAAV vector is better and the yield is higher in continuous passage.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and more particularly, relates to a recombinant baculovirus vector and an insect cell. BACKGROUND

[0002] Baculovirus is a kind of circular double-stranded DNA virus with capsid envelope. The baculovirus strain currently studied more is Autographa californica multiplenuclear polyhedrosis virus (MNPV), simply referred to as AcMNPV. Baculovirus expression system (BEVS) is a kind of eukaryotic expression system using insect baculovirus vector to infect host insect cells to produce foreign proteins.

[0003] During the viral replication process, baculovirus will naturally lose part of its genome to form mutant viruses, which retain the signals required for genome replication and packaging, becoming defective interfering particles. In the subsequent process of scale-up cell culture passage, the growth rate of these mutants may exceed that of baculovirus with full-length genome.

[0004] The inherent genetic instability of baculovirus greatly limits the large-scale production of foreign proteins in host insect cells. Baculovirus containing foreign genes is more likely to lose foreign genes during replication, and in the subsequent process of scale-up cell culture continuous passage, these baculovirus that have lost foreign genes gradually accumulate and dominate, resulting in a continuous decline in the yield of foreign gene products.

[0005] The baculovirus expression system (BEVS) can be used not only for the production of foreign proteins, but also for the production of viral vectors, such as recombinant adeno-associated virus (rAAV) vectors. A production system for preparing rAAV using baculovirus-infected insect cells has been developed, i.e., a Rep gene expression cassette, a Cap gene expression cassette, and a transgene cassette flanked by AAV inverted terminal repeat (ITR) sequences are separately integrated into three different baculovirus genomes by Tn7 transposition, and the three recombinant baculoviruses are used to co-infect host insect cells to prepare rAAV (Urabe et al., 2002, Hum. Gene Ther. 13:1935 1943; US20030148506; US20040197895). However, the continuous loss of the packaging essential elements (Rep gene expression cassette, Cap gene expression cassette, and transgene cassette) in the recombinant baculoviruses containing the packaging essential elements, respectively, during multiple passages results in a continuous decrease in the yield of rAAV. Patent document CN114736928A discloses a baculovirus vector and its application in preparing rAAV in insect cells. Although it has been verified that it can improve the stability during the passage process, the stability gradually decreases from the fourth generation, and still cannot meet the needs of long-term stable production.

[0006] Therefore, there is still a great need to improve the recombinant baculovirus vector for large-scale production of foreign proteins or gene therapy vector drugs. SUMMARY

[0007] In view of the above defects or improvement needs of the prior art, the present application provides a recombinant baculovirus vector and an insect cell.

[0008] To achieve the above-mentioned purpose, the present application provides a recombinant baculovirus vector comprising a nucleic acid molecule with an exogenous gene expression cassette, wherein the exogenous gene expression cassette is located between a CNE sequence and a NAE sequence of the nucleic acid molecule, and the distance to the CNE sequence and the distance to the NAE sequence are both less than 5 kb.

[0009] Preferably, the distance between the CNE sequence and the NAE sequence is greater than 1.5 kb.

[0010] Preferably, the exogenous gene expression cassette is a parvovirus Cap gene expression cassette, a parvovirus Rep gene expression cassette, a parvovirus Cap and Rep integrated gene expression cassette, or a transgene cassette.

[0011] As a further preferred, the transgene cassette comprises a transgene flanked by at least one parvovirus inverted terminal repeat sequence.

[0012] As a further preferred embodiment, the transgene comprises a nucleic acid sequence encoding a therapeutic gene product.

[0013] As a further preferred embodiment, the therapeutic gene product is a protein, a polypeptide, a small interfering RNA, a vector-based short hairpin RNA or a microRNA.

[0014] Preferably, the recombinant baculovirus vector is used for preparing a recombinant adeno-associated virus.

[0015] As a further preferred embodiment, the recombinant baculovirus vector is an insect cell-compatible vector.

[0016] According to another aspect of the present application, there is also provided an insect cell comprising the above-mentioned recombinant baculovirus vector.

[0017] Compared with the prior art, the present application ensures that the level of recombinant baculovirus producing exogenous proteins can remain relatively stable in continuous passage, by adopting the technical solution of arranging the exogenous gene expression cassette between the CNE sequence and the NAE sequence of the nucleic acid molecule; compared with the vector containing only one of the CNE or NAE sequence on both sides of the exogenous gene, the recombinant baculovirus vector provided by the present application has better production stability and higher yield of exogenous proteins or rAAV vectors in the continuous passage production process in the host insect cells.

[0018] It has been verified that when the recombinant baculovirus containing the GFP, Cap and Rep exogenous gene expression cassettes is continuously passed to the 10th generation, the exogenous proteins GFP, Cap and Rep still maintain a relatively high expression level; when the recombinant baculovirus for producing rAAV is continuously passed to the 9th generation, the packaging titer of rAAV can still maintain more than 40% of the initial value. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 FIG. 1 is a schematic diagram of the first homologous recombination expression frame structure in Example 1 of the present application;

[0020] Figure 2 FIG. 2 is a schematic diagram of the second homologous recombination expression frame structure in Example 1 of the present application;

[0021] Figure 3 FIG. 3 is a schematic diagram of the recombinant DNA fragment structure in each embodiment of the present application;

[0022] Figure 4 FIG. 4 is a schematic diagram of the recombinant DNA fragment structure in each comparative example of the present application;

[0023] Figure 5a FIG. 5 is a comparison of the experimental results of producing GFP in Comparative Examples 3 and 4 and Example 2;

[0024] Figure 5b Comparison of experimental results for producing Rep protein for Comparative Examples 5, 6 and Examples 4, 5;

[0025] Figure 5c Comparison of experimental results for producing Cap protein for Comparative Examples 5, 6 and Examples 3, 5;

[0026] Figure 6 Detection results of packaging titers of different passages of rAAV for each group of Verification Example 3 of the present application. DETAILED DESCRIPTION

[0027] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and should not be used to limit the present application. In addition, the technical features involved in each embodiment of the present application described below can be combined with each other as long as they do not conflict with each other.

[0028] In the present application, "interval" or "distance" means the shortest interval / distance of two sequences, for example, on a nucleic acid molecule, if sequence A is located in the 5' direction of sequence B, the interval / distance between sequence A and sequence B means the interval / distance from the 3' end of sequence A to the 5' end of sequence B; if sequence A is located in the 3' direction of sequence B, the interval / distance between sequence A and sequence B means the interval / distance from the 5' end of sequence A to the 3' end of sequence B.

[0029] In the present application, the symbol " / " means that the associated object is or, for example, A / B means A or B. In the present application, the term "and / or" is a description of the association relationship between the associated objects, which means that there can be three kinds of relationships, for example, A and / or B can mean that A exists alone, A and B exist together, and B exists alone.

[0030] In the description of the present application, it should be understood that the terms "first", "second" are only used for description purpose, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined with "first", "second" can explicitly or implicitly include one or more of the features. In the description of the present application, the meaning of "multiple" is two or more, unless otherwise specifically limited.

[0031] In addition, reference throughout this specification to "one embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. Thus, the appearance of the phrases "in one embodiment" or "in some embodiments" or "in other embodiments" or "in one example" or similar phrases throughout this specification are not necessarily all referring to the same embodiment.

[0032] For the purposes of the present disclosure, the following terms are defined below:

[0033] The term "operably linked": means that a polynucleotide (or polypeptide) sequence is placed into a functional relationship with another polynucleotide sequence. For example, a transcriptional regulatory sequence (e.g., a promoter) is operably linked to a gene coding sequence if it affects the transcription of the gene coding sequence.

[0034] The term "vector": means a nucleic acid molecule designed for the transport, transfer, and / or storage of genetic material, as well as the expression of genetic material and / or the integration of genetic material into the host cell chromosomal DNA, such as plasmid vectors, cosmid vectors, artificial chromosomes, phage vectors, and other viral vectors. A vector is typically composed of at least three basic elements, a replication origin, a selectable marker, and a multiple cloning site.

[0035] The term "expression cassette": means a nucleic acid construct comprising coding and regulatory sequences operably linked when introduced into a host cell, resulting in the transcription and / or translation of an RNA or polypeptide, respectively. An expression cassette is understood to include a promoter to allow the initiation of transcription, an open reading frame of interest, and a transcription terminator. Typically, a promoter sequence is placed upstream of the gene of interest, compatible with the expression control.

[0036] The term "cis-acting element": means specific DNA sequences in tandem with a structural gene, which are binding sites for transcription factors, and they regulate the precise initiation of gene transcription and transcription efficiency by binding to transcription factors. Cis-acting elements include promoters, enhancers, regulatory sequences, and inducible elements, etc., which are involved in the regulation of gene expression, do not encode any protein themselves, and only provide an action site.

[0037] The term "AAV virus": a single-stranded DNA virus, with a simple genomic structure, about 4.7 kb in length, containing a Rep gene expression cassette, a Cap gene expression cassette, and AAV inverted terminal repeats (ITRs) at both ends of the genome. These are the three elements necessary for packaging AAV virus.

[0038] The term "Cap gene": used to encode the structural VP capsid protein, which contains three overlapping open reading frames, encoding VP1, VP2, VP3 three types of subunits, VP1, VP2 and VP3 contain different start codons, share a stop codon, VP1 and VP2 share VP3 sequence. The N-terminal of VP1 has a conserved phospholipase A2 sequence, which is related to the escape of the virus from the body and is essential for its infectivity; VP2 protein is not essential for assembly or infection; The core of the VP3 protein consists of a conserved beta barrel motif, which determines the differences in the interaction of different serotypes of AAV with host cell receptors. The correct ratio of the three proteins in wild-type AAV is 6:6:54, about 1:1:10.

[0039] The term "Rep gene": used to encode four overlapping multifunctional proteins, Rep78 and Rep68 proteins involved in replication and integration of AAV, can bind to specific sequences in ITR; Rep52 and Rep40 proteins have helicase and ATPase activity, involved in the replication of single-stranded genomes and also involved in the assembly of viruses. Whether in mammalian cells or in insect cells, unspliced mRNA encoding Rep78 and Rep52 proteins is sufficient to meet the needs of rAAV production.

[0040] The term "ITR": a 125-nucleotide palindromic structure at both ends of the genome, which can form a self-complementary inverted T-shaped hairpin structure, is a cis-acting element required for DNA replication initiation and packaging of recombinant AAV genome into infectious viral particles. AAV as a defective virus cannot replicate independently in the absence of helper virus, so AAV can only integrate into the host cell chromosome at a specific site and remain in a latent state. In the presence of helper virus, increased expression of the rep gene can rescue the AAV genome integrated into the host cell chromosome, and a large amount of AAV DNA can be replicated, and the single-stranded rAAV genome is packaged into infectious virus particles under the action of VP capsid protein.

[0041] The term "CNE sequence": a conserved non-protein-coding element (CN E) was found to exist in all sequenced genomes of Alphabaculovirus, with a highly homologous sequence of 154-157 bp (Kikhno I. Identification of a Conserved Non-Protein-Coding Genomic Element that Plays an Essential Role in Alphabaculovirus Pathogenesis [J]. Plos One, 2014, 9. DOI: 10.1371 / journal.pone.0095322). It has been reported that the at-rich CNE sequence located in the ac152 region of the Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome is a cis-acting element essential for virion production.

[0042] The term "NAE sequence": a nucleocapsid assembly essential element was first found to exist in Alphabaculovirus, which plays an essential role in the nucleocapsid assembly process (Huang Z, Pan M, Zhu S, et al. The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly [J]. Journal of Virology, 2017, 91 (5): e02110-16-16. DOI: 10.1128 / JVI.02110-16). The natural NAE sequence is located in the ac83 gene and its homologous genes in Alphabaculovirus (CN106566829A). ac83 is a core gene related to baculovirus nucleocapsid assembly, with a full length of 2544 bp, encoding 847 amino acids, and a predicted molecular weight of 96.2 kDa. Knocking out ac83 does not affect the replication of the viral genome, but completely blocks the assembly of the viral nucleocapsid, and a large number of hollow capsid precursors can be observed in the nucleus under electron microscope.

[0043] The term "expression control sequence" refers to a nucleotide sequence that controls and regulates transcription and / or translation of nucleotide sequences to which it is operably linked. Thus, expression control sequences can include enhancers, promoters, transcription terminators, internal ribosome entry sites (IRES), protein translation initiation codons, protein translation termination codons, and introns containing splicing signals.

[0044] The present application provides a recombinant baculovirus vector, comprising a nucleic acid molecule with an exogenous gene expression cassette, the exogenous gene expression cassette is located between the CNE sequence and the NAE sequence of the nucleic acid molecule, and the distance from the CNE sequence and the distance from the NAE sequence are both less than 5 kb; in some embodiments, the distance between the CNE sequence and the NAE sequence is greater than 1.5 kb; more preferably, greater than or equal to 2 kb.

[0045] The exogenous gene expression cassette is used to express proteins, polypeptides, small interfering RNAs, vector-based short hairpin RNAs, or microRNAs; these products can be both elements required for the production of rAAV and coding sequences for the expression of exogenous proteins, including but not limited to reporter proteins or therapeutic gene products. For example, in the production system of insect-compatible vector-infected insect cells for the production of recombinant adeno-associated virus (rAAV), three elements are required, namely the Rep gene expression cassette, the Cap gene expression cassette, and the transgene cassette flanked by ITR sequences, one or more of which can use the above-mentioned recombinant baculovirus vector; that is, when the recombinant baculovirus vector infects insect cells for the production of rAAV, the exogenous gene expression cassette can be a parvovirus Cap gene expression cassette, a parvovirus Rep gene expression cassette, a parvovirus Cap and Rep integrated gene expression cassette, or a transgene cassette comprising at least one parvovirus inverted terminal repeat sequence (ITR) on both sides; wherein the transgene cassette comprising at least one parvovirus inverted terminal repeat sequence (ITR) includes a transgene and AAV inverted terminal repeat sequences (ITRs) located at both ends thereof, and the transgene can be a nucleotide sequence encoding a target gene product, which can be a therapeutic gene product such as a protein, a polypeptide, a small interfering RNA, a vector-based short hairpin RNA, or a microRNA, or other gene products when used for therapeutic purposes; for example but not limited to lipoprotein esterase, apolipoprotein, cytokine, interleukin, or interferon; or a reporter protein for evaluating vector transformation and expression, such as but not limited to fluorescent protein (green fluorescent protein GFP, red fluorescent protein RFP), chloramphenicol acetyltransferase, beta-galactosidase, beta-glucuronidase, renilla luciferase, firefly luciferase, or alkaline phosphatase, etc. When the recombinant baculovirus vector infects insect cells, the insect cells can be used for the production of recombinant adeno-associated virus.

[0046] Specifically, on the nucleic acid molecule, the CNE sequence, the foreign gene expression cassette and the NAE sequence can be arranged in order from 5' to 3' end, or the NAE sequence, the foreign gene expression cassette and the CNE sequence can be arranged in order from 5' to 3' end; when the parvovirus Cap gene and the Rep gene are expressed by using the recombinant baculovirus vector, the foreign gene expression cassette between the CNE sequence and the NAE sequence can be the parvovirus Cap gene expression cassette and the parvovirus Rep gene expression cassette, or the parvovirus Cap and Rep integrated gene expression cassette; only one of the Cap gene and the Rep gene can be located between the CNE sequence and the NAE sequence, for example, the parvovirus Cap gene expression cassette, the CNE sequence, the parvovirus Rep gene expression cassette and the NAE sequence can be arranged in order from 5' to 3' end; or both the Cap gene and the Rep gene can be located between the CNE sequence and the NAE sequence, for example, the NAE sequence, the parvovirus Cap and Rep integrated gene expression cassette and the CNE sequence can be arranged in order from 5' to 3' end; since the distance between the CNE sequence and the NAE sequence is preferably more than 1.5 kb, when the length of the foreign gene is less than 1.5 kb or more, some non-coding DNA sequences can be inserted between the CNE sequence and the NAE sequence in addition to the foreign gene.

[0047] In addition, the distance between the foreign gene expression cassette and the CNE sequence and the NAE sequence can be about 0.5 kb, about 1 kb, about 1.5 kb, about 2 kb, about 2.5 kb, about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb or about 5 kb.

[0048] In some embodiments, the CNE sequence can be a CNE sequence identical to the wild-type AcMNPV CNE sequence, or a CNE sequence from other baculoviruses, or an artificial CNE sequence sharing at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity or higher sequence identity with the wild-type AcMNPV CNE sequence; likewise, the NAE sequence can be a NAE sequence identical to the wild-type AcMNPV NAE sequence, or a NAE sequence from other baculoviruses, or an artificial NAE sequence sharing at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity or higher sequence identity with the wild-type AcMNPV NAE sequence.

[0049] In some embodiments, for expression of the capsid protein (Cap) in the Cap gene expression cassette, a single overlapping open reading frame comprising the VP1-encoding nucleotide sequence can be used, or multiple open reading frames comprising VP1-, VP2- and VP3-encoding nucleotide sequences separately can be used; preferably, the Cap gene expression cassette of the present application comprises a VP1-encoding nucleotide sequence comprising open reading frames encoding VP2 and VP3.

[0050] In some embodiments, for expression of the Rep proteins in the Rep gene expression cassette, a single overlapping open reading frame comprising the Rep78 / 68-encoding nucleotide sequence can be used, or multiple open reading frames comprising Rep78 / 68- and Rep52 / 40-encoding nucleotide sequences separately can be used; preferably, the Rep gene expression cassette of the present application comprises a Rep78 / 68-encoding nucleotide sequence comprising open reading frames encoding Rep52 / 40 separately.

[0051] In some embodiments, at least one of the Rep78 and Rep68 proteins, at least one of the Rep52 and Rep40 proteins, the capsid proteins VP1, VP2 and VP3 and at least one of the inverted terminal repeat sequences of the parvovirus are derived from an adeno-associated virus (AAV). The AAV nucleotide sequences can be derived from any of the known AAV serotypes. Preferably, the amino acid-encoding sequences of the Rep78 / 68 and Rep52 / 40 proteins are derived from AAV1, AAV2, AAV4, AAV7 and / or AAV8. In the present application, the nucleotide sequences encoding the capsid proteins VP1, VP2 and VP3 can be derived from any of the more than 100 known serotypes, more preferably from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12 or newly developed AAV-like particles obtained by capsid recombination technology and AAV capsid library screening, and rationally designed, artificially synthesized or evolved capsids, such as the Anc80 series of serotypes. Similarly, the inverted terminal repeat sequences (ITRs) of the parvovirus of the transgene cassette of the present application are selected from AAV1, AAV2, AAV4, AAV7 and / or AAV8.

[0052] In some embodiments, the Cap gene expression cassette and the Rep gene expression cassette, wherein:

[0053] the Cap gene expression cassette comprises, from 5' to 3', operably linked:

[0054] a promoter;

[0055] an expression control sequence;

[0056] a nucleotide sequence encoding a parvovirus VP1 capsid protein;

[0057] the Rep gene expression cassette comprises, from 5' to 3', operably linked:

[0058] a promoter,

[0059] an expression regulatory sequence;

[0060] a nucleotide sequence encoding a parvovirus Rep78 / 68 protein.

[0061] In some embodiments, the promoter driving the transcription of the Cap gene and the Rep gene can be selected from deltaIE1, IE1, 39K, VP39, ODV-E25, ODV-EC27, ODV-E18, p6.9, polH or p10. The baculovirus vector provided in the present application can be a baculovirus or a baculovirus shuttle vector (also known as baculovirus plasmid, abbreviated as bacmid). The baculovirus transfer vector involved in the present application generally contains a strong promoter and Tn7 transposon terminal elements Tn7L and Tn7R, for example but not limited to pFastBac vector.

[0062] Red recombination and Tn7 transposition are common methods for inserting foreign genes into the baculovirus vector genome. The 5' end or 3' end of the non-essential locus or essential locus in the baculovirus vector genome is within the range of not more than 3 kb, which is a common insertion site for foreign genes; in some embodiments, the above-mentioned foreign gene expression cassette is inserted into the baculovirus vector within the range of not more than 3 kb from the 5' end or 3' end of the essential locus by the method of Red recombination or Tn7 transposition; preferably the essential gene is selected from Ac6, Ac9, Ac10, Ac17, Ac66, Ac109, Ac139, Ac135, Ac98, Ac147 and Ac128.

[0063] In some embodiments, the above-mentioned foreign gene expression cassette is inserted into the non-essential locus of the baculovirus vector genome by the method of Red recombination or Tn7 transposition; preferably it is inserted into the Ac4, Ac5, Ac8, Ac15, Ac16, Ac30, Ac63, Ac64, Ac96, Ac97, Ac108, Ac124, Ac126, Ac136, Ac137 or Ac138 non-essential locus, more preferably it is inserted into the Ac8, Ac63 or Ac97 non-essential locus.

[0064] The method for preparing the above-mentioned recombinant baculovirus vector comprises:

[0065] Using the original baculovirus vector, using Red recombination technology, a bacmid is constructed which simultaneously lacks the CNE sequence and the NAE sequence; a recombinant DNA fragment is constructed which includes the CNE sequence, an exogenous gene expression cassette, and the NAE sequence; the recombinant DNA fragment is inserted into the above-mentioned exogenous gene insertion site in the baculovirus vector using Tn7 transposition or Red recombination technology, i.e. a recombinant baculovirus vector containing the CNE sequence, the exogenous gene expression cassette, and the NAE sequence is obtained.

[0066] The recombinant baculovirus vector containing the above-mentioned CNE sequence, exogenous gene expression cassette, and NAE sequence is transfected into insect cells to obtain a recombinant baculovirus, the insect cells are infected with the recombinant baculovirus, and the insect cells are cultured, which can be used to produce an exogenous protein or a recombinant adeno-associated virus vector.

[0067] The application also provides an insect cell containing the above-mentioned baculovirus vector, such as but not limited to Sf9 cells from Spodoptera frugiperda, Tni Pro cells from Trichoplusia ni, or E4a cells from Estima acrea, preferably Sf9 cells, which contain the vector.

[0068] The above technical solutions are described in detail below in combination with specific examples.

[0069] Example 1

[0070] 1. Construction of baculovirus vector lacking stable sequences

[0071] In this example, a baculovirus vector lacking both CNE and NAE stable sequences is constructed, which is named △CNE-△NAE-Bac.

[0072] Red recombination is a highly efficient recombination method at the bacterial level, which can quickly modify the baculovirus genome in E. coli (DH10Bac). Red recombination uses λ phage Red recombination enzymes (composed of Exo, Beta, and Gam proteins) to perform homologous recombination between a linear DNA fragment carrying a homologous arm and a specific target sequence in the genome, thereby achieving gene replacement (Doublet et al., 2008, J Microbiol Methods, 75(2): 359-361).

[0073] 1.1 Construction of △CNE-Bac

[0074] First, a first homologous recombination expression frame targeting the CNE sequence is constructed, with the nucleic acid sequence being SEQ ID No. 1, as shown in Figure 1As shown, the expression frame includes, from 5' to 3', up-CNE, Chol expression cassette and down-CNE; then the expression frame is replaced with the CNE sequence (SEQ ID No. 2) on the original baculovirus vector (wt-bac) by Red recombination technology, thereby obtaining bacmid ACNE-Bac which lacks only one stable sequence of CNE.

[0075] 1.2 Construction of ACNE- ANE-Bac

[0076] A second homologous recombination expression frame targeting NAE sequence is constructed again, and the nucleic acid sequence is SEQ ID No. 3, as shown in Figure 2 As shown, the expression frame includes, from 5' to 3', up-CNE, Chol expression cassette and down-CNE; then the expression frame is replaced with the CNE sequence (SEQ ID No. 2) on the original baculovirus vector (wt-bac) by Red recombination technology, thereby obtaining bacmid ACNE-Bac which lacks only one stable sequence of CNE.

[0077] 2 Construction of recombinant DNA fragment containing stable sequence and exogenous gene

[0078] A recombinant DNA fragment CNE-GFP expression cassette-NAE (SEQ ID No. 5) is constructed by artificial synthesis; the structure of the obtained recombinant DNA fragment is shown in Figure 2 As shown, the expression frame includes, from 5' to 3', up-CNE, Chol expression cassette and down-CNE; then the expression frame is replaced with the CNE sequence (SEQ ID No. 2) on the original baculovirus vector (wt-bac) by Red recombination technology, thereby obtaining bacmid ACNE-Bac which lacks only one stable sequence of CNE.

[0079] 3 Construction of recombinant baculovirus vector containing the above recombinant DNA fragment

[0080] Red recombination and Tn7 transposition technology are common methods for inserting exogenous genes into baculovirus vector genome. The 5' end or 3' end of non-essential gene locus or essential gene locus in baculovirus vector genome is not more than 3kb, which is a common insertion site for exogenous genes.

[0081] In this embodiment, the recombinant DNA fragment constructed in step 2 is inserted into the Ac97 locus of bacmid ACNE- ANE-Bac by Red recombination method, thereby obtaining recombinant baculovirus vector ACNE- ANE-Bac-GFP.

[0082] Embodiments 2-6

[0083] Example 1 is repeated with the same steps, except that in step 2, the GFP expression cassette in Example 1 is replaced by the GFP expression cassette + non-coding DNA sequence, Cap gene expression cassette (SEQ ID No. 7), Rep gene expression cassette (SEQ ID No. 8), Cap gene expression cassette + Rep gene expression cassette, ITR-GOI transgene cassette (SEQ ID No. 9) in Example 2-Example 6 respectively, and the structure of the recombinant DNA fragment obtained is as shown in Figure 3 , which are CNE-GFP expression cassette + non-coding DNA sequence-NAE (SEQ ID No. 10), CNE-Cap expression cassette-NAE (SEQ ID No. 11), CNE-Rep expression cassette-NAE (SEQ ID No. 12), CNE-Cap expression cassette + Rep expression cassette-NAE (SEQ ID No. 13), CNE-ITR-GOI transgene cassette-NAE (SEQ ID No. 14) respectively; and the structure of the recombinant baculovirus vector obtained in step 3 is △CNE-△NAE-Bac-GFP-non-coding DNA, △CNE-△NAE-Bac-Cap, △CNE-△NAE-Bac-Rep, △CNE-△NAE-Bac-Cap-Rep, △CNE-△NAE-Bac-ITR-GOI respectively.

[0084] The Cap gene expression cassette is constructed according to the method provided in Example 3 of Chinese patent CN202111105263.5; the Rep gene expression cassette is constructed according to the method provided in Example 1 of Chinese patent CN202310975187.6; and the ITR-GOI transgene cassette has, from 5' to 3' end, AAV serum 2 type 5' end ITR sequence, cytomegalovirus (Cmv) promoter, GFP transgene, transcription termination sequence (pA) and AAV serum 2 type 3' end ITR sequence.

[0085] Comparative Example 1

[0086] 1. Construction of baculovirus vector lacking a stable sequence

[0087] This step is the same as step 1.1 of Example 1, and a bacmid △CNE-Bac lacking only one stable sequence of CNE is obtained.

[0088] 2. Construction of recombinant DNA fragment containing stable sequence and exogenous gene

[0089] The recombinant DNA fragment is constructed by artificial synthesis, and the structure of the recombinant DNA fragment obtained is as shown in Figure 4As shown, the recombinant DNA fragment comprises, in order from 5' to 3', a CNE sequence and an ITR-GOI transgene cassette.

[0090] 3 Constructing a recombinant baculovirus vector containing the recombinant DNA fragment described above

[0091] The recombinant DNA fragment constructed in step 2 is inserted into the Ac97 locus of the bacmid ACNE-Bac by the method of Red recombination to obtain a recombinant baculovirus vector ACNE-Bac-ITR-GOI.

[0092] Comparative Example 2

[0093] 1 Constructing a baculovirus vector lacking a stabilization sequence

[0094] A second homologous recombination expression frame targeting the NAE sequence is constructed, comprising, in order from 5' to 3', an upstream homologous sequence of NAE (up-NAE), a gentamicin resistance gene expression frame (GmR, GM), and a downstream homologous sequence of NAE (down-NAE); then the expression frame is replaced with the NAE sequence on the original baculovirus vector by the Red recombination technology, thereby obtaining a bacmid ANAE-Bac lacking the NAE sequence.

[0095] 2 Constructing a recombinant DNA fragment containing both a stabilization sequence and an exogenous gene

[0096] A recombinant DNA fragment is constructed by artificial synthesis; the structure of the obtained recombinant DNA fragment is as shown in Figure 4 As shown, the recombinant DNA fragment comprises, in order from 5' to 3', a NAE sequence and an ITR-GOI transgene cassette. 3 Constructing a recombinant baculovirus vector containing the recombinant DNA fragment described above

[0097] The recombinant DNA fragment constructed in step 2 is inserted into the Ac97 locus of the bacmid ANAE-Bac by the method of Red recombination to obtain a recombinant baculovirus vector ANAE-Bac-ITR-GOI.

[0098] Comparative Example 3

[0099] Comparative Example 1 is repeated by the same steps, except that in step 2, the ITR-GOI transgene cassette is replaced with a GFP expression cassette, and in step 3, a recombinant baculovirus vector ACNE-Bac-GFP is obtained.

[0100] Comparative Example 4

[0101] Comparative Example 2 is repeated by the same steps, except that in step 2, the ITR-GOI transgene cassette is replaced with a GFP expression cassette, and in step 3, a recombinant baculovirus vector ANAE-Bac-GFP is obtained.

[0102] Comparative Example 5

[0103] Example 1 was repeated in the same way, except that in step 2, the recombinant DNA fragment constructed included, in order from 5' to 3', the Cap gene expression cassette, the CNE sequence, and the Rep gene expression cassette, and in step 3, the recombinant baculovirus vector ΔCNE-Bac-Cap-Rep was obtained.

[0104] Comparative Example 6

[0105] Example 2 was repeated in the same way, except that in step 2, the recombinant DNA fragment constructed included, in order from 5' to 3', the Cap gene expression cassette, the NAE sequence, and the Rep gene expression cassette, and in step 3, the recombinant baculovirus vector ΔNAE-Bac-Cap-Rep was obtained.

[0106] Verification Example 1: Baculovirus (BEV) titer detection

[0107] Sf9 insect cells were transfected with the recombinant baculovirus vectors of the examples and comparative examples and the original baculovirus vector (wt-bac) to prepare baculovirus (BEV). When the Sf9 insect cells after infection successfully produced BEV, a large number of replicated and proliferated BEV would further infect and cause obvious cytopathic effect (CPE) in the Sf9 cells. The culture supernatant of the Sf9 cells with CPE was collected, which contained a large number of BEV, i.e., the 0th passage BEV (P0). The prepared BEV-P0 was used to infect the suspension-cultured Sf9 cells at a multiplicity of infection (MOI = 1), and after 72 h of infection, the cell activity decreased to below 50%. The cell culture liquid was centrifuged at 1000g for 5 min, and the culture supernatant and cell precipitate were collected, respectively. The supernatant was labeled as the 1st passage BEV-P1. The P1 generation baculovirus was used to infect the Sf9 cells by continuous passage at the same MOI to obtain the P2, P3, P4, …, P10 generations of BEV. The titers of all generations of BEV were determined by the method of fluorescent quantitative PCR (qPCR), and the titer unit was expressed as VG / mL (VG, virus genomes). A pair of qPCR primers corresponding to the gp64 gene (present in all recombinant baculoviruses of the application) (Q-GP64-F: AACTTGGACATTACCCCGCC and Q-GP64-R: CCGTTGTACGCATACGCCTG) was used to determine the titer of the baculovirus.

[0108] The titer detection results of the first generation baculovirus (BEV-P1) and the second generation baculovirus (BEV-P2) are shown in Table 1:

[0109] Table 1: Titer of the first generation baculovirus and the second generation baculovirus

[0110]

[0111]

[0112] It can be seen that the titers of BEV-P1 and BEV-P2 of Example 1 are significantly lower than those of other baculovirus vectors, indicating that the replication or packaging of baculovirus is significantly inhibited after the recombinant baculovirus vector described in Example 1 is transfected into sf9 cells. The vector of Example 1 contains a GFP expression cassette flanked by CNE sequences and NAE sequences, wherein the 3' end of the CNE sequence is 1500 bp away from the 5' end of the NAE sequence. It is speculated that when the distance between the CNE sequence and the NAE sequence in the ΔCNE-ΔNAE-Bac-GFP vector is not greater than 1500 bp, the replication or packaging of baculovirus will be significantly affected. Therefore, the applicant constructed the vector in Example 2, in which a nucleotide sequence not encoding any gene product was inserted between the GFP expression cassette and the NAE sequence, only for increasing the distance between the CNE sequence and the NAE sequence. In this vector, the 3' end of the CNE sequence is about 2000 bp away from the 5' end of the NAE sequence. As can be seen from Table 1, when the distance between the CNE sequence and the NAE sequence in the vector of Example 2 is lengthened, the baculovirus can be normally replicated and packaged after the vector is used to transfect sf9 cells.

[0113] Verification Example 2 detects the protein expression level of recombinant baculovirus vector containing an exogenous gene expression cassette at different passages

[0114] Sf9 insect cells were transfected with the recombinant baculovirus vectors of each example and comparative example and were continuously passaged. P4, P6, P8, and P10 generations of BEV cell cultures were harvested, and Western Blot was used to test the protein expression in BEV cell cultures at different passages. The experimental results are shown in Figure 5, wherein Figure 5a is the expression of GFP protein, Figure 5b is the expression of Rep protein, Figure 5c is the expression of Cap protein.

[0115] As can be seen from the figures, the GFP expression level of Example 2 does not decrease significantly during the continuous passage process, indicating that the GFP expression cassette has high passage stability, while in Comparative Examples 3 and 4, the GFP expression level decreases significantly at P10 generation; the VP1 / VP2 / VP3 expression level of Example 3 does not decrease significantly during the continuous passage process, indicating that the Cap gene expression cassette has high passage stability, while in Comparative Examples 5 and 6, the VP1 / VP2 / VP3 expression level decreases significantly at P10 generation; the Rep expression level of Example 4 does not decrease significantly during the continuous passage process, indicating that the Rep gene expression cassette has high passage stability, while in Comparative Examples 5 and 6, the Rep expression level decreases significantly at P8 and P10 generations; the Cap and Rep expression levels of Example 5 do not decrease significantly during the continuous passage process, indicating that the Cap and Rep gene expression cassettes have high passage stability; the recombinant baculovirus vectors constructed in the above Examples 2-4 contain the foreign gene expression cassette between the CNE and NAE elements, thereby ensuring that the production of the foreign protein remains stable during the continuous passage production process.

[0116] Verification Example 3 Production of recombinant adeno-associated virus (rAAV) vectors

[0117] This verification example uses a double bacmid system to produce rAAV vectors, i.e., one recombinant baculovirus vector contains a Cap and Rep gene expression cassette, and another recombinant baculovirus vector contains a transgene cassette flanked by AAV inverted terminal repeat sequences (ITR-GOI). In this verification example, five groups of double bacmids are used to produce rAAV, and each group of double bacmids contains first and second recombinant baculovirus vectors with the characteristics shown in Table 2.

[0118] Table 2 Combination of recombinant baculovirus vectors for producing rAAV vectors

[0119]

[0120]

[0121] The specific operation is as follows: the first and second recombinant baculovirus vectors in each group are respectively transfected into sf9 cells and continuously passaged, and P2, P3, P4,..., P9 generations of BEV are respectively harvested. In group 1, P2, P3, P4, P5, P6, P7, P8 and P9 generations of BEV prepared by Comparative Example 1 and Comparative Example 4 are respectively used to co-infect suspended Sf9 cells at a multiplicity of infection (MOI = 1) for rAAV packaging, and the packaging volume is 300 mL to 400 mL. After 3 days of infection, the cell activity is monitored, and when the activity is less than 50%, the cell culture containing a large amount of rAAV is collected. Similarly, in groups 2-5, P2, P3, P4, P5, P6, P7, P8 and P9 generations of BEV prepared by the respective first and second recombinant baculovirus vectors are respectively used to co-infect suspended Sf9 cells at a multiplicity of infection (MOI = 1) for rAAV packaging.

[0122] The verification example uses Q-PCR to detect the titer of the harvested rAAV virus, and the titer unit is expressed by VG / ml (VG, virus genomes). The detection of rAAV titer uses a pair of primers targeting the ITR sequence (Q-ITR-F: GGAACCCCTAGTGATGGAGTT and Q-ITR-R: CGGCCTCAGTGAGCGA). The specific operation is as follows: take 500ul of the cell culture packaged with rAAV into a 1.5ml EP tube, and freeze-thaw repeatedly in liquid nitrogen and a 37 degree water bath for 4 times. Take 0.1ul Benzonase and add it to 500ul of the mixed solution, mix well at 37 degrees water bath for 1h, and then 95 degrees water bath for 10min. Centrifuge at 2500g for 10min, collect the supernatant in a new 1.5ml EP tube. Take 200ul of the supernatant and add 10ul of 10% SDS solution to make the final concentration 0.5% SDS. Then add 1.2ul of Proteinase K (working concentration 112ug / ml), the final volume is about 210ul, 55 degrees water bath for 1h. After brief centrifugation, 95 degrees water bath for 10min. Mix well, take 5ul of the sample and add 145ul of ddH2O to make the final volume 150ul; mix well, then take 10ul of the sample and add 90ul of ddH2O to make the final volume 100ul, take 2ul as Q-PCR template to measure the titer of the virus sample. The detection results of the packaging titer of rAAV of different generations in each group are shown in Table 1. Figure 6

[0123] ​As can be seen from the figure, in group 3-5, the packaging titer of rAAV is stably maintained from the 2nd generation to the 9th generation, in contrast, in group 1-2, the packaging titer of rAAV decreases rapidly from the 3rd generation to the 10th generation, and even decreases by more than one order of magnitude; by comparing the packaging titers of rAAV in different generations in group 1-3, it can be seen that the production stability of rAAV in group 3 is better, and the yield is higher, and in group 3, ITR-GOI is placed between the CNE sequence and the NAE sequence; by comparing the packaging titers of rAAV in different generations in group 3-5, it can be seen that the production stability of rAAV in group 5 is better, and the yield is higher, and in group 5, ITR-GOI, Cap and Rep gene expression cassettes are placed between the CNE sequence and the NAE sequence. It is proved that the scheme of placing the foreign gene expression cassette between the CNE sequence and the NAE sequence can significantly increase the production stability and yield of rAAV in the large-scale passage process.

[0124] Those skilled in the art will easily understand that the above description is only the preferred embodiment of the present application, and is not intended to limit the present application, and any modifications, equivalent replacements and improvements made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A recombinant baculovirus vector, characterized in that: The nucleic acid molecule comprises an exogenous gene expression cassette located between a CNE sequence and a NAE sequence of the nucleic acid molecule, and spaced less than 5 kb from the CNE sequence and less than 5 kb from the NAE sequence.

2. The recombinant baculovirus vector of claim 1, wherein: The spacing between the CNE sequence and the NAE sequence is greater than 1.5 kb.

3. The recombinant baculovirus vector of claim 1, wherein: The exogenous gene expression cassette is a parvovirus Cap gene expression cassette, a parvovirus Rep gene expression cassette, a parvovirus Cap and Rep integrated gene expression cassette, or a transgene cassette.

4. The recombinant baculovirus vector of claim 3, wherein: The transgene cassette comprises a transgene flanked by at least one parvovirus inverted terminal repeat sequence.

5. The recombinant baculovirus vector of claim 4, wherein: The transgene comprises a nucleic acid sequence encoding a therapeutic gene product.

6. The recombinant baculovirus vector of claim 5, wherein: The therapeutic gene product is a protein, a polypeptide, a small interfering RNA, a vector-based short hairpin RNA, or a microRNA.

7. The recombinant baculovirus vector of claim 1, wherein: The exogenous gene expression cassette is for expressing a protein, a polypeptide, a small interfering RNA, a vector-based short hairpin RNA, or a microRNA.

8. The recombinant baculovirus vector of any one of claims 1-7, wherein: A recombinant adeno-associated virus.

9. The recombinant baculovirus vector of claim 8, wherein: The recombinant baculovirus vector is an insect cell-compatible vector.

10. An insect cell, characterized in that: A recombinant baculovirus vector of claim 8 or 9.

Images