Recombinant getah virus expressing encephalitis b virus e protein, methods of construction and vaccine applications thereof

Abstract

The application discloses a recombinant getah virus expressing E protein of Japanese encephalitis virus, the virus has the E protein gene of the Japanese encephalitis virus, and the E protein gene is located between Cap and E3 genes of the genome of the getah virus. A corresponding construction method is also established, the getah virus is used as a parent strain, an infectious clone pGETV-GV thereof is used as a carrier, a truncated E protein of the Japanese encephalitis virus is inserted between Cap and E3 by using a genetic engineering method, and the recombinant getah virus rGECJEV-E is obtained. Tests show that the recombinant getah virus rGECJEV-E has the characteristics of good performance, good stability and high expression amount of exogenous protein, the expressed protein has good immunogenicity, can provide immunoprotection for the attack of the Japanese encephalitis virus, and the safety of the recombinant strain is relatively high. Therefore, the recombinant virus has great potential in preparation of a vaccine or a medicine for preventing or treating the getah virus and / or the Japanese encephalitis virus, and is expected to develop a recombinant bivalent vaccine for the getah virus and the Japanese encephalitis.

Description

Technical Field

[0001] This invention belongs to the field of viral protein expression technology, and particularly relates to a recombinant gaiter virus expressing Japanese encephalitis virus E protein, its construction method, and its vaccine application. Background Technology

[0002] Getah virus (GETV) is a mosquito-borne zoonotic virus belonging to the family Hymenoviridae and the genus Alphavirus. It was first isolated from *Culex gelidus* in Malaysia in 1955 and spread widely in the South Pacific. Since the early 21st century, the range and geographic distribution of GETV have gradually expanded from low-latitude tropical regions to 60° North latitude, and it has been isolated from 17 different species of mosquitoes belonging to five genera (*Culex*, *Anopheles*, *Armigeres*, *Aedes*, and *Mansonia*) in Eurasia, as well as midges. GETV infects animals ranging from horses and pigs to cattle, blue foxes, and red pandas, and the number of disease outbreaks caused by GETV in animals has gradually increased with the types of animals infected. The burden of GETV on the world is severely underestimated, and the increased economic costs to livestock production remain unknown.

[0003] Japanese encephalitis virus (JEV) is a member of the Flaviviridae family and Flavivirus genus. It is one of the most important pathogens in developing countries, primarily prevalent in tropical and subtropical regions of Asia and the Pacific. JEV is mainly transmitted through mosquito bites. Pigs are reservoir hosts for JEV, while humans, horses, and other animals are definitive hosts. The World Health Organization reports more than 67,900 cases of JEV infection globally each year, with over 10,000 being fatal. With rising global temperatures, climate change has led to increased habitat range and activity of JEV-carrying mosquitoes, resulting in a rise in clinical morbidity and causing significant economic losses to the global pig industry. The E protein is associated with viral virulence, host range, tissue tropism, membrane fusion, protective immunity, hemagglutination reaction, and serum specificity. The E protein also functions to produce hemagglutination-inhibiting antibodies, complement-fixing antibodies, and neutralizing antibodies, evoking a protective immune response in the host. It binds to specific receptors and adheres to cell membranes; therefore, the E protein is the protein of choice for JEV vaccines. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a recombinant gaiter virus expressing Japanese encephalitis virus E protein, its construction method and vaccine application, wherein the obtained recombinant strain has good stability, high expression level of exogenous protein, and good immunogenicity and immune protection.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0006] A recombinant gehtavirus expressing the Japanese encephalitis virus E protein, which possesses the Japanese encephalitis virus E protein gene, located between the Cap and E3 genes in the gehtavirus genome.

[0007] The above-mentioned method for constructing recombinant gehtavirus involves using gehtavirus as the parent strain, its infectious clone pGETV-GV as the vector, and using genetic engineering methods to insert a truncated Japanese encephalitis virus E protein between Cap and E3 to obtain recombinant gehtavirus rGECJEV-E; the preservation number of gehtavirus is CCTCC NO: V 202069; the Japanese encephalitis virus E protein is derived from the porcine Japanese encephalitis virus vaccine strain SA14-14-2.

[0008] The above-mentioned method for constructing recombinant gaiter virus involves using SOE-PCR in GETV infectious clones to fuse a portion of the GETV genome sequence, the secretory peptide USP, a truncated JEV E protein gene, and the Flag tag. The fusion fragment is then inserted between the Cap and E3 genes using two restriction enzyme sites, SwaI and SrfI, to obtain the recombinant plasmid pGECJEV-E. This plasmid is then transfected into sensitive cell lines for virus rescue to obtain recombinant gaiter virus rGECJEV-E.

[0009] The fusion fragment has the base sequence of sequence listing SEQ.NO.ID.14.

[0010] The recombinant plasmid was constructed as follows:

[0011] Using the full-length infectious clone pGETV-GX of GETV as a template, PCR products S1 and S2, containing SwaI and SrfI restriction enzyme sites, were amplified using primers SwaⅠ-F1 / Cap-R1 and Flag-T2A-E3-F3 / SrfⅠ-R3, respectively. Using porcine Japanese encephalitis virus SA14-14-2 cDNA as a template, PCR product S3, containing a truncated JEV E protein sequence and a Flag tag sequence, was amplified using the mutant primer USP-JEV-E-F2 / JEV-E-flag-R2. A second round of fusion PCR amplification was performed using primer USP-F2 / JEV-E-flag-R2. After recovering the amplified products, a third round of fusion PCR amplification was performed using primer cap-USP-F2 / JEV-E-flag-R2, yielding a product containing the secretory peptide USP and JEV. The PCR product S4 of the truncated E protein sequence and the Flag tag sequence was used as templates. Fusion PCR amplification was performed using the mutant primer cap-USP-F2 / SrfⅠ-R3. The fusion PCR product and PCR product S1 were used as templates for a final fusion amplification using the outer primer SwaⅠ-F1 / SrfⅠ-R3. The final fusion PCR product S5 was digested with SwaI and SrfI enzymes, and the full-length infectious clone pGETV-GX of the GETV vector was also digested. The fusion PCR product fragment containing the restriction sites was cloned into pGETV-GX using T4 DNA ligase to obtain the recombinant plasmid pGECJEV-E.

[0012] Primers SwaⅠ-F1, Cap-R1, Flag-T2A-E3-F3, SrfⅠ-R3, USP-JEV-E-F2, JEV-E-flag-R2, cap-USP-F2, and USP-F2 each have the base sequences of SEQ.NO.ID.1-8 in the sequence listing;

[0013] The secretory peptide USP, the truncated sequence of JEV E protein, and the Flag tag sequence have the base sequences of sequence listing SEQ.NO.ID.11-13, respectively.

[0014] The sensitive cell lines are BHK-21 cells, PK-15 cells, and MARC-145 cells.

[0015] The above-mentioned recombinant gehtavirus is used in the preparation of vaccines or drugs.

[0016] The application of recombinant plasmids or recombinant viruses obtained by any of the above construction methods in the preparation of vaccines or drugs.

[0017] The recombinant bivalent vaccine is prepared from the recombinant gehtavirus or any of the recombinant plasmids or recombinant viruses obtained by the above-mentioned recombinant gehtavirus or any of the construction methods.

[0018] To address the current lack of vaccines that simultaneously prevent gehtavirus (GETV) and Japanese encephalitis virus (JEV), the inventors constructed a recombinant gehtavirus expressing the JEV E protein. This virus possesses the JEV E protein gene, located between the Cap and E3 genes in the gehtavirus genome. A corresponding construction method was also established, using gehtavirus as the parent strain and its infectious clone pGETV-GV as the vector. Using genetic engineering methods, a truncated JEV E protein was inserted between the Cap and E3 genes to obtain the recombinant gehtavirus rGECJEV-E. The gehtavirus's accession number is CCTCC NO: V 202069. The JEV E protein is derived from the porcine JEV vaccine strain SA14-14-2. This invention inserts a foreign gene between the Cap and E3 protein genes. Compared to other positions, this position can accommodate a genetically stable foreign gene, which will not be deleted or lost during at least nine viral passages in vitro. Experiments show that,

[0019] IFA results showed that the rescued virus could be recognized by the GETV-specific antibody, indicating successful virus rescue. The gaeta recombinant virus rGECJEV-E described in this invention can stably form CPE on cells, with a cytopathic time of approximately 18–24 hpi and a viral titer of 10. 5 TCID 50 / mL-10 6 TCID 50 / mL, can form a plaque phenotype similar to the parental strain on BHK-21 cells. Multi-step growth curves show that its trend is basically consistent with that of the parental strain, indicating that the insertion of the exogenous fragment JEV E has no effect on the proliferation of the virus itself. Using flag as the primary antibody, IFA and Western blot analysis showed that the exogenous fragment inserted into the recombinant virus rGECJEV-E can be correctly expressed.

[0020] The results of the immunization of mice showed that JEV E protein antibodies could be detected in serum in the first week after the initial immunization, but the antibody level was low. After the booster immunization, the antibody level increased significantly and remained at a high level for two weeks. After the second immunization, the neutralizing antibody titer was determined by the plaque reduction neutralization assay. The neutralizing antibody titer in the rGECJEV-E immunization group was >1 / 128, while the titers in the other control groups and the negative group were <1 / 5.

[0021] Immunoprotective experiments against Japanese encephalitis virus (JE) in target mice showed that the recombinant virus rGECJEV-E has good safety and immunogenicity, providing good protection against JE virus challenge after immunization. In the control group, mice began exhibiting lethargy, piloerection, motor dysfunction, arched back, and eyelid swelling on day 3 post-challenge, and began dying on day 6, with all mice dying by day 8 post-challenge. Mice immunized with rGECJEV-E did not show the corresponding clinical symptoms; one mouse died on day 14 post-challenge.

[0022] In summary, the recombinant gehtavirus rGECJEV-E of this invention has the characteristics of good properties, good stability, and high expression level of exogenous protein. The expressed protein has good immunogenicity. After immunizing mice with the recombinant virus, it can not only stimulate an immune response against gehtavirus, but also produce specific antibodies against JEV E protein, which can provide immune protection against Japanese encephalitis virus challenge. Moreover, the viral load results indicate that the recombinant virus has extremely low pathogenicity or even almost no pathogenicity, indicating that the recombinant strain has high safety.

[0023] Therefore, the recombinant virus rGECJEV-E of this invention has great potential in the preparation of vaccines or drugs for the prevention or treatment of gehtavirus and / or Japanese encephalitis virus, and is expected to develop a recombinant bivalent vaccine that targets both gehtavirus and Japanese encephalitis. Attached Figure Description

[0024] Figure 1 A schematic diagram illustrating the construction method of the genomicon recombinant plasmid pGECJEV-E.

[0025] Figure 2 Construct an electrophoresis diagram for the plasmid, as shown in the figure:

[0026] a: M: DL 2000 DNA Marker, S1 amplifies the GETV S1 fragment, S2 amplifies the GETV S2 fragment;

[0027] b:M:DL 2000DNA Marker, S3 is a PCR product amplified using laboratory-preserved Japanese encephalitis virus SA14-14-2 cDNA as a template, which contains USP secretory peptide, truncated JEV E protein sequence and Flag tag sequence.

[0028] c: M: DL 5000 DNA Marker, S5: Fragment S3 fused with USP, product fused with S1 and S2 fragments.

[0029] Figure 3This is an electrophoresis result of the recombinant plasmid pGECJEV digestion and identification. In the figure: M: DL15000 DNA Marker; Lane 1: pGECJEV-E; Lane 2: pGETV-GX.

[0030] Figure 4 This is a diagram of the cytopathic effect (CPE) induced by viral infection of BHK-21 cells. In the diagram: A: rGETV-GX; B: rGECJEV-E; C: normal BHK-21 cells.

[0031] Figure 5 This is a 20× indirect immunofluorescence assay result of P3 generation recombinant virus. In the figure: A, B, and C are GETVE2 protein antibodies, and D and E are flag tag antibodies. A is inoculated with the parental strain rGETV-GX, B and D are inoculated with recombinant virus rGECJEV-E, and C and E are uninoculated BHK-21 cells.

[0032] Figure 6 This is a Western blot analysis result of the P3 generation recombinant virus rGECJEV-E. In the figure: M: Vazyme Marker; Lane 1: rGECJEV-E infected cell lysate; Lane 2: rGECJEV-E infected cell supernatant; Lane 3: rGETV-GX infected cell lysate; Lane 4: rGETV-GX infected cell supernatant.

[0033] Figure 7 This is a growth curve diagram of the recombinant virus rGECJEV-E and its parent strain rGETV-GX.

[0034] Figure 8 These are plaque morphology diagrams of the recombinant virus rGECJEV-E and its parent strain rGETV-GX. In the diagram: A: rGETV-GX; B: rGECJEV-E.

[0035] Figure 9 This is a graph showing the genetic stability test results of the recombinant virus rGECJEV. In the graph: M: DL 5000 DNA Marker; P3, P5, P7, P9, and P11 were amplified using the cDNA of the recombinant virus from generations P3, P5, P7, P9, and P11 as templates, respectively; 1-3 are negative controls; 4 is the control amplified using the cDNA of rGETV-GX as a template; 5 is the control amplified using plasmid pGECJEV-E as a template.

[0036] Figure 10 The results of the indirect immunofluorescence experiment (20×) using mouse serum as the primary antibody after immunization are shown. In the figure: A, B, and C are the rGETV-GX strain infected with BHK-21 cells, the JEV strain infected with BHK-21 cells, and the negative control, respectively.

[0037] Figure 11 The graph shows the antibody curve of mouse serum against JEV E protein detected by ELISA after immunization with rGECJEV-E.

[0038] Figure 12 The survival rate curves of immunized mice after being challenged with JEV virus are shown.

[0039] Figure 13 The results show the viral load in the tissues of mice after viral attack.

[0040] Preservation Information

[0041] Porcine genomic virus GETV-GX201808, accession number CCTCC NO: V 202069, accession date: October 13, 2020, accession address: Wuhan University, Wuhan, China, 430072, depositary institution: China Center for Type Culture Collection. Detailed Implementation

[0042] The following examples illustrate how the present invention can be implemented. Experimental methods without specific conditions are performed according to conventional procedures and conditions, such as those described in Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

[0043] 1. Construction of recombinant clones

[0044] 1.1 Virus, Cells, Strains and Reference Sequence

[0045] BHK-21 cells (milk hamster kidney cells), pGETV-GX, and Japanese encephalitis virus were preserved in the applicant's laboratory. The competent bacterial cells DH5α were purchased from TransGen Reagent Co., Ltd.

[0046] 1.2 Main Reagents and Instruments

[0047] RNase inhibitors (RRI, Thermo Fisher), dNTP Mixture, Reverse Transcriptase M-MLV (RNase H-, TaKaRa), DNA Marker (TaKaRa), Green Taq Mix (Vazyme), Restriction endonucleases, T4 DNA Ligase (NEB), Plasmid Mini Kit, Gel Extraction Kit, Viral RNA Kit (OMEGA), Lipfectamine 2000 (Invitrogen), CO2 incubator (Thermo Fisher), Inverted microscope (Olympus CKX41), Nucleic acid electrophoresis system (Beijing Junyi Oriental Electrophoresis Equipment), Goat Anti-Rabbit IgG (H+L) (TransGold); SDS-PAGE gel preparation kit, protein marker, RIPA cell lysis buffer (Kangwei Century Co., Ltd.); HRP-goat anti-rabbit IgG (H+L) (Beyotime), HRP-goat anti-mouse IgG (H+L) (Beyotime), Flag Tag Mouse Monoclonal Antibody (Beyotime); Crystal Violet Powder (Shanghai Jereh Biotechnology), Formaldehyde, Purified Agar (OXOID).

[0048] 1.3 Primer Design

[0049] (1) Using the full-length infectious clone pGETV-GX of GETV (Reference: Full-length infectious clone of GETV, replicator system and its preparation and application, Patent Application No. 2020113085094, Publication Date 2021-03-09) as a template, the end products containing SwaI and SrfI restriction enzyme sites were amplified respectively.

[0050] SwaⅠ-F1:ACCTACCGGTACAAGATTTAAATTCGGT (Sequence Listing SEQ.NO.ID.1)

[0051] Cap-R1: CTGGCTGGATTGTCATCCATTCTTCTGTTCCTTC (Sequence Listing SEQ.NO.ID.2)

[0052] Flag-T2A-E3-F3:GATGACAAGGAGGGCAGAGGAAGTCTTCTAACATGCGGTGAC

[0053] GTGGAGGAGAATCCCGGCCCTTCCGCCGCCTTG (Sequence Listing SEQ.NO.ID.3)

[0054] SrfⅠ-R3:GAGCAGATCGTAGTAGCCCGGGCGGTCCACGTTGTCCTCCAACA (Sequence Listing SEQ.NO.ID.4)

[0055] (2) Primers for amplifying the truncated JEV E protein and the flag tag were designed based on the genomic base sequence and flag tag sequence of the Japanese encephalitis virus strain SA14-14-2.

[0056] USP-JEV-E-F2:TGGAAATAAGCAGCACCTGCGATGCAATGACAATCCAGCCAGAAAACATCA (Sequence Listing SEQ.NO.ID.5)

[0057] JEV-E-flag-R2:CTTGTCATCGTCGTCCTTGTAATCCGTGCTTCCAGCTTTGTGCCAATGG (Sequence Listing SEQ.NO.ID.6)

[0058] (3) Design primers to amplify the secretory peptide USP

[0059] cap-USP-F2:CACCCCAGAAGGAACAGAAGAATGGATGTACAAAAAAAAGATTATCTCAGCTATTTTAATGT CTACAGTGATACTTTCTGCTGCAG (Sequence Listing SEQ.NO.ID.7)

[0060] USP-F2: CTACAGTGATACTTTCTGCTGCAGCCCCGTTGTCAGGTGTTTACGCCCTGGAAATAAGCAGCACCT GCGATGCA (Sequence Listing SEQ.NO.ID.8)

[0061] (4) Design detection primers for detecting exogenous genes. The PCR amplification site is the exogenous gene and the fragments of the vectors on both sides.

[0062] Cap344jiace-F:GTGGCAGGTTCACAATC (Sequence Listing SEQ.NO.ID.9)

[0063] 344srfI-R:CTCGAGCAGATCGTAGTA (Sequence Listing SEQ.NO.ID.10)

[0064] The primers mentioned above were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0065] 1.4 Construction process of recombinant clone pGECJEV-E

[0066] Using the full-length infectious clone pGETV-GX of GETV as a template, PCR product S1 and PCR product S2, containing SwaI and SrfI restriction enzyme sites at both ends, were amplified using amplification primers SwaⅠ-F1 / Cap-R1 and Flag-T2A-E3-F3 / SrfⅠ-R3, respectively.

[0067] Using cDNA from the laboratory-preserved Japanese encephalitis strain SA14-14-2 as a template, PCR product S3 containing a truncated JEV E protein sequence and a flag tag sequence was amplified using primers USP-JEV-E-F2 / JEV-E-flag-R2. A second round of fusion PCR amplification was performed using primers USP-F2 / JEV-E-flag-R2. After recovering the amplified product, a third round of fusion PCR amplification was performed using primers cap-USP-F2 / JEV-E-flag-R2, yielding a product containing the secretory peptide USP and JEV. The truncated E protein sequence and the Flag tag sequence were used to generate PCR product S4. Using PCR product S4 and PCR product S2 as templates, fusion PCR amplification was performed using the mutant primer cap-USP-F2 / SrfⅠ-R3. Using the fused PCR product and PCR product S1 as templates, a final fusion amplification was performed using the outer primer SwaⅠ-1F / SrfⅠ-R3 to obtain the final fused PCR product S5 (SEQ.NO.ID.14). The final fused PCR product S5 was digested with SwaI and SrfI enzymes, and pGETV-GX was also digested. The digested fusion PCR product fragment was cloned into pGETV-GX using T4 DNA ligase to obtain the recombinant plasmid pGECJEV-E.

[0068] PCR system: Prime STAR 12.5 μL, cDNA amplification template 3 μL, primer-F / primer-R 0.5 μL each, dd H2O to 25 μL. PCR reaction program conditions are as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 5 s, 72℃ extension for 10-25 s, for a total of 35 cycles; 72℃ extension for 10 min. For SOE-PCR, use two cDNA templates in a 1:1 molar ratio, without adding primers initially. After 6 cycles of PCR, add primers and run the standard PCR program. After the PCR reaction program is complete, perform electrophoresis on a 1% agarose gel. Stop electrophoresis when the dye reaches 2 / 3 of the way up the gel. Under UV irradiation, cut the correctly sized band into a 2 mL EP tube and recover the DNA using an OMEGA gel extraction kit. Store the DNA at -20℃.

[0069] The specific steps for enzyme digestion are as follows: 30 μL of target gene / plasmid / 15 μL of target gene, 1 μL each of SwaI and SrfI, 5 μL of CutSmart Buffer, and dd H2O to a final volume of 50 μL. The reaction conditions are as follows: after adding SwaI and SrfI, incubate at 37°C for 5 hours. The digestion product is then recovered using an OMEGA reaction solution recovery kit, and the DNA is stored at -20°C.

[0070] The exogenous fragments recovered from enzyme digestion and the vector digested by enzyme digestion were ligated at a molar ratio of 3:1 using T4 DNA ligase at 16°C for 6 hours. The ligation was then transformed into DH5α competent cells. The transformed bacterial culture was evenly spread onto LB culture dishes and placed at 37°C overnight. After uniform colonies grew on the culture dishes, they were removed, and single colonies were picked for culture and plasmid DNA was extracted.

[0071] The recombinant plasmid pGECJEV-E was digested with SwaI and SrfI, and then electrophoresed on a 1% agarose gel to screen for positive samples. The recombinant plasmids corresponding to the positive samples were then sequenced.

[0072] 2. Rescue and biological characteristics analysis of recombinant viruses

[0073] The correctly identified recombinant plasmid was transfected into well-grown BHK-21 cells in 6-well plates according to the Lipfectamine 2000 instructions. Before transfection, the culture medium was replaced with Opti-DMEM, and the transfection dose was 2 μg. The transfected 6-well plates were placed in an incubator at 37°C containing 5% CO2 and cultured for 6 hours. After 6 hours, the medium was replaced with 2 mL of DMEM containing 2% FBS. Cytopathic effects were continuously observed. After 36–48 hours, the cell supernatant was collected and stored at -80°C for later use.

[0074] 2.1 Indirect immunofluorescence (IFA) identification of recombinant virus

[0075] BHK-21 cells that were growing well in 6-well plates were inoculated with P3 generation recombinant virus at a dose of 0.01 MOI. After inoculation, the cell plates were incubated in a 37°C, 5% CO2 incubator. After observing cytopathic effects, the cell supernatant was discarded, the cell plates were washed twice with PBS, and the cells were fixed overnight at 4°C with pre-cooled methanol. Then, 1.0% BSA was added and the plates were blocked in a 37°C incubator for 45 min. After blocking, 500 μL of Flag-tagged mouse antibody (1:1000 dilution) and GETV E2 rabbit polyclonal antibody (1:1000 dilution) were added and the plates were incubated overnight at 4°C. After incubation, the cells were washed 5 times with TBST. After washing, 500 μL of goat anti-mouse and goat anti-rabbit secondary antibodies (1:1000 dilution) were added and the plates were incubated in a 37°C incubator in the dark for 45 min. After incubation and washing, the cells were stained with DAPI dye and observed under a fluorescence microscope.

[0076] 2.2 Determination of multi-step growth curve of recombinant virus

[0077] BHK-21 cells were infected with recombinant virus and parental virus at a dose of 0.01 MOI. Cell supernatant was collected at 6h, 12h, 18h, 24h, 36h, 48h and 60h post-infection. Viral titer was measured at each time point, and multi-step viral growth curves were plotted.

[0078] 2.3 Viral plaque phenotype determination

[0079] Use 100 TCIDs 50 The recombinant virus and parental virus were inoculated into BHK-21 cells with a cell abundance of approximately 90% and incubated at 37°C with 5% CO2 for 1 hour. After incubation, the supernatant was discarded, and 4 mL of a 1:1 mixture of 2×DMEM and 2% low-melting-point agar was added to each well. After solidification, the cells were inverted and incubated for further growth at 37°C with 5% CO2. After observing obvious plaques under an inverted microscope, the cells were fixed with 4% paraformaldehyde for 6 hours. The fixative and agar layer were washed away, and then stained with 0.5% crystal violet for 30 minutes. After rinsing off the staining solution with water, the cells were observed.

[0080] 2.4 Stability identification of recombinant virus

[0081] The recombinant virus was passaged to the 15th generation, and the cell supernatant from the P1 to P15 generations was collected. Then, the viral nucleic acid of the P3, P5, P7, P11, and P15 generations was extracted using the Viral RNA Kit. After reverse transcription, conventional PCR was performed using primers Cap344 jiace-F and 344srfI-R. The parental strain and the recombinant plasmid were used as controls to verify the genetic stability of the exogenous reporter protein in the recombinant virus.

[0082] 2.5 Western Blot Identification of JEV E Protein Expression by Recombinant Virus rGECJEV-E

[0083] rGECJEV-E and rGETV-GX were seeded into BHK-21 cells, with the DMEM group serving as a negative control. After 36 hours, the supernatant and cells were collected, and the processed samples were subjected to SDS-PAGE electrophoresis. Proteins were transferred to PVDF membranes using a semi-dry transfer apparatus and blocked with 5% skim milk powder. The primary antibodies were Flag-tagged antibody and GETV E2 protein rabbit polyclonal antibody, respectively. The secondary antibodies were HRP-labeled goat anti-mouse IgG and HRP-labeled goat anti-rabbit IgG, respectively. After Western blot analysis, the samples were immediately observed and photographed using a Western blot imaging system for storage.

[0084] 3. Immunoprotective assay of recombinant virus rGECJEV-E

[0085] 3.1 Immunization and Infection

[0086] Thirty healthy 6-week-old female BALB / c mice were randomly divided into three groups of 10 mice each: the rGECJEV-E group, the rGETV-GX group, and the DMEM-negative group. The mice were immunized via intraperitoneal injection, with each mouse receiving a challenge dose of 10 mg / L. 7 TCID 50 Two weeks after the first immunization, mice were immunized a second time using the same method but with double the dose. Fourteen days after the second immunization, mice were challenged intraperitoneally with the Japanese encephalitis type III strain HSY-1 and given an intracerebral injection. The mice were observed for survival and clinical symptoms daily for 14 days after infection.

[0087] 3.2 IFA detection of antibodies in mice

[0088] BHK-21 cells that were growing well in 6-well plates were seeded with JEV and GETV at a dose of 0.01 MOI. After inoculation, the cell plates were incubated in a 37°C, 5% CO2 incubator. After observing cytopathic effects, the cell supernatant was discarded, the cell plates were washed twice with PBS, and the cells were fixed overnight at 4°C with pre-chilled ice-cold methanol. Then, 1.0% BSA was added and the cells were blocked in a 37°C incubator for 45 min. After blocking, mouse serum diluted 1:500 was added and the cells were incubated overnight at 4°C. The cells were washed with TBST, and 500 μL (1:1000) goat anti-mouse secondary antibody was added to each well. The cells were incubated in a 37°C incubator in the dark for 45 min. After incubation and washing, nuclear staining was performed with DAPI dye and observed under a fluorescence microscope.

[0089] 3.3 Indirect ELISA detection of anti-JEV antibody titer in mouse serum

[0090] The purified pcold-JEV-E protein was added to each well of a 96-well ELISA plate at a dilution of 200 μg / well, and then 100 μl was added to each well. The plate was incubated overnight at 4°C. The plate was washed 3-5 times with PBST, and 100 μl of PBST containing 1% BSA was added to each well of the ELISA plate. The plate was incubated at 37°C for 2 h. The plate was washed 3-5 times with PBST. The mouse serum to be tested was diluted 1:200 with PBST containing 1% BSA, and 100 μl of the diluted serum was added to each well of the ELISA plate. The plate was incubated at 37°C for 1 h, and then washed thoroughly with PBST. The (HRP)-labeled goat anti-mouse IgG antibody was diluted 1:5000 with PBST containing 1% BSA, and 100 μl of the antibody was added to each well of the ELISA plate. The plate was incubated at 37°C for 45 min, and then washed thoroughly with PBST. After color development, the absorbance at a wavelength of 450 nm was measured.

[0091] 3.4 Detection of neutralizing antibodies in the serum of mice immunized with recombinant virus

[0092] The neutralizing antibody titer of the isolated mouse serum was determined using the plaque reduction neutralization assay. After plating, serum of different dilution levels was mixed with an equal volume of 100 PFU of JEV and incubated at 37°C for 1 h. The mixture was then seeded into 0.2 mL per well of a monolayer 6-well plate and incubated at 37°C for 1 h. The virus solution was then discarded, and 2 mL of 2×DMEM and 2% low melting point agar were mixed 1:1 and added to each well. The plates were incubated at 37°C, and the cells were fixed and stained after plaques appeared.

[0093] 3.5 Viral load in mouse tissues after viral attack

[0094] Mice were euthanized on days 3 and 5 after viral challenge. 0.1g of brain tissue was collected and added to 1mL of DMEM for grinding. After centrifugation, 100μl of the supernatant was collected, and then further diluted 10-fold serially with DMEM until a final concentration of 10 was reached. -6The diluted virus solution was inoculated into BHK-21 cells with approximately 90% cell abundance and incubated at 37°C with 5% CO2 for 1 hour. After incubation, the supernatant was discarded, and 4 mL of a 1:1 mixture of 2×DMEM and 2% low-melting-point agar was added to each well. After solidification, the cells were inverted and incubated at 37°C with 5% CO2 for further culture. After observing obvious plaques under an inverted microscope, the cells were fixed with 4% paraformaldehyde for 6 hours. The fixative and agar layer were washed off, and then stained with 0.5% crystal violet for 30 minutes. After washing off the staining solution with water, the cells were observed, and the virus titer was calculated to plot the tissue load curve.

[0095] 4 Experimental Results

[0096] 4.1 Target gene amplification and recombinant plasmid restriction enzyme digestion identification

[0097] like Figure 2 , Figure 3 As shown, the size of the amplified target gene fragment is consistent with the theory, and the size of the recombinant plasmid restriction enzyme digestion bands is consistent with the theory, indicating that the recombinant plasmid was successfully constructed.

[0098] 4.2 Rescue of Recombinant Viruses

[0099] The recombinant plasmid constructed by transfecting BHK-21 cells exhibited pathological changes such as shrinkage, filamentation, and fragmentation, eventually leading to cell detachment and death. Negative cells showed no significant changes, indicating successful virus rescue. Figure 4 ).

[0100] 4.3 Identification of Recombinant Viruses

[0101] 4.3.1 Indirect immunofluorescence assay (IFA) for identifying recombinant virus

[0102] Viral solutions of P3 generation parental virus and recombinant virus were inoculated into BHK-21 cells, with a negative control included. Indirect immunofluorescence staining was performed to detect the expression of the carrier protein E2 and the exogenous protein JEVE. Incubation with the corresponding antibodies produced specific fluorescence, while normal BHK-21 cells (as a blank control) did not produce specific fluorescence. Figure 5 This indicates that BHK-21 cells infected with the recombinant virus expressed GETV and JEV proteins, and also shows that infectious recombinant GETV was rescued.

[0103] 4.3.2 Western Blot (WB) Identification of Recombinant Virus

[0104] The recombinant virus and the parental virus were inoculated into BHK-21 cells. After 36 hours, the supernatant and cells were collected for SDS-PAGE electrophoresis. Mouse Flag-Tag antibody was used as the primary antibody for incubation and color development. Lane 1 showed a specific band of the expected size, while the parental virus did not show this band. Figure 6 This indicates that the exogenous gene was successfully expressed in the recombinant virus. 4.4 Analysis of the biological characteristics of rGECJEV-E

[0105] 4.4.1 Determination of multi-step growth curve of recombinant virus

[0106] To further understand the growth characteristics of the recombinant virus, BHK-21 cells were infected with the recombinant virus and parental virus at a dose of 0.01 MOI, and multi-step growth curve analysis of the virus was performed. Figure 7 The results showed that the rescued virus had similar replication kinetics curves to the parental strain, but the parental strain reached its highest viral titer 18 hours after infection, while the recombinant virus with the inserted reporter gene reached its highest viral titer 24 hours after infection.

[0107] 4.4.2 Viral plaque phenotype determination

[0108] Use 100 TCIDs 50 The infection dose will be determined by inoculating cells with recombinant virus and parent virus for plaque assays. Figure 8 By comparing the plaque phenotype, the results showed that the plaques formed by the recombinant virus and the parent virus were similar in size, indicating that the recombinant virus had the same infectivity to cells as the parent virus.

[0109] 4.4.3 Stability analysis of recombinant viruses

[0110] The stability of exogenous proteins in the viral genome was analyzed by RT-PCR, with parental strains and recombinant plasmids used as controls. The results showed that ( Figure 9 When the exogenous protein JEV E is expressed between the Cap protein and the E3 protein, it is deleted in the 11th generation and can be stably inherited to the P9 generation.

[0111] 4.5 Immunogenicity of the recombinant GECJEV-E vaccine

[0112] 4.5.1 Immunoprotective experiments against Japanese encephalitis virus were conducted on target animals, mice. After immunization with the recombinant virus, all mice in each group were healthy and active without clinical symptoms and no change in weight, indicating that the recombinant vaccine has high safety.

[0113] 4.5.2 IFA detection of antibodies in mice

[0114] Viral solutions of the P3 generation parental virus and recombinant virus were inoculated into BHK-21 cells, with a negative control included. Indirect immunofluorescence staining was performed to detect the expression of the carrier protein E2 and the exogenous protein JEVE. Incubation with serum from the ninth day after immunization with the recombinant virus as the primary antibody resulted in specific fluorescence, while normal BHK-21 cells (as a blank control) showed no specific fluorescence. Figure 10 The presence of GETVE2 and JEVE proteins indicates their expression.

[0115] 4.5.3 Indirect ELISA detection of mouse serum anti-JEV antibody titer

[0116] The JEV ELISA results are shown in the figure ( Figure 11 One week after the first immunization with the recombinant virus, the antibody level against JEV was very low. It increased slightly two weeks after the first immunization, and the antibody level rose rapidly after the second immunization and maintained an upward trend.

[0117] 4.5.4 Detection of neutralizing antibodies in the serum of mice immunized with recombinant virus

[0118] The neutralizing antibody titers of the isolated mouse serum were determined using the plaque reduction neutralization assay. The PRNT results showed that the neutralizing antibody titers in the recombinant rGECJEV-E immunization group were >1 / 128, while those in the other control and negative groups were <1 / 5. This indicates that the recombinant virus has a certain neutralizing effect, producing neutralizing antibodies against JEV with high titers, which can provide good protection against JEV challenge.

[0119] Protection against challenge in 4.6rGECJEV-E immunized mice

[0120] 4.6.1 Survival rate change curve of mice after challenge

[0121] Control group mice began exhibiting lethargy, piloerection, dyskinesia, arched back, and eyelid swelling on the third day after challenge, and began dying on the sixth day, with all mice dying by the eighth day after challenge. Mice immunized with rGECJEV-E did not show the corresponding clinical symptoms; their weight only decreased briefly before rapidly recovering. By the 14th day after challenge, one mouse had died. Figure 12 The fact that all mice in the control group died while only one mouse in the immunized group died indicates that immunizing mice provides good protection against Japanese encephalitis virus attack.

[0122] 4.6.2 Viral load curve in mouse tissues after viral attack

[0123] Brain tissue from mice on days 3 and 5 after challenge was ground, inoculated into cells, and subjected to plaque assay to determine viral load. A viral load curve was then plotted. Figure 13The viral load in the control group was significantly higher than that in the recombinant virus group. In the brain tissue containing the recombinant virus rGECJEV-E, the viral load did not reach the detection threshold and was undetectable. Vaccination significantly reduced the viral load in the mouse brain, indirectly demonstrating the protective effect of the recombinant virus vaccine on mice.

Claims

1. A recombinant gatavirus expressing Japanese encephalitis virus E protein, characterized in that... A recombinant virus was obtained by inserting the fusion gene shown in SEQ ID NO.14 between the Cap and E3 genes of the gaiter virus with accession number CCTCC NO: V 202069 as the parent strain.

2. The method for constructing recombinant gaiter virus according to claim 1, characterized in that: Using GETV as the parent strain, and its infectious clone pGETV-GV as the vector, a truncated Japanese encephalitis virus (JEV) E protein was inserted between Cap and E3 using genetic engineering methods to obtain recombinant GETV rGECJEV-E. The parent strain's preservation number is CCTCC NO: V202069. The JEV E protein is derived from the porcine Japanese encephalitis virus vaccine strain SA14-14-2. In the GETV infectious clone, a portion of the GETV genome sequence, the secretory peptide USP, the truncated JEV E protein gene, and the Flag tag were fused using SOE-PCR. The fusion fragment was inserted between the Cap and E3 genes using the SwaI and SrfI restriction enzyme sites to obtain the recombinant plasmid pGECJEV-E. This plasmid was then transfected into sensitive cell lines for virus rescue to obtain recombinant GETV rGECJEV-E. The fusion fragment is the base sequence of SEQ.NO.ID.14 in the sequence listing.

3. The method for constructing recombinant gaiter virus according to claim 2, characterized in that... The recombinant plasmid was constructed according to the following steps: Using the full-length infectious clone pGETV-GX of GETV as a template, PCR products S1 and S2, containing SwaI and SrfI restriction enzyme sites, were amplified using primers SwaⅠ-F1 / Cap-R1 and Flag-T2A-E3-F3 / SrfⅠ-R3, respectively. Using porcine Japanese encephalitis virus SA14-14-2 cDNA as a template, PCR product S3, containing a truncated JEV E protein sequence and a Flag tag sequence, was amplified using the mutant primer USP-JEV-E-F2 / JEV-E-flag-R2. A second round of fusion PCR amplification was performed using primer USP-F2 / JEV-E-flag-R2. After recovering the amplified products, a third round of fusion PCR amplification was performed using primer cap-USP-F2 / JEV-E-flag-R2, yielding a product containing the secretory peptide USP and JEV. The PCR product S4 of the truncated E protein sequence and the Flag tag sequence was used as templates. Fusion PCR amplification was performed using the mutant primer cap-USP-F2 / SrfⅠ-R3. The fusion PCR product and PCR product S1 were used as templates for a final fusion amplification using the outer primer SwaⅠ-F1 / SrfⅠ-R3. The final fusion PCR product S5 was digested with SwaI and SrfI enzymes, and the full-length infectious clone pGETV-GX of the GETV vector was also digested. The fusion PCR product fragment containing the restriction sites was cloned into pGETV-GX using T4 DNA ligase to obtain the recombinant plasmid pGECJEV-E. The primers SwaⅠ-F1, Cap-R1, Flag-T2A-E3-F3, SrfⅠ-R3, USP-JEV-E-F2, JEV-E-flag-R2, cap-USP-F2, and USP-F2 are the base sequences of sequence listing SEQ.NO.ID.1-8, respectively; The truncated sequences of the secretory peptide USP, JAVE protein, and Flag tag sequence are the base sequences of sequence listing SEQ.NO.ID.11-13, respectively.

4. The method for constructing recombinant gaiter virus according to claim 3, characterized in that: The sensitive cell lines are BHK-21 cells, PK-15 cells, and MARC-145 cells.

5. The use of the recombinant gehtavirus of claim 1 in the preparation of a vaccine for the prevention of gehtavirus and / or Japanese encephalitis virus.

6. The use of the recombinant plasmid or recombinant virus obtained by any of the construction methods described in claims 2 to 4 in the preparation of a vaccine for the prevention of Gatavirus and / or Japanese encephalitis virus.

7. A recombinant bivalent vaccine, characterized in that... It is prepared from the recombinant gaiter virus of claim 1 or the recombinant plasmid or recombinant virus obtained by any of the construction methods of claims 2 to 4.

Images