InDel molecular marker for identifying genetic sex of megalobrama amblycephala and application

Abstract

According to the InDel specific molecular marker for identifying the genetic sex of the megalobrama amblycephala and the application, a primer pair is designed, sample genome DNA serves as a template, the genetic sex of the megalobrama amblycephala can be identified only through PCR and agarose gel electrophoresis, consumed time is short, damage to fish bodies is small, limitation of fish ages is avoided, the InDel specific molecular marker can be applied to the whole life cycle of the megalobrama amblycephala, and the application range of the InDel specific molecular marker is wide. The method is convenient and rapid, has higher accuracy, and is especially suitable for rapid sex determination of a large number of samples. The method provides basic data for further mining of the sex determining gene of the megalobrama amblycephala, and lays a foundation for sex control breeding of the megalobrama amblycephala.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture biotechnology, specifically relating to an InDel molecular marker for identifying the genetic sex of the thick-jawed bream and its application. Background Technology

[0002] Thick-jawed bream ( Megalobrama pellegrini It belongs to the order Cypriniformes, family Cyprinidae, and genus Cypriniformes. Megalobrama The thick-jawed bream (also known as the black bream or black bream) is an omnivorous fish that primarily feeds on plants. It is prized for its delicious flesh, large size, rapid growth, and high economic value. In Sichuan, among the most valuable scaled fish, there is a saying: "First bream, second rock bream, third Qingbo," with "bream" referring to the thick-jawed bream. This freshwater economic species, endemic to the Yangtze River basin, has an average age of sexual maturity of 3.03 years for females and 2.55 years for males. Females grow faster and reach larger sizes than males. Therefore, if male and female thick-jawed bream can be selected and raised separately at a young age, the economic benefits of aquaculture would be significantly improved. However, the external morphological differences between the sexes of the thick-jawed bream are not significant, and there are no heteromorphic sex chromosomes. Currently, accurate identification relies solely on anatomical examination, severely hindering the development of marker-assisted breeding and separate-sex aquaculture. Therefore, there is an urgent need to develop a specific molecular marker for marker-assisted breeding that can accurately identify the genotype and sex of the thick-jawed bream using a simple method.

[0003] Sex-specific molecular markers refer to stable genotype or DNA sequence differences between specific sexes, and are key tools for elucidating the genetic mechanisms of sex determination and achieving precise identification of genetic sex. In fish, due to the low degree of sex chromosome differentiation in most species (such as the XY / ZW system in the early differentiation stage), it is difficult to distinguish genetic sex through karyotype analysis or phenotypic observation. Therefore, the development of molecular markers has become a core means of revealing the mechanisms of sex determination. In early studies, the screening of sex-specific markers mainly relied on microsatellites (simple sequence repeats, SSR), random amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) techniques. These methods detect polymorphic differences between sexes through PCR amplification and electrophoresis analysis, but they have significant drawbacks such as low screening efficiency, limited resolution, and high cost. In recent years, with the rapid development of high-throughput sequencing technology, the screening methods for sex-specific markers have also been continuously innovated, greatly promoting the research on the determination of sex determination and the mechanisms of sex differentiation in fish. More and more sex markers of economically important fish species have been discovered, such as the spiny-headed pufferfish (Scoidea esculenta). Collichthys lucidus ),grass carp( Ctenopharyngodon idella), goldfish (Carassius auratus) Scatophagus argus ), large yellow croaker (Pseudosciaena crocea) Larimichthys crocea ), and half-smooth tongue (Cynoglossus semilaevis) Cynoglossus semilaevis The present application is based on high-throughput sequencing technology and Fst method, identifies one male-specific molecular marker of Acipenser dabryanus, and successfully applies the marker to rapid identification of female and male genders of Acipenser dabryanus Yibin population. SUMMARY

[0004] The present application aims to provide an InDel-specific molecular marker for genetic gender identification of Acipenser dabryanus.

[0005] Another purpose of the present application is to provide a primer pair for detecting the above-mentioned molecular marker and further identifying the gender of Acipenser dabryanus.

[0006] The last purpose of the present application is to provide a detection method and application for identifying the gender of Acipenser dabryanus.

[0007] In order to achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows: An InDel-specific molecular marker for genetic gender identification of Acipenser dabryanus, the site is located at 32,904,146 bp of chromosome 23, showing multi-fragment non-continuous deletion, the total deletion length is 53 bp, female (XX): retains the complete sequence, the PCR amplification product is 319 bp; male (XY): there are scattered short fragment deletions on the Y chromosome, the total deletion is 53 bp, and the amplification product is 266 bp.

[0008] Sequence alignment verification finds that the Y chromosome deletion region includes: a first deletion region, 32 bp of the Y sequence, the X sequence has one more base than the Y sequence, and the deletion sequence is A; a second deletion region, 94 bp of the Y sequence, the X sequence has 36 bp more than the Y sequence, and the deletion sequence is GTAAATCCAGGTAATTGGAACAAAATACTGAGGAGG; a third deletion region: 157 bp of the Y sequence, the X sequence has 16 bp more than the Y sequence, and the deletion sequence is AACAACACAGAACAAT. Therefore, the sequence of the molecular marker SEQ ID NO. 1 is AGTAAATCCAGGTAATTGGAACAAAATACTGAGGAGGAACAACACAGAACAAT.

[0009] A primer pair for detecting the above-mentioned molecular marker and further identifying the gender of Acipenser dabryanus, the sequence of the primer pair is shown as SEQ ID NO. 2 and SEQ ID NO. 3; A detection method for identifying the gender of Acipenser dabryanus, the specific method is as follows: The genomic DNA of the Pelteobagrus vishnu was extracted as a template, and the primer pair (SEQ ID NO. 2 and SEQ ID NO. 3) was used for PCR amplification, and the PCR amplification system was as follows: 10 uL of Premix Taq (containing dNTPs, Mg 2+ , Taq DNA polymerase and reaction buffer, Takara Bio), 0.8 uL of each of the upstream and downstream primers (10 mM), 1 uL of template DNA, and sterile enzyme-free water was added to 20 L. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 50℃ annealing for 30 s; 72℃ extension for 45 s, a total of 32 cycles; finally 72℃ extension for 10 min; and 4℃ storage; The PCR amplification product was detected by electrophoresis in a 2.5% agarose gel. If a single specific band is amplified, it is a female individual; if two bands are amplified, it is a male individual.

[0010] The application of the above-mentioned molecular marker or primer pair in identifying the gender of Pelteobagrus vishnu, including but not limited to kits and the like.

[0011] The present application has the following beneficial effects: The present application provides an InDel specific molecular marker for genetic gender identification of Pelteobagrus vishnu and application. The whole genome resequencing data of 20 Pelteobagrus vishnu is used to obtain the genetic variation sites of the Pelteobagrus vishnu population at the genome level, combined with the genetic differentiation index (Fst) and the sex dimorphism SNPs / InDels genotype density analysis, a male-specific InDel molecular marker is identified, which is located at 32,904,146 bp on chromosome 23, a 53 bp deletion nucleotide sequence, which is SEQ ID NO. 1. The female does not have the SEQ ID NO. 1 sequence deletion fragment, and the male individual has the SEQ ID NO. 1 sequence deletion fragment. The primer pair is designed to use the sample genomic DNA as a template, and the genetic gender of Pelteobagrus vishnu can be identified only by PCR and agarose gel electrophoresis, which consumes less time, causes less damage to the fish body and is not limited by the age of the fish. It can be applied to the whole life cycle of Pelteobagrus vishnu, which is convenient, fast and more accurate, and is especially suitable for rapid gender identification of a large number of samples. The present application provides basic data for further mining of Pelteobagrus vishnu gender determination genes, and lays a foundation for Pelteobagrus vishnu sex control breeding. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 : Sequence alignment result of primer 32904146-F / R amplification; the symbol “.” in the sequence represents the male sample specific base deletion; the black arrow symbol indicates SEQ ID NO. 2 and SEQ ID NO. 3.

[0013] Figure 2 : Agarose gel electrophoresis diagram of 27 samples of Acipenser dabryanus using the upstream and downstream primers of the sequence shown in SEQ ID NO. 1. DETAILED DESCRIPTION

[0014] The following examples are intended to illustrate the present application but not to limit the scope of the present application.

[0015] The materials, reagents and the like used in the present example. If not specifically stated, the materials and reagents are obtained from commercial channels; the methods not specifically described are conventional experimental methods and can be known from the prior art.

[0016] Example 1: Obtaining sex-specific sites of Acipenser dabryanus (1) Genome resequencing was performed on 20 Acipenser dabryanus. After determining the sex by dissecting the gonads, the fin bar was cut to extract genomic DNA and high-throughput sequencing and data quality control were performed to obtain clean data.

[0017] (2) After aligning the clean data of 10 female fish and 10 male fish to the Acipenser dabryanus male reference genome using BWA software to obtain bam files, the GATK software was used to detect variations on each chromosome to obtain variation sites, and then combined with the genetic differentiation index (Fst) and sex dimorphic SNPs / InDels genotype density analysis method, a total of 1673 sex dimorphic SNPs / InDels sites were obtained, and after final screening, an InDel site located at 32,904,146 bp was obtained, which had male-specific deletion characteristics. The upstream primer was 32904146-F, the nucleotide sequence was shown in SEQ ID NO. 2, and the downstream primer was 32904146-R, the nucleotide sequence was shown in SEQ ID NO. 3. The primers were designed and PCR amplified to successfully identify the sex of Acipenser dabryanus.

[0018] Example 2: Use method of sex-specific InDel site of Acipenser dabryanus (1) Primers were designed for the specific InDel site screened from Example 1, and the primer sequences were as follows: 32904146-F: 5'-ATCACTGAAGGAAAGAAAAG-3' 32904146-R: 5'-AAAGAAGCATGAAAGACACA-3' (2) The genomic DNA of Acipenser dabryanus was extracted as a template, and the above primers were used for PCR amplification. The PCR amplification system was: Premix Taq (containing dNTPs, Mg 2+, Taq DNA polymerase and reaction buffer, Takara Bio) 10 uL, 0.8 uL of each of upstream and downstream primers (10 mM), 1 uL of template DNA, and sterile enzyme-free water to 20 L. The PCR reaction program was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s; 50°C annealing for 30 s; 72°C extension for 45 s, for a total of 32 cycles; final 72°C extension for 10 min; and 4°C storage for standby.

[0019] (3) The PCR amplification product was detected by electrophoresis in a 2.5% agarose gel. If a single specific band is amplified, it is a female individual; if two bands are amplified, it is a male individual.

[0020] Example 3: Application of male-specific molecular marker in gender identification of Acipenser dabryanus (1) Genomic DNA extraction The gender was identified by anatomical observation of the gonad, 16 male fish and 11 female fish of the Yibin population were randomly selected, the tail fin was cut off, and the genomic DNA of each sample was separated and extracted by using the Ezup column genomic DNA extraction method. The DNA concentration and purity were determined by using a Nanodrop spectrophotometer, 2 uL of the DNA sample was detected by agarose gel electrophoresis (1.5% concentration) to detect the integrity of the DNA, and then stored at -20°C for standby.

[0021] (2) PCR amplification The genomic DNA of A. dabryanus extracted in step (1) was used as a template, and PCR amplification was performed by using the primer pair described in Example 2, and the amplification system and amplification program were the same as described in Example 2.

[0022] (3) Analysis of electrophoresis results The PCR amplification product obtained in step (2) was detected by electrophoresis using a 2.5% agarose gel. The agarose gel electrophoresis results are shown in Figure 2 : The primer pair 32904146-F / R amplified a 319 bp band in the DNA samples of 11 female fish, and amplified two bands with lengths of 319 bp and 266 bp in the DNA samples of 16 male fish, wherein the 266 bp band was a male-specific sequence, and the gel electrophoresis diagram is shown in Figure 2 .

[0023] (4) Sequence alignment The PCR product was subjected to 2.5% agarose gel electrophoresis, and it can be seen that there is a difference between male and female individuals. The fragment was recovered and connected to the pGEM-T Easy vector, and then transformed into top10 chemically competent cells, and positive clones were selected for sequencing. The sequencing results confirmed that the amplified band was the target band, thereby confirming that the marker of the application can be used to detect the male and female genders of A. dabryanus.

[0024] The above examples provide a detailed explanation of the present application, but the embodiments of the present application are not limited to the above examples. Any changes made without departing from the spirit of the present application should be included in the scope of protection of the present application.

Claims

1. An InDel specific molecular marker for genetic sex identification of Pelteobagrus vachelli, characterized in that: The sequence of the molecular marker is shown as SEQ ID NO.

1.

2. The molecular marker of claim 1, wherein: The molecular marker is located at 32,904,146 bp on chromosome 23, and is a nucleotide sequence of a 53 bp deletion; the female individual does not have the deletion fragment of SEQ ID NO. 1, and the male individual has the deletion fragment of SEQ ID NO.

1.

3. A primer pair for detecting the molecular marker of claim 1 or 2, thereby identifying the sex of the Pelteobagrus vachelli, characterized in that: The sequence of the primer pair is shown as SEQ ID NO. 2 and SEQ ID NO.

3.

4. A detection method for identifying the gender of Pelteobagrus vachelli, characterized in that: The method comprises the following steps: The genomic DNA of Pelteobagrus vachelli was extracted as a template, and PCR amplification was performed using the above primer pair (SEQ ID NO. 2 and SEQ ID NO. 3) with a PCR amplification system: Premix Taq (containing dNTPs, Mg 2+ , Taq DNA polymerase and reaction buffer, Takara Bio) 10 uL, 0.8 uL of each of upper and lower primers (10 mM), 1 uL of template DNA, and sterile water to 20 L. The PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; annealing for 30 s (the temperature is according to the Tm value of the primer); 72℃ extension for 45 s, for a total of 30 cycles; finally, 72℃ extension for 10 min; and 4℃ preservation. The PCR amplification product is detected by electrophoresis in a 2.5% agarose gel. If a single specific band is amplified, it is a female individual; if two bands are amplified, it is a male individual.

5. A kit for genetic sex identification of Pelteobagrus vachelli, characterized in that: The primer pair of claim 2 is included.

Images